User contributions
From 2012.igem.org
- 03:55, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Parameters) (top)
- 03:55, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Parameters)
- 03:55, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Parameters)
- 03:46, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Parameters)
- 03:28, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling
- 03:27, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/BioreactorSim (→How?)
- 03:27, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/BioreactorSim (→How?)
- 03:24, 27 September 2012 (diff | hist) N File:Team-EPF-Lausanne bioreactor lines.jpg (top)
- 03:22, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/BioreactorSim (→Validation)
- 03:21, 27 September 2012 (diff | hist) N File:Team-EPF-Lausanne bioreactor matlab.zip (top)
- 03:19, 27 September 2012 (diff | hist) File:Team-EPF-Lausanne reactor 60.jpg (uploaded a new version of "File:Team-EPF-Lausanne reactor 60.jpg") (top)
- 03:18, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/BioreactorSim (→How?)
- 03:17, 27 September 2012 (diff | hist) N File:Team-EPF-Lausanne reactor 60.jpg
- 03:16, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/BioreactorSim
- 03:09, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/BioreactorSim (→Validation)
- 03:07, 27 September 2012 (diff | hist) N File:Team-EPF-Lausanne validate.jpg (top)
- 03:06, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/BioreactorSim
- 01:33, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Conclusion)
- 01:30, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Why?)
- 01:28, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Parameters)
- 01:26, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Parameters and conclusions)
- 01:13, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Double binding site)
- 01:07, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 01:06, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 01:04, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 01:03, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 01:02, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 00:59, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Parameters)
- 00:58, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of activated reporter plasmids)
- 00:31, 27 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Parameters?)
- 00:30, 27 September 2012 (diff | hist) N File:Team-EPF-Lausanne Modeling concentrations.jpg (top)
- 23:33, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 23:32, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Double binding site)
- 23:32, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Expression levels)
- 23:31, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 23:30, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Expression levels)
- 23:30, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 23:29, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Photoactivation level)
- 23:27, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Expression levels)
- 23:27, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Photoactivation level)
- 23:22, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of activated reporter plasmids)
- 23:20, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 23:19, 26 September 2012 (diff | hist) N File:Team-EPF-Lausanne Modeling Binding eq miss.png (top)
- 22:53, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 22:51, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 22:51, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 22:49, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 22:49, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a double binding site)
- 22:48, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 22:46, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:45, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:44, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:43, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:43, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:42, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:42, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:41, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:40, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:39, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:39, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:38, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:37, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 22:35, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a single binding site)
- 21:50, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 21:50, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Supposing a tandem binding site)
- 21:49, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 21:47, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of activated reporter plasmids)
- 21:47, 26 September 2012 (diff | hist) N File:Team-EPF-Lausanne path simple tandem.png (top)
- 21:46, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 21:41, 26 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Yang 1996) (top)
- 21:40, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 21:32, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→How?)
- 21:30, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 21:27, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 21:27, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 21:26, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 21:22, 26 September 2012 (diff | hist) File:EPF-Lausanne-Modeling-path simple.png (uploaded a new version of "File:EPF-Lausanne-Modeling-path simple.png") (top)
- 21:07, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 19:52, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 19:32, 26 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Sadowski 1988)
- 19:21, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 18:58, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 18:55, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 18:55, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Number of bound reporter plasmids)
- 18:45, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→What?)
- 18:43, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 17:00, 26 September 2012 (diff | hist) File:EPF-Lausanne-Modeling-path simple.png (uploaded a new version of "File:EPF-Lausanne-Modeling-path simple.png")
- 14:54, 26 September 2012 (diff | hist) N File:File-EPF-Lausanne-Modeling-path simple.png (top)
- 13:45, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Project (→Melanopsin)
- 13:45, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Project (→Melanopsin)
- 13:42, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Project (→Proteins)
- 13:41, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Project (→LOV2)
- 13:40, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Project (→VP16C)
- 13:40, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Project (→VP16)
- 13:39, 26 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Jin 1993)
- 13:20, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Project (→LOV2)
- 13:04, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Project (→TrpR)
- 12:59, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/3D structure
- 11:36, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/3D structure
- 10:10, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→What?)
- 10:08, 26 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Yang 1996)
- 09:49, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling
- 09:47, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (Removed and added to the project page) (top)
- 09:47, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Project (→Proteins)
- 09:40, 26 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Eitoku 2005)
- 09:40, 26 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Yang 1996)
- 09:39, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→What?)
- 09:39, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→What?)
- 09:32, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→What?)
- 09:31, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→What?)
- 09:31, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 09:27, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→What?)
- 09:26, 26 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Hendrik 2005)
- 09:20, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 09:05, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Deactivation parameters)
- 09:02, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 08:52, 26 September 2012 (diff | hist) m Team:EPF-Lausanne/Modeling/LovTAP (→VP16)
- 08:52, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 08:51, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling
- 08:50, 26 September 2012 (diff | hist) N Team:EPF-Lausanne/Modeling/3D structure (Created page with "{{:Team:EPF-Lausanne/Template/Header|3D structure of LovTAP-VP16}} =Building LovTAP-VP16= [[File:Team-EPF-Lausanne_Lit-lit-dimer_dna.png|Fig. 1: A reconstruction of how LovTAP-...")
- 08:49, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression (→Why?)
- 08:32, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 08:22, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→The code)
- 08:21, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→The code)
- 08:20, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→The code)
- 08:20, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→The code)
- 08:18, 26 September 2012 (diff | hist) N File:Team-EPF-Lausanne photodynamics.zip (MATLAB code used for the section Modeling/Photodynamics) (top)
- 07:59, 26 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Results)
- 07:57, 26 September 2012 (diff | hist) N File:Team-EPF-Lausanne photodynamics convergence.jpg (top)
- 07:51, 26 September 2012 (diff | hist) N File:Team-EPF-Lausanne photodynamics plots.m (MATLAB scripts used to plot the photodynamics graphs) (top)
- 07:47, 26 September 2012 (diff | hist) N File:Team-EPF-Lausanne photodynamics.m (MATLAB function used to compute the proportion of LOV2 photoproduct) (top)
- 21:37, 25 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Salomon 2000)
- 18:45, 25 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Eitoku 2005)
- 18:45, 25 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Yao 2008)
- 18:42, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 18:09, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Bioreactor (Replaced content with "{{:Team:EPF-Lausanne/Template/Header|project}} == Cell culture absorbance test == Raw results in File:Team-EPF-Lausanne-cell-culture-absorbance-nanodrop.pdf. {{:Team:...") (top)
- 18:07, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Bioreactor (→Calculations)
- 18:06, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Bioreactor (→Calculations)
- 18:05, 25 September 2012 (diff | hist) N File:Team-EPF-Lausanne Test plate label.png (top)
- 17:46, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Bioreactor
- 17:40, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Bioreactor
- 17:22, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Bioreactor
- 17:17, 25 September 2012 (diff | hist) m Team:EPF-Lausanne (→Not Only Pharma)
- 16:52, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→Conclusions)
- 16:45, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 16:43, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 16:35, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Results)
- 16:32, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Deactivation parameters)
- 16:30, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Activation parameters)
- 16:29, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactivation)
- 16:13, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→What?)
- 16:12, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Why?)
- 16:11, 25 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Schwanhausser 2011)
- 16:11, 25 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 16:01, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Why?)
- 15:42, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Why?)
- 15:38, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Why?)
- 15:37, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Why?)
- 15:32, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 15:11, 25 September 2012 (diff | hist) N File:Team-EPF-Lausanne Lit-lit lit-dark.png (top)
- 15:00, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 14:47, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 14:23, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→Building LovTAP-VP16)
- 14:12, 25 September 2012 (diff | hist) N File:Team-EPF-Lausanne clashes.png (top)
- 14:01, 25 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Fussenegger 2011 et al)
- 13:43, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 12:10, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 12:10, 25 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 12:07, 25 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Strickland 2008)
- 12:07, 25 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 09:38, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→Building LovTAP-VP16)
- 08:51, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→Building LovTAP-VP16)
- 07:53, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→Building LovTAP-VP16)
- 07:29, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→Building LovTAP-VP16)
- 07:28, 25 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 07:26, 25 September 2012 (diff | hist) N File:Team-EPF-Lausanne Lit-lit-dimer dna.png (top)
- 19:58, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 19:55, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 19:33, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 19:33, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Darzacq 2007)
- 19:27, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactivation)
- 19:17, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Deactivation parameters)
- 19:08, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Results)
- 19:03, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Results)
- 19:00, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Results)
- 18:59, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Results)
- 18:58, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation
- 18:50, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 18:25, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Kasahara (2002))
- 18:25, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Salomon (2000))
- 18:25, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Marchesini (1989))
- 18:25, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Hockberger(1999))
- 18:24, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Hockberger (1999))
- 18:13, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation
- 18:04, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 18:03, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 17:58, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Why?)
- 17:58, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation
- 17:55, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Why?)
- 17:03, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation
- 16:45, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Results)
- 16:43, 24 September 2012 (diff | hist) File:Team-EPF-Lausanne photosaturation.jpg (uploaded a new version of "File:Team-EPF-Lausanne photosaturation.jpg") (top)
- 14:12, 24 September 2012 (diff | hist) N File:Team-EPF-Lausanne photosaturation.jpg
- 14:10, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation
- 14:07, 24 September 2012 (diff | hist) N File:Team-EPF-Lausanne photoproduct cycles.jpg (top)
- 08:29, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation
- 08:27, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Dagradation)
- 08:25, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Activation parameters)
- 08:23, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Activation parameters)
- 08:20, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation
- 08:20, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactivation)
- 08:19, 24 September 2012 (diff | hist) N File:Team-EPF-Lausanne Activation model compared Kasahara.jpg (top)
- 08:08, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation
- 08:03, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 08:03, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 08:02, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 08:02, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 08:01, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 08:01, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 08:01, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 08:00, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References
- 07:52, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Kasahara (2002))
- 07:51, 24 September 2012 (diff | hist) Team:EPF-Lausanne/References (→Kasahara (2002))
- 07:50, 24 September 2012 (diff | hist) N Team:EPF-Lausanne/References (Created page with "{{:Team:EPF-Lausanne/Template/Header|References}} ===Kasahara (2002)=== Masahiro Kasahara, Trevor E. Swartz, Margaret A. Olney, Akihiko Onodera, Nobuyoshi Mochizuki, Hideya Fuku...")
- 07:41, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 07:41, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 07:40, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 07:40, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 07:40, 24 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 07:39, 24 September 2012 (diff | hist) N File:Team-EPF-Lausanne dynamics eq dM 2.png (top)
- 07:38, 24 September 2012 (diff | hist) N File:Team-EPF-Lausanne dynamics eq dM 1.png (top)
- 22:33, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 22:33, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 22:32, 23 September 2012 (diff | hist) N File:Team-EPF-Lausanne dynamics eq dN 3.png (top)
- 22:31, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 22:30, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 22:30, 23 September 2012 (diff | hist) N File:Team-EPF-Lausanne dynamics eq dN 2.png (top)
- 22:28, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 22:27, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 22:27, 23 September 2012 (diff | hist) N File:Team-EPF-Lausanne dynamics eq dN 1.png (top)
- 22:23, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 22:23, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 22:23, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 22:22, 23 September 2012 (diff | hist) N File:Team-EPF-Lausanne dynamics eq sigma.png (top)
- 22:14, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Photoactication)
- 22:12, 23 September 2012 (diff | hist) N File:Team-EPF-Lausanne dynamics eq sigma.jpg (top)
- 14:07, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation
- 14:05, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation
- 13:26, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Photoactivation (→Why?)
- 13:25, 23 September 2012 (diff | hist) N Team:EPF-Lausanne/Modeling/Photoactivation (Created page with "{{:Team:EPF-Lausanne/Template/Header|Photoactivation}} =Introduction= ==Why?== Hockberger et al (1999) suggest that blue light up to 470 nm can have some phototoxic effect on m...")
- 10:27, 23 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Bioreactor
- 14:26, 22 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling
- 13:21, 22 September 2012 (diff | hist) Team:EPF-Lausanne/Protocol/Ligation
- 13:17, 22 September 2012 (diff | hist) Team:EPF-Lausanne/Protocol/Ligation
- 13:47, 19 September 2012 (diff | hist) N Team:EPF-Lausanne/Modeling/Structure (Created page with "{{:Team:EPF-Lausanne/Template/Header}} 'What:' {{:Team:EPF-Lausanne/Template/Footer}}") (top)
- 13:40, 19 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 13:13, 17 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 13:12, 17 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 13:12, 17 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 12:29, 17 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 12:14, 17 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 12:12, 17 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 12:07, 17 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Expression
- 12:06, 17 September 2012 (diff | hist) N Team:EPF-Lausanne/Modeling/Expression (Created page with "{{:Team:EPF-Lausanne/Template/Header|Modeling expression levels}} File:EPF-Lausanne-Modeling-path_simple.png {{:Team:EPF-Lausanne/Template/Footer}}")
- 12:05, 17 September 2012 (diff | hist) N File:EPF-Lausanne-Modeling-path simple.png
- 14:12, 15 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→LOV2)
- 14:11, 15 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→LOV2)
- 14:11, 15 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→LOV2)
- 11:04, 14 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→LOV2)
- 11:04, 14 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→LOV2)
- 10:34, 13 September 2012 (diff | hist) Team:EPF-Lausanne/Protocol
- 11:20, 9 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→How LovTAP is thought to work)
- 09:34, 9 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 08:58, 9 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 08:22, 9 September 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→Introduction)
- 15:36, 28 August 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/28 August 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == Minipreps for pGL and pcDNA3.1(+)-LovTAP-VP16 C5 and C6 ...")
- 15:30, 28 August 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Bioreactor
- 15:29, 28 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/27 August 2012 (→Bioreactor: cell culture absorbance test)
- 15:29, 28 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/27 August 2012 (→Bioreactor: cell culture absorbance test)
- 15:28, 28 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/27 August 2012 (→Bioreactor: cell culture absorbance test)
- 15:26, 28 August 2012 (diff | hist) N File:Team-EPF-Lausanne-cell-culture-absorbance-nanodrop.pdf (top)
- 14:47, 28 August 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Bioreactor (→Illuminance test)
- 14:36, 28 August 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/27 August 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == Overnight culture of pGL4.30 backbone plasmid == 5 colo...")
- 14:42, 24 August 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/24 August 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == Ligation of purified PCR products into backbones == {{:...")
- 14:36, 24 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/23 August 2012
- 14:35, 24 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/23 August 2012 (→Agar plate preparation)
- 14:33, 24 August 2012 (diff | hist) N Team:EPF-Lausanne/Protocol/AgarPlates (Created page with "<noinclude>{{:Team:EPF-Lausanne/Template/Header}}</noinclude> {{:Team:EPF-Lausanne/Template/ProtocolHeader|Ampicillin Agar Plates|{{{1|}}}}} <!-- ...")
- 14:22, 24 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/23 August 2012 (→Agar plate preparation)
- 10:10, 23 August 2012 (diff | hist) Team:EPF-Lausanne/Meetings (→Thursday, 23rd August, informal meeting) (top)
- 09:33, 23 August 2012 (diff | hist) Team:EPF-Lausanne/Meetings
- 09:19, 23 August 2012 (diff | hist) Team:EPF-Lausanne/Safety
- 17:11, 20 August 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Bioreactor (→Illuminance test)
- 17:10, 20 August 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Bioreactor (→Illumination)
- 14:13, 20 August 2012 (diff | hist) Team:EPF-Lausanne (→Our solution)
- 12:08, 9 August 2012 (diff | hist) Team:EPF-Lausanne/Planning (→= Microcontroller)
- 12:08, 9 August 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Bioreactor)
- 11:32, 9 August 2012 (diff | hist) Team:EPF-Lausanne/Planning (→✓ TNFR)
- 11:26, 9 August 2012 (diff | hist) Team:EPF-Lausanne/Planning (→✓ Sequence plasmid)
- 11:25, 9 August 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/9 August 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == We have colonies for SEAP and eGFP! == Cultures to be l...")
- 12:08, 8 August 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Fussenegger)
- 12:02, 8 August 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Digest plasmid to check quality)
- 11:59, 8 August 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Get the main plasmid DNA sequence)
- 11:59, 8 August 2012 (diff | hist) Team:EPF-Lausanne/Planning
- 09:58, 8 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/8 August 2012 (→Control of Minipreps: digestion + gel)
- 09:51, 8 August 2012 (diff | hist) Team:EPF-Lausanne/Protocol/RestrictionSiteDigestion
- 09:49, 8 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/8 August 2012
- 09:47, 8 August 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/8 August 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == Miniprep for SEAP and eGPF == {{:Team:EPF-Lausanne/Temp...")
- 21:50, 6 August 2012 (diff | hist) Team:EPF-Lausanne/Sequencing
- 21:48, 6 August 2012 (diff | hist) Team:EPF-Lausanne/Sequencing/melanopsin 06 08 12 (top)
- 13:56, 6 August 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Sequence plasmid)
- 13:49, 6 August 2012 (diff | hist) Team:EPF-Lausanne/Sequencing/melanopsin 06 08 12
- 13:49, 6 August 2012 (diff | hist) Team:EPF-Lausanne/Sequencing/melanopsin 06 08 12
- 13:48, 6 August 2012 (diff | hist) Team:EPF-Lausanne/Sequencing/melanopsin 06 08 12
- 13:48, 6 August 2012 (diff | hist) Team:EPF-Lausanne/Sequencing/melanopsin 06 08 12
- 13:47, 6 August 2012 (diff | hist) N Team:EPF-Lausanne/Sequencing/melanopsin 06 08 12 (Created page with " <nowiki>>1_PHY42_mel_fwd_PHY42_mel_fwd GGCTANNGATTTATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCATGGACTCTCCTTCAGGACCAAGAGTCTTGTCAAGCTTAACTCAGGATCCCAGCTTCACAACCAGTCCTGCCCTGCAAGGCATTTGGAA ...")
- 08:36, 6 August 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP (→= VP16)
- 08:36, 6 August 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 16:32, 5 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/2 August 2012
- 16:29, 5 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/2 August 2012
- 16:28, 5 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/2 August 2012
- 16:21, 5 August 2012 (diff | hist) N File:Team-EPF-Lausanne-Protocols-Gel-2012.08.02-RO.jpg (top)
- 16:20, 5 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/2 August 2012
- 16:11, 5 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/2 August 2012
- 16:10, 5 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/2 August 2012
- 16:10, 5 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/2 August 2012
- 15:54, 5 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/2 August 2012
- 15:42, 5 August 2012 (diff | hist) N File:Team-EPF-Lausanne-Gels-02-08-2012.jpg (Well, none of the bands correspond with what they should...) (top)
- 15:32, 5 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/1 August 2012 (→Afternoon : Digestion of all the plasmids for testing and ligation)
- 16:12, 3 August 2012 (diff | hist) Team:EPF-Lausanne/Notebook/1 August 2012 (→Afternoon : Digestion of all the plasmids for testing and ligation)
- 15:32, 3 August 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/2 August 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == Gel for the [[Team:EPF-Lausanne/Notebook/1_August_2012|p...")
- 10:26, 31 July 2012 (diff | hist) Team:EPF-Lausanne/Meetings (→Tuesday, 31st July, informal meeting)
- 09:46, 31 July 2012 (diff | hist) Team:EPF-Lausanne/Meetings
- 09:32, 31 July 2012 (diff | hist) Team:EPF-Lausanne/Sequencing/LovTAP T7 27 07 2012 (→Compared with just LovTAP) (top)
- 09:31, 31 July 2012 (diff | hist) Team:EPF-Lausanne/Sequencing/LovTAP T7 27 07 2012
- 09:30, 31 July 2012 (diff | hist) Team:EPF-Lausanne/Sequencing
- 09:29, 31 July 2012 (diff | hist) Team:EPF-Lausanne/Sequencing
- 08:48, 31 July 2012 (diff | hist) N Team:EPF-Lausanne/Sequencing/lovtap reverse 31 7 12 (Created page with "Comparison of the two ordered sequnces. For the forward sequence I had to tel SerialCloner it's Antiparallel: <nowiki> Alignment of Sequence_1: [sequencing_lovtap_reverse.xdna...") (top)
- 08:28, 31 July 2012 (diff | hist) Team:EPF-Lausanne/Modeling/LovTAP
- 07:28, 31 July 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/31 July 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == Plate with PHY42 transformed bacteria moved to fridge ==...")
- 07:26, 31 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/30 July 2012
- 15:00, 30 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/30 July 2012 (→Miniprep for pMP and PGL4.30)
- 14:59, 30 July 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/30 July 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == Miniprep for pMP and PGL4.30 == {{:Team:EPF-Lausanne/Te...")
- 13:38, 30 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/PreparePlasmidExtraction
- 13:20, 30 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/MiniPrep
- 18:21, 29 July 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/29 July 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == Title == {{:Team:EPF-Lausanne/Template/LabPresence|Alex...")
- 15:44, 27 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/27 July 2012
- 10:28, 27 July 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Bioreactor (→Illumination)
- 10:18, 27 July 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Bioreactor (→Illumination)
- 10:08, 27 July 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Bioreactor (→Illumination)
- 09:47, 27 July 2012 (diff | hist) N Team:EPF-Lausanne/Sequencing (Created page with "LovTAP with T7 primer, got on July the 27th")
- 09:45, 27 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook
- 09:45, 27 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook
- 09:41, 27 July 2012 (diff | hist) N Team:EPF-Lausanne/Sequencing/ (Created page with "Sequencing of the original LovTAP plasmid after our first maxiprep using the T7 primer. Got on July the 27th.") (top)
- 09:39, 27 July 2012 (diff | hist) N Team:EPF-Lausanne/Sequencing/LovTAP T7 27 07 2012 (Created page with "Seq_2 is the plasmid we thought we had, and Seq_2 is the sequencing result using the T7 primer: <nowiki>Alignment of Sequence_1: [Sequence Window #2] with Sequence_2: [Untitl...")
- 14:03, 26 July 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Bioreactor (→Illumination)
- 14:01, 26 July 2012 (diff | hist) Team:EPF-Lausanne/Modeling/Bioreactor
- 14:01, 26 July 2012 (diff | hist) Team:EPF-Lausanne/Modeling
- 14:01, 26 July 2012 (diff | hist) Team:EPF-Lausanne/Modeling
- 14:00, 26 July 2012 (diff | hist) N Team:EPF-Lausanne/Modeling/Bioreactor (Created page with "= Illumination = In Strickland's paper, it's mentioned that they used 8000 mcd LEDs from [theledlight.com], with 20º viewing angle and 468 nm at 3.4 V. It's also mentioned tha...")
- 13:51, 26 July 2012 (diff | hist) Team:EPF-Lausanne/Modeling
- 13:50, 26 July 2012 (diff | hist) N Team:EPF-Lausanne/Modeling/LovTAP (Created page with "{{:Team:EPF-Lausanne/Template/Header}} = Introduction = == How LovTAP is thought to work == === Allosteric regulation === In a protein, generally an enzyme, an allosteric sit...")
- 10:20, 26 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Buy LED sticks? - Diego)
- 23:46, 16 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→LovTAP)
- 17:59, 16 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/16 July 2012 (→Plasmid digestion and gel)
- 17:58, 16 July 2012 (diff | hist) N File:Team-EPF-Lausanne-gel-16.07.12.jpg (1,2: 1kb ladder. 3,4: LovTAP maxiprep 5,6: RO maxiprep)
- 17:38, 16 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Transient transfection -Alex, Mouna, June)
- 17:38, 16 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Transient transfection)
- 17:37, 16 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Transient transfection)
- 17:27, 16 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→✓ Maxiprep)
- 17:27, 16 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→✓ Maxiprep)
- 14:52, 13 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Bioreactor)
- 14:51, 13 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Bioreactor: Buy LED sticks?)
- 14:48, 13 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/13 July 2012 (top)
- 14:37, 13 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/13 July 2012 (→Finish MaxiPrep)
- 14:36, 13 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol (DNA)
- 14:35, 13 July 2012 (diff | hist) N Team:EPF-Lausanne/Protocol/DNAConcentration (Created page with "<noinclude>{{:Team:EPF-Lausanne/Template/Header}}</noinclude> {{:Team:EPF-Lausanne/Template/ProtocolHeader|DNA concentration measurement|{{{1|}}}}} <!-- ...")
- 14:22, 13 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/13 July 2012 (DNA concestration)
- 11:06, 13 July 2012 (diff | hist) Team:EPF-Lausanne/Modeling
- 07:44, 13 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/12 July 2012
- 15:07, 12 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Original LovTAP plasmid)
- 15:03, 12 July 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/12 July 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == Maxiprep == 2 maxipreps using 200 ml of LB each, for RO...")
- 14:54, 12 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/29 June 2012 (→Morning)
- 09:10, 12 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→LovTAP: Details on RO plasmid transformation)
- 08:53, 12 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→Safety)
- 08:35, 12 July 2012 (diff | hist) Team:EPF-Lausanne/Planning (→✓ Competent cell preparation)
- 08:23, 12 July 2012 (diff | hist) Team:EPF-Lausanne/Planning
- 08:13, 12 July 2012 (diff | hist) Team:EPF-Lausanne/Template/Header (Old menu removed)
- 16:34, 11 July 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/11 July 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == Morning == {{:Team:EPF-Lausanne/Template/LabPresence|San...")
- 16:50, 10 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/10 July 2012 (→Afternoon: transformation) (top)
- 16:49, 10 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/10 July 2012 (→Afternoon: transformation)
- 16:48, 10 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/10 July 2012
- 16:45, 10 July 2012 (diff | hist) m Team:EPF-Lausanne/Protocol/Transformation
- 16:31, 10 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/4 July 2012 (→Gel electrophoresis)
- 16:30, 10 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/4 July 2012 (→Gel electrophoresis)
- 16:30, 10 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/4 July 2012 (→Gel electrophoresis: Added picture)
- 15:29, 10 July 2012 (diff | hist) N File:Team-EPF-Lausanne-Protocols-Gel-2012.07.04 - RO.jpg (Gel run the 4th of July 2012. See notebook for details.) (top)
- 14:04, 10 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/10 July 2012 (→Morning: agar plates)
- 14:00, 10 July 2012 (diff | hist) m Team:EPF-Lausanne/Notebook/10 July 2012 (→Morning: agar plates)
- 13:59, 10 July 2012 (diff | hist) N Team:EPF-Lausanne/Protocol/Agar plate (Created page with "<noinclude>{{:Team:EPF-Lausanne/Template/Header}}</noinclude> {{:Team:EPF-Lausanne/Template/ProtocolHeader|Agar LB plate preparation|{{{1|}}}}} <!-- ...") (top)
- 13:46, 10 July 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/10 July 2012 (Agar plates)
- 13:40, 10 July 2012 (diff | hist) Team:EPF-Lausanne (First draft)
- 09:23, 9 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/Gel
- 09:19, 9 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/RestrictionSiteDigestion (Protocol based on july 4th added)
- 08:05, 9 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/6 July 2012 (→05.07.12 transfection: Corrected ELISA room number)
- 14:02, 6 July 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/6 July 2012 (Just a draft)
- 13:55, 6 July 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/5 July 2012 (Just a draft)
- 15:31, 4 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/Gel
- 15:20, 4 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/4 July 2012
- 15:10, 4 July 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/4 July 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> == Digestion == {{:Team:EPF-Lausanne/Template/LabPresence|...")
- 14:30, 4 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/Gel (Added ladder preparation)
- 14:25, 4 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/Gel
- 14:23, 4 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/Gel
- 13:40, 4 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/Gel (Added image of ladder)
- 13:38, 4 July 2012 (diff | hist) N File:Team-EPF-Lausanne-Protocols-1kb-ladder.gif (Gel electrophoresis, 1kb ladder) (top)
- 01:09, 2 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/13 June 2012 (→Gel electrophoresis)
- 01:07, 2 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/Gel
- 00:51, 2 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/RestrictionSiteDigestion (Added unfinished warning)
- 00:50, 2 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/13 June 2012 (→Gel electrophoresis)
- 00:45, 2 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/13 June 2012 (Added details on what was done for digestion)
- 23:53, 1 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/RestrictionSiteDigestion
- 23:50, 1 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/13 June 2012
- 23:41, 1 July 2012 (diff | hist) N Team:EPF-Lausanne/Protocol/RestrictionSiteDigestion (Created page with "<noinclude>{{:Team:EPF-Lausanne/Template/Header}}</noinclude> {{:Team:EPF-Lausanne/Template/ProtocolHeader|Restriction site digestion|{{{1|}}}}} <!-- ...")
- 18:42, 1 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol (Added digestion protocol)
- 18:41, 1 July 2012 (diff | hist) N Team:EPF-Lausanne/Restriction site digestion (Just started, from the lab notebook) (top)
- 18:36, 1 July 2012 (diff | hist) N Team:EPF-Lausanne/Notebook/13 June 2012 (Created page with "{{:Team:EPF-Lausanne/Template/Header}} {{:Team:EPF-Lausanne/Template/NotebookHeader}} <!-- Content between here --> {{:Team:EPF-Lausanne/Template/LabPresence|Andrei, June, D...")
- 18:29, 1 July 2012 (diff | hist) N File:Team-EPF-Lausanne Notebook 13 June 2012 gelbands.jpg (First time running a gel of the digested lovTAP plasmid. First well from the left is the ladder. Seventh is the non-digested plasmid. In the rest we can see the 2 expected bands, though not exactly in the expected place.) (top)
- 14:43, 1 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol (Gel protocol added)
- 14:41, 1 July 2012 (diff | hist) Team:EPF-Lausanne/Notebook/29 June 2012 (→Afternoon: Mention to the gel)
- 14:38, 1 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/Gel
- 14:31, 1 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/Gel
- 14:30, 1 July 2012 (diff | hist) N Team:EPF-Lausanne/Protocol/Gel (Created page with "<noinclude>{{:Team:EPF-Lausanne/Template/Header}}</noinclude> {{:Team:EPF-Lausanne/Template/ProtocolHeader|Gel electrophoresis|{{{1|}}}}} <!-- ...")
- 14:05, 1 July 2012 (diff | hist) Team:EPF-Lausanne/Protocol/MiniPrep