Team:University College London/LabBook/Week9
From 2012.igem.org
Contents |
Monday 6.7.12
Aim: Inoculate the Plates that were transformed on Thursday. On Thursday we began Expt 8.5 by transforming the BioBricks, and our results on Friday indicated there was growth for all. (However, the negative control was contaminated, so we will have to be careful to assess the analytical restriction digest for correct products). The table below describes the BioBricks that were used:
The two constitutive promoters were used because we were never able to detect our previous constitutive promoter BBa_J23119 (Expt 7.3) and our 3A ligation of BBa_J23119 and BBa_B0034 failed (Expt 8.4). This does not necessarily indicate our transformation of BBa_J23119 has failed, but we decided to transform several more in case. The RBS promoter BBa_B0030 was transformed for the same reason. The Gas Vesicle Cluster was transformed because all previous attempts have failed.
Method
Step 2 - Inoculating Colonies into a Selective Broth:: Add Yul of antibiotic to reach desired antibiotic concentration.
(For Ampicillin this is 50ug/ml, For Kanamycin it is 25ug/ml, for Tetracycline it is 15ug/ml, and for Chloramphenicol it is 25ug/ml)
Step 4 – Selecting a Colony: Select a clear, isolated colony and using an inoculation hoop scoop up a colony onto the tip. Deposit in the falcon tube
Step 5 - Culture: Culture your falcon tubes overnight at a temperature of 37 oC. Leave for no longer than 16 hours.
Step 2 – Inoculating Colonies into a Selective Broth: The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.
Samples | Volume Inoculated | Broth (ml) | Antibiotic (ug/ml) | |
---|---|---|---|---|
BioBrick | BBa_J23100 | 10ul | Lysogeny Broth (5) | Ampicillin(50ug/ml) |
90ul | ||||
BBa_J23106 | 10ul | |||
90ul | ||||
BBa_B0030 | 10ul | |||
90ul | ||||
BBa_I750016 | 10ul | |||
90ul |
Tuesday 7
Aim: Results from Colony Picking
ResultsThe table below indicates there was growth for all BioBricks.
Biobrick | Growth |
---|---|
1750016 sample 1 | No Growth |
1750016 sample 2 | No Growth |
1750016 sample 3 | No Growth |
B0030 sample 1 | No Growth |
B0030 sample 2 | No Growth |
B0030 sample 3 | No Growth |
J23100 sample 1 | No Growth |
J23100 sample 2 | No Growth |
J23100 sample 3 | No Growth |
J23106 sample 1 | Growth |
J23106 sample 1 | Growth |
J23106 sample 1 | Growth |
Conclusion: We are unsure why we have failed to get colonies for many of the BioBricks. Again, we are considering the possibility that our agar is not selective enough. Initially we thought this may be due to adding Antibiotic while the agar is too hot, leading to degradation of the sample. However this has been corrected in the protocol, but the problem is persisting. Instead we are considering running a troubleshoot by testing the selectivity of the various eppendorfs of antibiotic stocks we made at the beginning of the summer. If any show less selectivity then we can stop using them. This will be considered for later in the week. Meanwhile, we can miniprep and nanodrop BBa_J23106 (strong constitutive promoter)
Step 1 - Pellet Cells: Pellet 1.5-5ml bacterial culture containing the plasmid by centrifugation g = 6000
Time = 2 min
Temperature = (15-25oC)
Step 2 - Resuspend Cells: Add 250ul S1 to the pellet and resuspend the cells completely by vortexing or pipetting. Transfer the suspension to a clean 1.5ml microcentrifuge tube.
Step 3 - Puncturing Cell Membrane: Add 250ul S2 gently mix by inverting the tube 4-6 times to obtain a clear lysate. Incubate on ice or at room temperature for NOT longer than 5 min.
Step 4 - Neutralising S2: Add 400ul Buffer NB and gently mix by inverting the tube 6-10 times, until a white precipitate forms.
Step 5 - Centrifuge:
g: 14000
Time:10 minutes
Temperature: (15-25oC)
Step 6 - Centrifuge: Transfer the supernatant into a column assembled in a clean collection tube (provided. Centrifuge:
g = 10,000
Time: 1 minute
Temperature: (15-25oC)
Step 7 - Wash Column: Discard the flow-through and wash the spin column by adding 700ul of Wash Buffer. Centrifuge:
g - 10,000
Time - 1 minute
Temperature: (15-25oC)
Step 8 - Remove residual ethanol: Centrifuge:
g - 10,000
Time - 1 minute
Temperature: (15-25oC)
Step 9 - Elute DNA: Place the column into a clean microcentrifuge tube. Add 50-100ul of Elution Buffer, TE buffer or sterile water directly onto column membrane and stand for 1 min. Centrifuge:
g - 10,000
Time - 1 minute
Temperature: (15-25oC)
Step 10 - Storage: Store DNA at 4oC or -20oC
Software ND-1000 Model:
Step 1: Initialise the spectrophotometer by pipetting 1 µ of clean water onto lower optic surface, lowering the lever arm and selecting ‘initialise’ in the ND-1000 software
Step 2: Wipe and add elution buffer as negative control. Click blank in ND-1000 software
Step 3: Wipe and add 1 µl sample
Step 4: On the software set lambda to 260nm
Step 5: Lower the lever arm and click measure in ND-1000 software
Step 6: Take readings for concentration and purity
Step 7: Once measurement complete, wipe surface
?What happened next?
Monday 6.7.12
Aim: Repeat the inoculation of the ligation products (J23119 + B0034) done last week. Innoculation is only done for the (J23119 + B0034), but not for the (starvation promoter + B0034) because that ligation did not transform.
Method
Step 2 - Inoculating Colonies into a Selective Broth:: Add Yul of antibiotic to reach desired antibiotic concentration.
(For Ampicillin this is 50ug/ml, For Kanamycin it is 25ug/ml, for Tetracycline it is 15ug/ml, and for Chloramphenicol it is 25ug/ml)
Step 4 – Selecting a Colony: Select a clear, isolated colony and using an inoculation hoop scoop up a colony onto the tip. Deposit in the falcon tube
Step 5 - Culture: Culture your falcon tubes overnight at a temperature of 37 oC. Leave for no longer than 16 hours.
Step 2 – Inoculating Colonies into a Selective Broth: The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.
Ligation | No. innoculations | Broth | Antibiotic |
---|---|---|---|
J23119 + B0034 | 3 |
Tuesday 7
Aim: Check results of Colony Picking
Results: The table below indicates whether there was growth for the BioBricks ligations
Ligation | Growth/No Growth |
---|---|
J23119+B0034 sample 1 | Growth |
J23119+B0034 sample 2 | Growth |
J23119+B0034 sample 3 | Growth |
Conclusion: We can proceed now to miniprep the samples, and run them on a gel to test the presence of a band
Method:
Step 1 - Pellet Cells: Pellet 1.5-5ml bacterial culture containing the plasmid by centrifugation g = 6000
Time = 2 min
Temperature = (15-25oC)
Step 2 - Resuspend Cells: Add 250ul S1 to the pellet and resuspend the cells completely by vortexing or pipetting. Transfer the suspension to a clean 1.5ml microcentrifuge tube.
Step 3 - Puncturing Cell Membrane: Add 250ul S2 gently mix by inverting the tube 4-6 times to obtain a clear lysate. Incubate on ice or at room temperature for NOT longer than 5 min.
Step 4 - Neutralising S2: Add 400ul Buffer NB and gently mix by inverting the tube 6-10 times, until a white precipitate forms.
Step 5 - Centrifuge:
g: 14000
Time:10 minutes
Temperature: (15-25oC)
Step 6 - Centrifuge: Transfer the supernatant into a column assembled in a clean collection tube (provided. Centrifuge:
g = 10,000
Time: 1 minute
Temperature: (15-25oC)
Step 7 - Wash Column: Discard the flow-through and wash the spin column by adding 700ul of Wash Buffer. Centrifuge:
g - 10,000
Time - 1 minute
Temperature: (15-25oC)
Step 8 - Remove residual ethanol: Centrifuge:
g - 10,000
Time - 1 minute
Temperature: (15-25oC)
Step 9 - Elute DNA: Place the column into a clean microcentrifuge tube. Add 50-100ul of Elution Buffer, TE buffer or sterile water directly onto column membrane and stand for 1 min. Centrifuge:
g - 10,000
Time - 1 minute
Temperature: (15-25oC)
Step 10 - Storage: Store DNA at 4oC or -20oC
Preparing the Gel
Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water
Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.
Step 3: Cool solution under running cold water.
Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)
Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles
Running a gel
Step 6: Add 1 part loading buffer to five parts of loading sample
Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm
Step 8: Add 5ul of DNA ladder to lane 1
Step 9: Add samples to the remaining wells
Step 10: Run at 100 volts for 1hour and 15 minutes
Imaging the Gel
Step 11: Place gel in GelDoc 2000 chamber
Step 12: Turn GelDoc 2000 chamber on
Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire
Step 14: Alter the exposure/settings to give a clear image.
TAE - Tris-acetate-EDTA
EDTA - ethylenediamine tetraacetic acid
?What do we conclude from the gel?
Monday 8.8.12
Aim: To repeat Expt 8.2, where we undertook PCR amplification of PSB1A3, PSB1C3, PSB1K3 for 3A assembly. While we achieved bands of the correct size for all three plasmid backbones in Expt 8.2, the nanodrop concentration for PSB1A3 and PSB1C3 was very low (unusable). Therefore we decided to repeat the PCR. As the concentration of PSB1K3 was not particularly high, we decided to repeat this again also.
Method:
PCR protocol ??
Preparing the Gel
Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water
Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.
Step 3: Cool solution under running cold water.
Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)
Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles
Running a gel
Step 6: Add 1 part loading buffer to five parts of loading sample
Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm
Step 8: Add 5ul of DNA ladder to lane 1
Step 9: Add samples to the remaining wells
Step 10: Run at 100 volts for 1hour and 15 minutes
Imaging the Gel
Step 11: Place gel in GelDoc 2000 chamber
Step 12: Turn GelDoc 2000 chamber on
Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire
Step 14: Alter the exposure/settings to give a clear image.
TAE - Tris-acetate-EDTA
EDTA - ethylenediamine tetraacetic acid
Conclusion: There were no products on the gel. We feel the poor nanodrop results from Expt 8.2, and the poor electrophoresis results from this Expt may be a result of the choice of polymerase. Our supervisors recommended we try Phusion Polymerase, which we will attempt tomorrow.
Tuesday 9.8.12
Aim: To repeat PCR with Phusion Polymerase to amplify the three plasmid backbones. As we had more confidence that this PCR reaction would work, we included an extra plasmid, pSB1T3, also required for ligation.
Method PCR
Preparing the Gel
Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water
Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.
Step 3: Cool solution under running cold water.
Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)
Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles
Running a gel
Step 6: Add 1 part loading buffer to five parts of loading sample
Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm
Step 8: Add 5ul of DNA ladder to lane 1
Step 9: Add samples to the remaining wells
Step 10: Run at 100 volts for 1hour and 15 minutes
Imaging the Gel
Step 11: Place gel in GelDoc 2000 chamber
Step 12: Turn GelDoc 2000 chamber on
Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire
Step 14: Alter the exposure/settings to give a clear image.
TAE - Tris-acetate-EDTA
EDTA - ethylenediamine tetraacetic acid
Conclusion: Bands were detected, for all but one plasmid backbone (at the right region) INSERT PIC
Thursday 10.8.12
Aim: To carry out nanodrop for the PCR reaction of plasmids with phusion polymerase
Method
Software ND-1000 Model:
Step 1: Initialise the spectrophotometer by pipetting 1 µ of clean water onto lower optic surface, lowering the lever arm and selecting ‘initialise’ in the ND-1000 software
Step 2: Wipe and add elution buffer as negative control. Click blank in ND-1000 software
Step 3: Wipe and add 1 µl sample
Step 4: On the software set lambda to 260nm
Step 5: Lower the lever arm and click measure in ND-1000 software
Step 6: Take readings for concentration and purity
Step 7: Once measurement complete, wipe surface
Plasmid | λ260 | λ 280 |
---|---|---|
PSB1A3 (ng/μl) | 45.7 | 45.4 |
PSB1C3 (ng/μl) | 52.2 | 48.0 |
PSB1K3 (ng/μl) | 57.9 | 59.4 |
Conclusion: The results of the nanodrop indicate that we have usable concentrations of the plasmids, though they are not particularly high. However, we can attempt to use these for 3A ligation.
Wednesday 8.8.12
Aim: To extract the Laccase gene for the Degradation module and the irrE gene for the Salt Tolerance module.
Method:
Protocol: Extracting Colony DNA (irrE) - in notes???
Protocol: Genomic Extraction
Protocol: Primer Design
Step?: The design of the primers is shown by the table below
Protocol: PCR
Step?: The table below gives the identity of the primers used for each reaction.
DNA Extracted | Function | Module | Primer Pair | Primer | Primer Sequence |
---|---|---|---|---|---|
BBa_K729002 | Laccase Gene | Degradation | LR1/LF1 | LR1 | gaatacggtctttttataccg |
LF1 | gaaataactatgcaacgtcg | ||||
REVLF2/LFTW0 | REVLF2 | gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg | |||
LFTW0 | gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg | ||||
BBa_K729001 | irrE | Salt Tolerance | STF1/ST2R | STF1 | atggggccaaaagctaaagctgaagcc |
ST2R | tcactgtgcagcgtcctgcg | ||||
STF3/ST4R | STF3 | gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc | |||
ST4R | gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg |
9-3
9-4
9-5
9-6