"
Team:University College London/LabBook/Week12
From 2012.igem.org
(→11.4) |
(→27.8.12) |
||
| Line 6: | Line 6: | ||
== 27.8.12 == | == 27.8.12 == | ||
| - | |||
| - | ''' | + | '''Aim'''- Repeat inocculation of nuclease + curli ligation transformations. Inoculation was repeated due to no growth the first time round. |
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html> | <html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html> | ||
Revision as of 00:43, 27 September 2012
27.8.12
Aim- Repeat inocculation of nuclease + curli ligation transformations. Inoculation was repeated due to no growth the first time round.
Step 2 - Inoculating Colonies into a Selective Broth:: Add Yul of antibiotic to reach desired antibiotic concentration.
(For Ampicillin this is 50ug/ml, For Kanamycin it is 25ug/ml, for Tetracycline it is 15ug/ml, and for Chloramphenicol it is 25ug/ml)
Step 4 – Selecting a Colony: Select a clear, isolated colony and using an inoculation hoop scoop up a colony onto the tip. Deposit in the falcon tube
Step 5 - Culture: Culture your falcon tubes overnight at a temperature of 37 oC. Leave for no longer than 16 hours.
Monday 27.8.12
Aim: To find the right concentration of W3110 E. coli cells in LB that would be later used to streak out on the agar plates to obtain an optimal amount of colonies.
Methods: 1. The colony was inoculated the night before in 10ml of LB plus 10 ul CMP 2. The day after 5 dilutions were made from the sample 3. First solution - 1ml of the original solution & 4ml of the LB Second – 1ml of the first solution & 4ml of the LB Third – 1 ml of the second solution & 4ml of the LB Fourth – 1 ml of the third solution & 4ml of the LB Fifth – 1ml of the fourth solution & 4ml of the LB
Tuesday 28/08
Aim: (on Monday grew WNu o/n in prep for miniprep. This miniprep will be used as a template for pcr of a 2nd nuclease.
Not the synthesised staph aureus nuclease (Plan A). The Wnu Nuclease is considered our plan B.
Methods: (10ul cells, 10ul, amp, 10ml (LB). Wnu cells were obtained from a glycerol stock.
Optimal number of colonies was achieved using the fourth solution/dilution (24 colonies). Using the dilution number 4 we plated out 12 plates.
Wednesday 29/08 Aim: To test whether IPTG induces the lac promoter. Method: we applied HCL to the plates previously streaked. On addition of HCL, DNA precipitates out of solution producing a cloudy appearance. The absence of DNA, due to Nuclease activity, creates cleared zones around colonies.
Friday 31/08 Nuclease test: 21 plates, three plates tested (HCL applied every time) every time, every three hours.
27.8.12
Aim - Amplify irrE from Deinococcus radiodurans.
Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below
| PCR Components | Volume (ul) |
|---|---|
| 5x Reaction Buffer | 10 |
| 25mM MgCl2 | 4 |
| 10mM dNTPs | 1 |
| 10uM Forward primer | 5 |
| 10uM Reverse primer | 5 |
| DNA Polymerase | 0.25 |
| Nuclease Free Water | 24.25 |
| Template DNA | 0.5 |
| Total Volume | 0.5 |
Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.
| PCR conditions | Temp (oC) | Time (s) |
|---|---|---|
| Initial Denaturation (1 cycle) | 95 | 30 |
| Denaturation/Annealing/Extension (30 cycles) | 95/55/72 | 10/25/120 |
| Final Extension (1 cycle) | 72 | 600 |
| Hold | 4 | ∞ |
Method
Colony PCR was preformed on Deinococcus radiodurans. 5uL of colony matter was resuspended in 10uL dH2O and added to boiling water in a screw top vial,and left to return to ambient room temperature.
1uL was used as PCR template. The following reaction was set up in 50uL:
All primers were prepared to a concentration of 1pmol.uL, from 100pmol.uL stocks. Primers ordered from MWG operon
Step 1 - Setting up PCR tubes: The table below gives the identity of the primers used for each reaction.
| DNA Template | Function | Module | Primer Pair | Primer | Primer Sequence |
|---|---|---|---|---|---|
| Deinococcus radioduran colony | irrE | Salt Tolerance | STF1/ST2R | STF1 | atggggccaaaagctaaagctgaagcc |
| ST2R | tcactgtgcagcgtcctgcg | ||||
| STF3/ST4R | STF3 | gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc | |||
| ST4R | gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg | ||||
| No Template (Negative Control) | N/A | Salt Tolerance | STF1/STF2 | STF1 | atggggccaaaagctaaagctgaagcc |
| ST2R | tcactgtgcagcgtcctgcg |
Results:
PCR successful, band corresponding to approx 930bp length.
PCR cleanup of Irre followed with Anachem PCR cleanup kit.
Concentration determined by nanodrop: 9ng.uL-1
Conclusion: We will revise the protocol to see if we can detect any bands.
