Team:University College London/LabBook/Week10

From 2012.igem.org

(Difference between revisions)
(Tuesday 14.8.12)
(Tuesday 14.8.12)
Line 45: Line 45:
-
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered,
+
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered.
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}
 +
 +
 +
 +
== Wednesday 15.08.12 ==
 +
 +
 +
Aim: Repeat the PCR again to optimise results. As an improvement we are using:
 +
- Phusion polymerase
 +
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday.
 +
- Changing the annealing temperature from 55C to 57C
 +
 +
Method
 +
 +
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html>
 +
 +
Step 1 - Setting up PCR tubes: The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.

Revision as of 11:28, 24 August 2012

Contents

Tuesday 14.8.12

Aim - Repeat experiment 9.2: We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.

Method

PCR Protocol

Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below

PCR Components Volume (ul)
5x Reaction Buffer 10
25mM MgCl2 4
10mM dNTPs 1
10uM Forward primer 5
10uM Reverse primer 5
DNA Polymerase 0.25
Nuclease Free Water 24.25
Template DNA 0.5
Total Volume 0.5

Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.

PCR conditions Temp (oC) Time (s)
Initial Denaturation (1 cycle) 95 30
Denaturation/Annealing/Extension (30 cycles) 95/55/72 10/25/120
Final Extension (1 cycle) 72 600
Hold 4


Step 1 - Setting up PCR tubes: The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2.

DNA Template Function Module Primer Pair Primer Primer Sequence
BBa_K729002 Laccase GeneDegradation LR1/LF1 LR1 gaatacggtctttttataccg
LF1 gaaataactatgcaacgtcg
REVLF2/LFTW0 REVLF2 gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg
LFTW0 gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg
No Template (Negative Control) N/A Degradation LR1/LF1LR1 gaatacggtctttttataccg
LF1 gaaataactatgcaacgtcg
BBa_K729001 irrESalt Tolerance STF1/ST2RSTF1 atggggccaaaagctaaagctgaagcc
ST2R tcactgtgcagcgtcctgcg
STF3/ST4R STF3 gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc
ST4R gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg
No Template (Negative Control) N/A Salt Tolerance STF1/STF2STF1 atggggccaaaagctaaagctgaagcc
ST2R tcactgtgcagcgtcctgcg


Results: The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered.


Wednesday 15.08.12

Aim: Repeat the PCR again to optimise results. As an improvement we are using: - Phusion polymerase - Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. - Changing the annealing temperature from 55C to 57C

Method

PCR Protocol

Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below

PCR Components Volume (ul)
5x Reaction Buffer 10
25mM MgCl2 4
10mM dNTPs 1
10uM Forward primer 5
10uM Reverse primer 5
DNA Polymerase 0.25
Nuclease Free Water 24.25
Template DNA 0.5
Total Volume 0.5

Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.

PCR conditions Temp (oC) Time (s)
Initial Denaturation (1 cycle) 95 30
Denaturation/Annealing/Extension (30 cycles) 95/55/72 10/25/120
Final Extension (1 cycle) 72 600
Hold 4


Step 1 - Setting up PCR tubes: The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.


9-4

<img id="10-1" src="Ucl2012-labbook-graph10-1.png" />

</html>

10-1