Team:University College London/LabBook/Week10

From 2012.igem.org

(Difference between revisions)
(→9-2)
(→Tuesday 14.8.12)
Line 12: Line 12:
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2.  
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2.  
 +
 +
{| class="wikitable"
 +
|-
 +
! DNA Extracted !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence
 +
|-
 +
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg
 +
|-
 +
|  LF1|| gaaataactatgcaacgtcg
 +
|-
 +
|  rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg
 +
|-
 +
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg
 +
|-
 +
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc
 +
|-
 +
|  ST2R ||tcactgtgcagcgtcctgcg
 +
|-
 +
|  rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc
 +
|-
 +
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg
 +
|}
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered,  
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered,  

Revision as of 09:33, 24 August 2012

Tuesday 14.8.12

Aim - Repeat experiment 9.2: We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.

Method

PCR Protocol

Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below

PCR Components Volume (ul)
5x Reaction Buffer 10
25mM MgCl2 4
10mM dNTPs 1
10uM Forward primer 5
10uM Reverse primer 5
DNA Polymerase 0.25
Nuclease Free Water 24.25
Template DNA 0.5
Total Volume 0.5

Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.

PCR conditions Temp (oC) Time (s)
Initial Denaturation (1 cycle) 95 30
Denaturation/Annealing/Extension (30 cycles) 95/55/72 10/25/120
Final Extension (1 cycle) 72 600
Hold 4 ∞


Step 1 - Setting up PCR tubes: The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2.

DNA Extracted Function Module Primer Pair Primer Primer Sequence
BBa_K729002 Laccase GeneDegradation LR1/LF1 LR1 gaatacggtctttttataccg
LF1 gaaataactatgcaacgtcg
REVLF2/LFTW0 REVLF2 gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg
LFTW0 gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg
BBa_K729001 irrESalt Tolerance STF1/ST2RSTF1 atggggccaaaagctaaagctgaagcc
ST2R tcactgtgcagcgtcctgcg
STF3/ST4R STF3 gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc
ST4R gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg

Results: The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered,



9-4

<img id="10-1" src="Ucl2012-labbook-graph10-1.png" />

</html>

10-1

Retrieved from "http://2012.igem.org/Team:University_College_London/LabBook/Week10"