Team:University College London/LabBook/Week12

From 2012.igem.org

(Difference between revisions)
(Created page with "{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index....")
(→Friday 31/08)
 
(48 intermediate revisions not shown)
Line 2: Line 2:
</html>{{:Team:University_College_London/templates/labbookmenu}}<html>
</html>{{:Team:University_College_London/templates/labbookmenu}}<html>
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" />
-
<img id="11.4" src="https://static.igem.org/mediawiki/2012/1/13/Ucl2012-labbook-graph7-1.png" />
+
<img id="11.4" src="https://static.igem.org/mediawiki/2012/3/35/Ucl2012-labbook-graph1211-4.png" />
<div class="experimentContent"></html>
<div class="experimentContent"></html>
-
== 11.4 ==
+
==27.8.12==
 +
 
 +
 
 +
'''Aim'''- Repeat inocculation of nuclease + curli ligation transformations. Inoculation was repeated due to no growth the first time round.
 +
 
 +
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html>
 +
 
 +
 
 +
==30.08.12==
 +
 
 +
'''Aim'''- To carry out mini-prep of curli+TT and Nuclease + CP DNA from the previous day’s inoculations.
 +
 
 +
'''Results'''- Once the mini-prep was carried out, the concentration of each sample was measured, and the following results obtained:
 +
 
 +
{| class="wikitable"
 +
!Sample !!Concentration !!Notes
 +
|-
 +
|Nuclease +CP (1) ||245.8 ng/uL ||
 +
|-
 +
|Nulcease+ CP (2) ||235.3 ng/uL ||
 +
|-
 +
|Curli + TT (3) ||50.2 ng/uL ||Curve showed irregular spikes, indicating unreliability of DNA. Hence, sample was discarded.
 +
|-
 +
|Curli + TT (4) ||212.8 ng/uL ||
 +
|-
 +
|Curli + TT  (5) ||438.2 ng/uL ||Grown from the glycerol stock from the previous day
 +
|}
 +
'''Analytical Digest'''
 +
 
 +
In addition, an analytical digest was carried out in order to confirm DNA identity. The following recipes were used for the samples and controls:
 +
 
 +
{| class="wikitable"
 +
|
 +
| colspan="4" |'''Ligations'''
 +
| colspan="4" | '''Control'''
 +
|-
 +
| ||1 ||2 ||4 ||5 ||1 ||2 ||4 ||5
 +
|-
 +
|dH2O ||3.5 ||3.5 ||3.5 ||3.5 ||4.5 ||4.5 ||4.5 ||4.5
 +
|-
 +
|NEB ||1 ||1 ||1 ||1 ||1 ||1 ||1 ||1
 +
|-
 +
|DNA ||3 ||3 ||3 ||3 ||3 ||3 ||3 ||3
 +
|-
 +
|BSA ||0.5 ||0.5 ||0.5 ||0.5 ||0.5 ||0.5 ||0.5 ||0.5
 +
|-
 +
|XBal ||1 ||1 ||1 ||1 ||1 ||1 ||1 ||1
 +
|-
 +
|SpeI ||1 ||1 ||1 ||1 ||0 ||0 ||0 ||0
 +
|-
 +
|TOTAL ||10 ||10 ||10 ||10 ||10 ||10 ||10 ||10
 +
|}
 +
Each digest was then run on a gel in order to check whether band sizes are as expected. Each 10ul digest was supplemented with 2ul of loading dye.
 +
 
 +
 
 +
==28.08.12 ==
 +
 
 +
'''Digestions:'''
 +
 
 +
PSB1C3 with E + P
 +
 
 +
PCR amplified Laccase with E + P
 +
 
 +
PCR amplified Curli with E+ P
 +
 
 +
Nuclease in Puc57 with E + P
 +
 
 +
Constitutive promoter + RBS construct with E + S
 +
 
 +
PCR amplified Laccase X + P
 +
 
 +
PCR amplified Laccase X + P
 +
 
 +
Nuclease in puc57 with X + P
 +
 
 +
 
 +
'''Digestion protocol:'''
 +
 
 +
250ng vector: xuL
 +
 
 +
Enzyme 1: 1uL
 +
 
 +
Enzyme 2: 1uL
 +
 
 +
NEB buffer 2: 2uL
 +
 
 +
BSA: 0.5 uL
 +
 
 +
dH2O: made up to 20uL
 +
 
 +
 
 +
Incubated at 37C for 30mins and heat inactivated at 80C for 20mins.
 +
 
 +
The following ligations were then performed:
 +
 
 +
Ligations were preformed using NEB quick ligase.
 +
 
 +
 
 +
50ng of vector, 4uL,
 +
 
 +
Combined in a (3:1) molar ratio with insert
 +
 
 +
10uL 2X Quick ligation buffer
 +
 
 +
1uL quick ligase
 +
 
 +
Incubate at room temperature at 5mins
 +
 
 +
Transform immediately or store at -20
 +
 
 +
 
 +
{| class="wikitable"
 +
!Ligation Number !!Components !!Amounts
 +
|-
 +
|rowspan="3" |1 ||PCR amplified Curli ||12 ul
 +
|-
 +
|Constitutive promoter + RBS construct ||0.5ul
 +
|-
 +
|PSB1C3 ||4.0ul
 +
|-
 +
|rowspan="3" |2 ||PCR amplified Curli ||6 ul
 +
|-
 +
|Constitutive promoter + RBS construct ||0.5ul
 +
|-
 +
|PSB1C3 ||4.0ul
 +
|-
 +
|rowspan="3" |3 ||Nuclease in puc57 ||2.5ul
 +
|-
 +
|Constitutive promoter + RBS construct ||0.5ul
 +
|-
 +
|PSB1C3 ||4.0ul
 +
|-
 +
|rowspan="2" |4 ||pSB1C3 ||4.0ul
 +
|-
 +
|PCR amplified Curli ||12 ul
 +
|-
 +
|rowspan="2" |5 ||pSB1C3 ||4.0ul
 +
|-
 +
|PCR amplified Laccase ||6.0ul
 +
|-
 +
|rowspan="2" |6 ||pSB1C3 ||4.0ul
 +
|-
 +
|Nuclease in puc57 ||2.5ul
 +
|}
 +
 
 +
== Wednesday (29.08.12) ==
 +
Aim: To carry out transformation of the ligation product using chemically competent E. coli w3110. 
 +
 
 +
'''Methods:'''
 +
 
 +
Transformation of chemically competent cells:
 +
 
 +
Add 1-5uL of DNA to frozen cells and leave to thaw for 45mins. For thorough mixing of the DNA.
 +
 
 +
Heat shock at 37C for 10 mins in the thermomixer.
 +
 
 +
Return to ice for 2mins.
 +
 
 +
Add 1.3ml of LB. And transfer to 25ml falcons and incubate for 1hr at 37C at 200rpm.
 +
 
 +
Transfer contents to 1.5ml eppendorfs and sediment cells at 6000g for 2mins.
 +
 
 +
Resuspend pellet with 100uL LB and spread on plates supplemented with appropriate antibiotic.
 +
 
 +
Plates prepared with LB agar supplemented with 1uL of antibiotic at 1000x concentration per 1ml of agar.
 +
 
 +
Plates were incubated at 37C overnight.
 +
 
 +
Controls: The transformation control: Dh20 in place of h20 and spread onto LB + CMP and LB no Drug.
 +
 
 +
Ligations controls: Cut Plasmid backbone with and without ligase, spread on CMP supplemented plates.
 +
 
 +
 
 +
===30.08.12===
 +
'''Aim: Inoculate previous days ligation.'''
 +
 
 +
'''Results:'''
 +
 
 +
Ligations were successful. Transformation controls – Negative control, no growth on CMP plate. Positive control - growth on LB plate.
 +
Ligation controls – With ligase, colonies. No ligase - no colonies. Hence, colonies were    picked from each plate into 5ml selective LB + CMP and incubated overnight at 37°C at 200rpm.
 +
 
 +
===Friday 31/08===
 +
 
 +
'''Aim:''' To carry out mini-prep of the Curli, Laccase and Nuclease ligations to psb1c3 and to constitutive + rbs.
 +
 
 +
'''Results:''' Since the inoculation grew overnight, a mini-prep was carried out. After this, concentration of each sample was measures, giving the following results:
 +
 
 +
{| class="wikitable"
 +
!Ligation !!Concentration (ng/ul)
 +
|-
 +
|Pc + RBS +LAC ||276.4
 +
|-
 +
|Pc + RBS + LAC ||235.9
 +
|-
 +
|pSB1C3 + CUR ||425.3
 +
|-
 +
|pSB1C3 + LAC ||305.7
 +
|-
 +
|pSB1C3 + NUC ||290.0
 +
|-
 +
|Pc + RBS + CUR ||279.3
 +
|-
 +
|pSB1C3 + LAC ||335.5
 +
|}
 +
 
<html></div>
<html></div>
<div class="experiment"></div>
<div class="experiment"></div>
-
<img id="12.1" src="https://static.igem.org/mediawiki/2012/2/22/Ucl2012-labbook-graph7-2.png" /><div class="experimentContent">
+
<img id="12.1" src="https://static.igem.org/mediawiki/2012/9/99/Ucl2012-labbook-graph12-1.png" /><div class="experimentContent">
</html>
</html>
-
== 12.1 ==
+
 
 +
== Monday (27.08.12) ==
 +
 
 +
'''Aim:''' To find the right concentration of W3110 E. coli cells in LB that would be later used to streak out on the agar plates to obtain an optimal amount of colonies.
 +
 
 +
'''Methods:'''
 +
1. The colony was inoculated the night before in 10ml of LB plus 10 ul CMP
 +
 
 +
2. The day after 5 dilutions were made from the sample
 +
 
 +
3. First solution - 1ml of the original solution & 4ml of the LB
 +
 
 +
Second – 1ml of the first solution  & 4ml of the LB
 +
 
 +
Third – 1 ml of the second solution & 4ml of the LB
 +
 
 +
Fourth – 1 ml of the third solution & 4ml of the LB
 +
 
 +
Fifth – 1ml of the fourth solution & 4ml of the LB
 +
 
 +
 
 +
== Tuesday (28.08.12) ==
 +
 
 +
'''Aim:''' (on Monday grew WNu o/n in prep for miniprep. This miniprep will be used as a template for pcr of a 2nd nuclease.
 +
 
 +
Not the synthesised staph aureus nuclease (Plan A). The Wnu Nuclease is considered our plan B.
 +
 
 +
'''Methods:'''
 +
(10ul cells, 10ul, amp, 10ml (LB). Wnu cells were obtained from a glycerol stock.
 +
 
 +
Optimal number of colonies was achieved using the fourth solution/dilution (24 colonies). Using the dilution number 4 we plated out 12 plates.
 +
 
 +
 
 +
== Wednesday (29.08.12) ==
 +
Aim: To test whether IPTG induces the lac promoter.
 +
Method: we applied HCL to the plates previously streaked. On addition of HCL, DNA precipitates out of solution producing a cloudy appearance. The absence of DNA, due to Nuclease activity, creates cleared zones around colonies.
 +
 
 +
 
 +
== Friday (31.08.12) ==
 +
Nuclease test: 21 plates, three plates tested (HCL applied every time) every time, every three hours.
 +
 
 +
 
<html>
<html>
</div><div class="experiment"></div>
</div><div class="experiment"></div>
-
<img id="12.2" src="https://static.igem.org/mediawiki/2012/1/13/Ucl2012-labbook-graph7-1.png" />
+
<img id="12.2" src="https://static.igem.org/mediawiki/2012/a/a2/Ucl2012-labbook-graph12-2.png" />
<div class="experimentContent"></html>
<div class="experimentContent"></html>
-
== 12.2 ==
+
 
-
<html></div>
+
== 27.8.12 ==
-
<div class="experiment"></div>
+
 
-
<img id="12.3" src="https://static.igem.org/mediawiki/2012/2/22/Ucl2012-labbook-graph7-2.png" /><div class="experimentContent">
+
'''Aim ''' - Amplify irrE from Deinococcus radiodurans.
-
</html>
+
 
-
== 12.3 ==
+
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html>
-
<html>
+
 
-
</div><div class="experiment"></div>
+
'''Method'''
-
<img id="12.4" src="https://static.igem.org/mediawiki/2012/2/22/Ucl2012-labbook-graph7-2.png" /><div class="experimentContent">
+
 
-
</html>
+
Colony PCR was preformed on Deinococcus radiodurans. 5uL of colony matter was resuspended in 10uL dH2O and added to boiling water in a screw top vial,and  left to return to ambient room temperature.
-
== 12.4 ==
+
 
 +
1uL was used as PCR template. The following reaction was set up in 50uL:
 +
 
 +
All primers were prepared to a concentration of 1pmol.uL, from 100pmol.uL stocks. Primers ordered from MWG operon
 +
 
 +
 
 +
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction.
 +
 
 +
{| class="wikitable"
 +
|-
 +
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence
 +
|-
 +
| rowspan="4" |Deinococcus radioduran colony || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc
 +
|-
 +
|  ST2R ||tcactgtgcagcgtcctgcg
 +
|-
 +
|  rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc
 +
|-
 +
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg
 +
|-
 +
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc
 +
|-
 +
|  ST2R|| tcactgtgcagcgtcctgcg
 +
|-
 +
|}
 +
 
 +
 
 +
 
 +
'''Results:'''
 +
 
 +
PCR successful, band corresponding to approx 930bp length.  
 +
 
 +
PCR cleanup of Irre followed with Anachem PCR cleanup kit.
 +
 
 +
Concentration determined by nanodrop: 9ng.uL-1
 +
 
 +
 
 +
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.
 +
 
 +
 
<html>
<html>
</div><div class="experiment"></div></html>
</div><div class="experiment"></div></html>
-
 
{{:Team:University_College_London/templates/foot}}
{{:Team:University_College_London/templates/foot}}

Latest revision as of 03:38, 27 September 2012

Contents

27.8.12

Aim- Repeat inocculation of nuclease + curli ligation transformations. Inoculation was repeated due to no growth the first time round.

Picking Colonies Protocol
Step 1 – Creating culture media: In a sterile environment, set up X numbers of falcons, each with 5mls of media.


Step 2 - Inoculating Colonies into a Selective Broth:: Add Yul of antibiotic to reach desired antibiotic concentration.


(For Ampicillin this is 50ug/ml, For Kanamycin it is 25ug/ml, for Tetracycline it is 15ug/ml, and for Chloramphenicol it is 25ug/ml)


Step 4 – Selecting a Colony: Select a clear, isolated colony and using an inoculation hoop scoop up a colony onto the tip. Deposit in the falcon tube


Step 5 - Culture: Culture your falcon tubes overnight at a temperature of 37 oC. Leave for no longer than 16 hours.


30.08.12

Aim- To carry out mini-prep of curli+TT and Nuclease + CP DNA from the previous day’s inoculations.

Results- Once the mini-prep was carried out, the concentration of each sample was measured, and the following results obtained:

Sample Concentration Notes
Nuclease +CP (1) 245.8 ng/uL
Nulcease+ CP (2) 235.3 ng/uL
Curli + TT (3) 50.2 ng/uL Curve showed irregular spikes, indicating unreliability of DNA. Hence, sample was discarded.
Curli + TT (4) 212.8 ng/uL
Curli + TT (5) 438.2 ng/uL Grown from the glycerol stock from the previous day

Analytical Digest

In addition, an analytical digest was carried out in order to confirm DNA identity. The following recipes were used for the samples and controls:

Ligations Control
1 2 4 5 1 2 4 5
dH2O 3.5 3.5 3.5 3.5 4.5 4.5 4.5 4.5
NEB 1 1 1 1 1 1 1 1
DNA 3 3 3 3 3 3 3 3
BSA 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5
XBal 1 1 1 1 1 1 1 1
SpeI 1 1 1 1 0 0 0 0
TOTAL 10 10 10 10 10 10 10 10

Each digest was then run on a gel in order to check whether band sizes are as expected. Each 10ul digest was supplemented with 2ul of loading dye.


28.08.12

Digestions:

PSB1C3 with E + P

PCR amplified Laccase with E + P

PCR amplified Curli with E+ P

Nuclease in Puc57 with E + P

Constitutive promoter + RBS construct with E + S

PCR amplified Laccase X + P

PCR amplified Laccase X + P

Nuclease in puc57 with X + P


Digestion protocol:

250ng vector: xuL

Enzyme 1: 1uL

Enzyme 2: 1uL

NEB buffer 2: 2uL

BSA: 0.5 uL

dH2O: made up to 20uL


Incubated at 37C for 30mins and heat inactivated at 80C for 20mins.

The following ligations were then performed:

Ligations were preformed using NEB quick ligase.


50ng of vector, 4uL,

Combined in a (3:1) molar ratio with insert

10uL 2X Quick ligation buffer

1uL quick ligase

Incubate at room temperature at 5mins

Transform immediately or store at -20


Ligation Number Components Amounts
1 PCR amplified Curli 12 ul
Constitutive promoter + RBS construct 0.5ul
PSB1C3 4.0ul
2 PCR amplified Curli 6 ul
Constitutive promoter + RBS construct 0.5ul
PSB1C3 4.0ul
3 Nuclease in puc57 2.5ul
Constitutive promoter + RBS construct 0.5ul
PSB1C3 4.0ul
4 pSB1C3 4.0ul
PCR amplified Curli 12 ul
5 pSB1C3 4.0ul
PCR amplified Laccase 6.0ul
6 pSB1C3 4.0ul
Nuclease in puc57 2.5ul

Wednesday (29.08.12)

Aim: To carry out transformation of the ligation product using chemically competent E. coli w3110.

Methods:

Transformation of chemically competent cells:

Add 1-5uL of DNA to frozen cells and leave to thaw for 45mins. For thorough mixing of the DNA.

Heat shock at 37C for 10 mins in the thermomixer.

Return to ice for 2mins.

Add 1.3ml of LB. And transfer to 25ml falcons and incubate for 1hr at 37C at 200rpm.

Transfer contents to 1.5ml eppendorfs and sediment cells at 6000g for 2mins.

Resuspend pellet with 100uL LB and spread on plates supplemented with appropriate antibiotic.

Plates prepared with LB agar supplemented with 1uL of antibiotic at 1000x concentration per 1ml of agar.

Plates were incubated at 37C overnight.

Controls: The transformation control: Dh20 in place of h20 and spread onto LB + CMP and LB no Drug.

Ligations controls: Cut Plasmid backbone with and without ligase, spread on CMP supplemented plates.


30.08.12

Aim: Inoculate previous days ligation.

Results:

Ligations were successful. Transformation controls – Negative control, no growth on CMP plate. Positive control - growth on LB plate. Ligation controls – With ligase, colonies. No ligase - no colonies. Hence, colonies were picked from each plate into 5ml selective LB + CMP and incubated overnight at 37°C at 200rpm.

Friday 31/08

Aim: To carry out mini-prep of the Curli, Laccase and Nuclease ligations to psb1c3 and to constitutive + rbs.

Results: Since the inoculation grew overnight, a mini-prep was carried out. After this, concentration of each sample was measures, giving the following results:

Ligation Concentration (ng/ul)
Pc + RBS +LAC 276.4
Pc + RBS + LAC 235.9
pSB1C3 + CUR 425.3
pSB1C3 + LAC 305.7
pSB1C3 + NUC 290.0
Pc + RBS + CUR 279.3
pSB1C3 + LAC 335.5

Monday (27.08.12)

Aim: To find the right concentration of W3110 E. coli cells in LB that would be later used to streak out on the agar plates to obtain an optimal amount of colonies.

Methods: 1. The colony was inoculated the night before in 10ml of LB plus 10 ul CMP

2. The day after 5 dilutions were made from the sample

3. First solution - 1ml of the original solution & 4ml of the LB

Second – 1ml of the first solution & 4ml of the LB

Third – 1 ml of the second solution & 4ml of the LB

Fourth – 1 ml of the third solution & 4ml of the LB

Fifth – 1ml of the fourth solution & 4ml of the LB


Tuesday (28.08.12)

Aim: (on Monday grew WNu o/n in prep for miniprep. This miniprep will be used as a template for pcr of a 2nd nuclease.

Not the synthesised staph aureus nuclease (Plan A). The Wnu Nuclease is considered our plan B.

Methods: (10ul cells, 10ul, amp, 10ml (LB). Wnu cells were obtained from a glycerol stock.

Optimal number of colonies was achieved using the fourth solution/dilution (24 colonies). Using the dilution number 4 we plated out 12 plates.


Wednesday (29.08.12)

Aim: To test whether IPTG induces the lac promoter. Method: we applied HCL to the plates previously streaked. On addition of HCL, DNA precipitates out of solution producing a cloudy appearance. The absence of DNA, due to Nuclease activity, creates cleared zones around colonies.


Friday (31.08.12)

Nuclease test: 21 plates, three plates tested (HCL applied every time) every time, every three hours.


27.8.12

Aim - Amplify irrE from Deinococcus radiodurans.

PCR Protocol

Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below

PCR Components Volume (ul)
5x Reaction Buffer 10
25mM MgCl2 4
10mM dNTPs 1
10uM Forward primer 5
10uM Reverse primer 5
DNA Polymerase 0.25
Nuclease Free Water 24.25
Template DNA 0.5
Total Volume 0.5

Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.

PCR conditions Temp (oC) Time (s)
Initial Denaturation (1 cycle) 95 30
Denaturation/Annealing/Extension (30 cycles) 95/55/72 10/25/120
Final Extension (1 cycle) 72 600
Hold 4 ∞


Method

Colony PCR was preformed on Deinococcus radiodurans. 5uL of colony matter was resuspended in 10uL dH2O and added to boiling water in a screw top vial,and left to return to ambient room temperature.

1uL was used as PCR template. The following reaction was set up in 50uL:

All primers were prepared to a concentration of 1pmol.uL, from 100pmol.uL stocks. Primers ordered from MWG operon


Step 1 - Setting up PCR tubes: The table below gives the identity of the primers used for each reaction.

DNA Template Function Module Primer Pair Primer Primer Sequence
Deinococcus radioduran colony irrESalt Tolerance STF1/ST2RSTF1 atggggccaaaagctaaagctgaagcc
ST2R tcactgtgcagcgtcctgcg
STF3/ST4R STF3 gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc
ST4R gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg
No Template (Negative Control) N/A Salt Tolerance STF1/STF2STF1 atggggccaaaagctaaagctgaagcc
ST2R tcactgtgcagcgtcctgcg


Results:

PCR successful, band corresponding to approx 930bp length.

PCR cleanup of Irre followed with Anachem PCR cleanup kit.

Concentration determined by nanodrop: 9ng.uL-1


Conclusion: We will revise the protocol to see if we can detect any bands.


Retrieved from "http://2012.igem.org/Team:University_College_London/LabBook/Week12"