Team:UNAM Genomics Mexico/Notebook/ANDMetal
From 2012.igem.org
(111 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
{{:Template:Team:UNAM_Genomics_Mexico/webhtml| content= | {{:Template:Team:UNAM_Genomics_Mexico/webhtml| content= | ||
+ | __NOTOC__ | ||
+ | <br /> | ||
+ | <center><h1>'''Cadmium/Heavy metals AND Gate Notebook'''</h1></center> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | <table border="0" height="150" cellspacing="15" bgcolor="transparent" id="tablecontentbg" cellpadding="20"> | ||
+ | <tr> | ||
+ | <td id="leftcolumn2"><center>2[[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#MAY | '''MAY''']]</center><br /> | ||
<br /> | <br /> | ||
- | < | + | 2.1 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#05.2F29.2F2012 | 05/29/2012]] <br /> |
+ | 2.2 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#05.2F31.2F2012 | 05/31/2012]] <br /> | ||
+ | </td> | ||
+ | |||
+ | <td id="contentcolumn2"><center>3 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#JUNE | '''JUNE''']]</center><br /> | ||
<br /> | <br /> | ||
+ | 3.1 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#06.2F06.2F2012 | 06/06/2012]]<br /> | ||
+ | 3.2 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#06.2F08.2F12 | 06/08/12]]<br /> | ||
+ | 3.3 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#06.2F11.2F12 | 06/11/12]]<br /> | ||
+ | 3.4 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#06.2F14.2F12 | 06/14/2012]]<br /> | ||
+ | 3.5 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#06.2F15.2F12 | 06/15/12]]<br /> | ||
+ | 3.6 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#06.2F18.2F12 | 06/18/12]]<br /> | ||
+ | </td> | ||
+ | |||
+ | <td id="rightcolumn2"><center>4 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#JULY | '''JULY''']]</center><br /> | ||
<br /> | <br /> | ||
+ | 4.1 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F02.2F12 | 07/02/12]]<br /> | ||
+ | 4.2 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F03.2F12 | 07/03/12]]<br /> | ||
+ | 4.3 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F04.2F12 | 07/04/2012]]<br /> | ||
+ | 4.4 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F05.2F12 | 07/05/12]]<br /> | ||
+ | 4.5 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F06.2F12 | 07/06/12]]<br /> | ||
+ | 4.6[[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F09.2F12 | 07/09/12]]<br /> | ||
+ | 4.7 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F10.2F12 | 07/10/12]]<br /> | ||
+ | 4.8 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F11.2F12 | 07/11/12]]<br /> | ||
+ | 4.9[[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F12.2F12 | 07/12/12]]<br /> | ||
+ | 4.10 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F13.2F12 | 07/13/12]]<br /> | ||
+ | 4.11 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F16.2F12 | 07/16/12]]<br /> | ||
+ | 4.12 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F17.2F12 | 07/17/12]]<br /> | ||
+ | 4.13 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F18.2F12 | 07/18/12]]<br /> | ||
+ | 4.14 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F19.2F12 | 07/19/12]]<br /> | ||
+ | 4.15 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F20.2F12 | 07/20/12]]<br /> | ||
+ | 4.16 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F23.2F12 | 07/23/12]]<br /> | ||
+ | 4.17 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F24.2F12 | 07/24/12]]<br /> | ||
+ | 4.18 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F25.2F12 | 07/25/12]]<br /> | ||
+ | 4.19 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F26.2F12 | 07/26/12]]<br /> | ||
+ | 4.20 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F27.2F12 | 07/27/12]]<br /> | ||
+ | 4.21 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F30.2F12 | 07/30/12]]<br /> | ||
+ | 4.22 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#07.2F31.2F12 | 07/31/12]]<br /> | ||
+ | </td> | ||
+ | </tr> | ||
- | |||
<tr> | <tr> | ||
- | <td id="leftcolumn2"> | + | <td id="leftcolumn2"><center>5[[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#August | '''AUGUST''']]</center><br /> |
- | <td id="contentcolumn2"> | + | <br /> |
- | <td id="rightcolumn2"> | + | 5.1[[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F01.2F12 | 08/01/12]] <br /> |
+ | 5.2 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F02.2F12| 08/02/12]]<br /> | ||
+ | 5.3 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F03.2F12| 08/03/12]]<br /> | ||
+ | 5.4 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F07.2F12| 08/07/12]]<br /> | ||
+ | 5.5 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F08.2F12| 08/08/12]]<br /> | ||
+ | 5.6 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F09.2F12| 08/09/12]]<br /> | ||
+ | 5.7 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F10.2F12| 08/10/12]]<br /> | ||
+ | 5.8 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F13.2F12| 08/13/12]]<br /> | ||
+ | 5.9 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F14.2F12| 08/14/12]]<br /> | ||
+ | 5.10 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F15.2F12| 08/15/12]]<br /> | ||
+ | 5.11 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F16.2F12| 08/16/12]]<br /> | ||
+ | 5.12 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F17.2F12| 08/17/12]]<br /> | ||
+ | 5.13 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F20.2F12| 08/20/12]]<br /> | ||
+ | 5.14 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F21.2F12| 08/21/12]]<br /> | ||
+ | 5.15 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F22.2F12| 08/22/12]]<br /> | ||
+ | 5.16 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F23.2F12| 08/23/12]]<br /> | ||
+ | 5.17[[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F24.2F12| 08/24/12]]<br /> | ||
+ | 5.18 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F25.2F12| 08/25/12]]<br /> | ||
+ | 5.19 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F26.2F12| 08/26/12]]<br /> | ||
+ | 5.20 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F27.2F12| 08/27/12]]<br /> | ||
+ | 5.21 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F28.2F12| 08/28/12]]<br /> | ||
+ | 5.22 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F29.2F12| 08/29/12]]<br /> | ||
+ | 5.23 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#08.2F31.2F12| 08/31/12]]<br /> | ||
+ | </td> | ||
+ | |||
+ | <td id="contentcolumn2"><center>6[[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#SEPTEMBER | '''SEPTEMBER''']]</center> <br /> | ||
+ | <br /> | ||
+ | 6.1 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F01.2F12| 09/01/12]]<br /> | ||
+ | 6.2 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F02.2F12|09/02/12]]<br /> | ||
+ | 6.3 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F03.2F12|09/03/12]]<br /> | ||
+ | 6.4 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F04.2F12|09/04/12]]<br /> | ||
+ | 6.5 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F05.2F12|09/05/12]]<br /> | ||
+ | 6.6 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F06.2F12|09/06/12]]<br /> | ||
+ | 6.7 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F07.2F12|09/07/12]]<br /> | ||
+ | 6.8 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F09.2F12|08/09/12]]<br /> | ||
+ | 6.9 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F10.2F12|09/10/12]]<br /> | ||
+ | 6.10 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F11.2F12|09/11/12]]<br /> | ||
+ | 6.11 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F12.2F12|09/12/12]]<br /> | ||
+ | 6.12 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F13.2F12|09/13/12]]<br /> | ||
+ | 6.13 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F14.2F12|09/14/12]]<br /> | ||
+ | 6.14 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F15.2F12|09/15/12]]<br /> | ||
+ | 6.15 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F16.2F12|09/16/12]]<br /> | ||
+ | 6.16 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F18.2F12|09/18/12]]<br /> | ||
+ | 6.17 [[Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#09.2F19.2F12|09/19/12]]<br /> | ||
+ | </td> | ||
+ | |||
+ | <td id="rightcolumn2"><p> '''On hover the images to see descriptions'''</p><td/> | ||
</tr> | </tr> | ||
</table> | </table> | ||
- | |||
<br /> | <br /> | ||
<br /> | <br /> | ||
- | =MAY= | + | = MAY = |
<html> | <html> | ||
Line 47: | Line 136: | ||
Our group is in charge of building part of the “and” construction. We started analyzing if the plasmid we have with P4 actually had what we needed. <br /><br /> | Our group is in charge of building part of the “and” construction. We started analyzing if the plasmid we have with P4 actually had what we needed. <br /><br /> | ||
- | The plasmid PRMn25 contains the protein P4. It has Amp100 resistance and comes in Escherichia coli NFI. Cells were lysed to make sure the plasmid was present in these cells (5000bp). We ran a gel with 3 lysis, a sample from the plasmid PFRC54 (A3 promoter) and a sample of total DNA from the strain from which PFRC54 was obtained. <br /><br /> | + | The plasmid PRMn25 contains the protein P4. It has Amp100 resistance and comes in ''Escherichia coli'' NFI. Cells were lysed to make sure the plasmid was present in these cells (5000bp). We ran a gel with 3 lysis, a sample from the plasmid PFRC54 (A3 promoter) and a sample of total DNA from the strain from which PFRC54 was obtained. <br /><br /> |
<br /><br /> | <br /><br /> | ||
<br /><br /> | <br /><br /> | ||
Line 94: | Line 183: | ||
<br /> | <br /> | ||
+ | |||
+ | |||
=JUNE= | =JUNE= | ||
+ | ::::::::::::::::::::::::::::::::::::::[[File:UnamgenomcisUp.png|right | 120px |link=Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#Cadmium.2FHeavy_metals_AND_Gate_Notebook]] | ||
<html> | <html> | ||
<div class='thumbnailWrapper'> | <div class='thumbnailWrapper'> | ||
Line 353: | Line 445: | ||
<br /> | <br /> | ||
=JULY= | =JULY= | ||
+ | ::::::::::::::::::::::::::::::::::::::[[File:UnamgenomcisUp.png|right | 120px |link=Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#Cadmium.2FHeavy_metals_AND_Gate_Notebook]] | ||
<h2>07/02/12</h2><br /> | <h2>07/02/12</h2><br /> | ||
We did 2 PCRs, since the primers have arrived. We purified by miniprep RFP and P4. With this PCR we will add the prefix (EcoRI and XbaI) and RBS to the beginning of the sequence, and suffix (restiction sites for SpeI asn PstI). <br /> | We did 2 PCRs, since the primers have arrived. We purified by miniprep RFP and P4. With this PCR we will add the prefix (EcoRI and XbaI) and RBS to the beginning of the sequence, and suffix (restiction sites for SpeI asn PstI). <br /> | ||
Line 884: | Line 977: | ||
In the gel we can see that the terminator digestion in ok, although it is still partial. We need to leave it for the whole night. We can’t see the RFP digestion; it is possible that it degraded. We will concentrate RFP. <br /> | In the gel we can see that the terminator digestion in ok, although it is still partial. We need to leave it for the whole night. We can’t see the RFP digestion; it is possible that it degraded. We will concentrate RFP. <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/f/f6/UnamgenomicsoANDcadmio07_17_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/f/f6/UnamgenomicsoANDcadmio07_17_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'>1. 1 kb ladder<br /> | ||
+ | 2. RFP lysis. <br /> | ||
+ | 3. RFP lysis 2010<br /> | ||
+ | 4. Terminator Digestion. <br /> | ||
+ | 5. RFP Digestion. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/e/e8/UnamgenomicsoANDcadmio07_17_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e8/UnamgenomicsoANDcadmio07_17_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionrojo'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. RFP PCR lysis. <br /> | ||
+ | 3. RFP PCR lysis. <br /> | ||
+ | 4. RFP PCR lysis. <br /> | ||
+ | 5. RFP PCR lysis. <br /> | ||
+ | 6. RFP PCR lysis. <br /> | ||
+ | 7. RFP PCR lysis. <br /> | ||
+ | 8. Negative control. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/4/4f/UnamgenomicsoANDcadmio07_17_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/4/4f/UnamgenomicsoANDcadmio07_17_2012_3.jpg' height="300" /></a> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. PCR RFP lysis. <br /> | ||
+ | 3. PCR RFP lysis. <br /> | ||
+ | 4. PCR RFP lysis. <br /> | ||
+ | The pcr looks fine, now we will run 3 samples in fused wells so we can cut them and extract the DNA. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/1/10/UnamgenomicsoANDcadmio07_17_2012_4.jpg'><img src='https://static.igem.org/mediawiki/2012/1/10/UnamgenomicsoANDcadmio07_17_2012_4.jpg' height="300" /></a> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'>1. 1kb ladder. <br /> | ||
+ | 2. Purified RFP. <br /> | ||
+ | 3. Purified RFP. <br /> | ||
+ | 4. Purified RFP. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <h2>07/17/12</h2><br /> | ||
+ | We ran 6 50 µl reactions of the PCR to amplify RFP. We will use as DNA RFP from the lysis, one from 2012, and one from 2010. We will make a dilution, use 1 µl of lysis and diluted them in H2O. <br /> | ||
+ | [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#PCR_Protocol_.2850.C2.B5l.29 | PCR protocol]]. <br /> | ||
+ | |||
+ | >We can still observe bands in the purification, we will try to do a better PCR. <br /> | ||
+ | >We digested the terminator lysis with EcoRI and XbaI and we decided to switch buffers. We used buffer 2 even though EcoRI might have a star effect. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/6/6d/UnamgenomicsoANDcadmio07_18_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/6/6d/UnamgenomicsoANDcadmio07_18_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionrosa'> | ||
+ | <p class='captionInside'>2. 1 kb ladder. <br /> | ||
+ | 3. Terminator digested E/X. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/f/f9/UnamgenomicsoANDcadmio07_18_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/f/f9/UnamgenomicsoANDcadmio07_18_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionaqua'> | ||
+ | <p class='captionInside'>1. 1 kb ladder <br /> | ||
+ | 2. RFP PCR with hot start<br /> | ||
+ | 3. Negative Control<br /> | ||
+ | 4. Terminator Lysis<br /> | ||
+ | 5. Terminator digestion E/X. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/4/4b/UnamgenomicsoANDcadmio07_18_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/4/4b/UnamgenomicsoANDcadmio07_18_2012_3.jpg' height="300" /></a> | ||
+ | <div class='captionmoradoclaro'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. RFP lysis PCR. <br /> | ||
+ | 3. RFP lysis (other team). <br /> | ||
+ | 4. Negative control. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <h2>07/18/12</h2><br /> | ||
+ | We did a PCR using hot star and without MgCl2. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Hot_start_PCR_protocol | HOT START PCR PROTOCOL]] <br /> | ||
+ | <br /> | ||
+ | |||
+ | We left an RFP digestion and took the DNA from the RFP PCR which looked good. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#PCR_Protocol_.2850.C2.B5l.29 | PCR PROTOCOL]] | ||
+ | <br /> | ||
+ | |||
+ | From these PCR products we left the PCR digestion with EcoRI and SpeI and used enzymes from the same company. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/f/fc/UnamgenomicsoANDcadmio07_19_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/f/fc/UnamgenomicsoANDcadmio07_19_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionmorado'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. E/S RFP digestion. <br /> | ||
+ | 3. E/S RFP digestion (RFP PCR lysis). <br /> | ||
+ | 4. E/S RFP digestion (Cut RFP PCR from the other team). <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/1/1b/UnamgenomicsoANDcadmio07_19_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/1/1b/UnamgenomicsoANDcadmio07_19_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionazul'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. E/X terminator 1 digestion. <br /> | ||
+ | 3. E/X terminator 2 digestion. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/5/53/UnamgenomicsoANDcadmio07_19_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/5/53/UnamgenomicsoANDcadmio07_19_2012_3.jpg' height="300" /></a> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. Terminator Lysis 1. <br /> | ||
+ | 3. RFP Lysis 2. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/6/6d/UnamgenomicsoANDcadmio07_19_2012_4.jpg'><img src='https://static.igem.org/mediawiki/2012/6/6d/UnamgenomicsoANDcadmio07_19_2012_4.jpg' height="300" /></a> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. RFP E/S digestion. <br /> | ||
+ | 3. Terminator 2 E/X digestion. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <h2>07/19/12</h2><br /> | ||
+ | From the three RFP digestions we left yesterday we ran a gel to prove that our DNA wasn’t being degraded, as it had been happening. <br /> | ||
+ | |||
+ | > Our DNA wasn’t degraded, we will use these digestions to do the ligation. <br /> | ||
+ | >We did lysis of the terminator cultures by miniprep. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Lysis_protocol | LYSIS PROTOCOL]] <br /> | ||
+ | |||
+ | We ligated RFP+terminator. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]] <br /> | ||
+ | We transformed the ligation. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANFORMATION PROTOCOL]] <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <h2>07/20/12</h2><br /> | ||
+ | We observed two colonies, we put them in liquid LB. <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/1/11/UnamgenomicsoANDcadmio07_23_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/1/11/UnamgenomicsoANDcadmio07_23_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionrojo'> | ||
+ | <p class='captionInside'>1.1 kb ladder. <br /> | ||
+ | 2.RFP-terminator lysis. <br /> | ||
+ | 3.RFP-termintor lysis. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/b/b5/UnamgenomicsoANDcadmio07_23_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/b/b5/UnamgenomicsoANDcadmio07_23_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'>1.1 kb ladder. <br /> | ||
+ | 2.E ligation 1 digestion. <br /> | ||
+ | 3.P ligation 1 digestion. <br /> | ||
+ | 4.E/P ligation 1 digestion. <br /> | ||
+ | 5.E ligation 2 digestion. <br /> | ||
+ | 6.P ligation 2 digestion. <br /> | ||
+ | 7.E/P ligation 2 digestion. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>07/23/12</h2><br /> | ||
+ | We made a lysis of the ligation using miniprep. <br /> | ||
+ | |||
+ | >We did the following digestions<br /> [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br /> | ||
+ | •EcoRI/PstI ligation<br /> | ||
+ | •EcoRI ligation<br /> | ||
+ | •PstI ligation<br /> | ||
+ | |||
+ | The results indicate that the vector only ligated with itself. <br /> | ||
+ | |||
+ | We put B0014 and E1010 digestions. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br /> | ||
+ | Boo14 EcoRI<br /> | ||
+ | Boo14-XbaI<br /> | ||
+ | B0014 EcoRI/XbaI<br /> | ||
+ | E1010 EcoRI<br /> | ||
+ | E1010 SpeI<br /> | ||
+ | E1010 EcoRI/SpeI<br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/2/2e/UnamgenomicsoANDcadmio07_24_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/2/2e/UnamgenomicsoANDcadmio07_24_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionrosa'> | ||
+ | <p class='captionInside'>1.1 kb Ladder. <br /> | ||
+ | 2.B0014 EcoRI. <br /> | ||
+ | 3.B0014 XbaI. <br /> | ||
+ | 4.B0014 EcoRI-XbaI. <br /> | ||
+ | 5.B0014 EcoRI-XbaI dephosphated. <br /> | ||
+ | 6.E1010 EcoRI. <br /> | ||
+ | 7.E1010 SpeI. <br /> | ||
+ | 8.E1010 EcoRI-SpeI. <br /> | ||
+ | 9.E1010 EcoRI-SpeI. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/e/e6/UnamgenomicsoANDcadmio07_24_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e6/UnamgenomicsoANDcadmio07_24_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionaqua'> | ||
+ | <p class='captionInside'>1.1 kb ladder. <br /> | ||
+ | 2.B0014 lysis. <br /> | ||
+ | 3.B0014 lysis. <br /> | ||
+ | The buffer had been used previously and this is probably why the gel didn’t come out well. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | |||
+ | <h2>07/24/12</h2><br /> | ||
+ | We dephosphated the B0014-E/X digestion. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Dephosphorylation_protocol | DEPHOSPHORYLATION PROTOCOL]] <br /> | ||
+ | >We inactivated every digestion 10 minutes at 70ºC. We ran an agarose gel at 100 volts. <br /> | ||
+ | |||
+ | |||
+ | We put 4 ligations: [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]] <br /> | ||
+ | B0014 dephosphated + E1010 <br /> | ||
+ | B0014 + E1010 <br /> | ||
+ | B0014 <br /> | ||
+ | B0014 dephosphated <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/0/06/UnamgenomicsoANDcadmio07_25_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/0/06/UnamgenomicsoANDcadmio07_25_2012.jpg' height="300" /></a> | ||
+ | <div class='captionaqua'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. B0014 lisis. <br /> | ||
+ | 3. B0014 lisis. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>07/25/12</h2><br /> | ||
+ | At 9:30 we still didn’t observe colonies of the ligation transformation. <br /> | ||
+ | At 1:35 20 colonies were cultivated so we could digest them (XbaI/PstI) [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]]. <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/3/33/UnamgenomicsoANDcadmio07_26_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/3/33/UnamgenomicsoANDcadmio07_26_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionmorado'> | ||
+ | <p class='captionInside'>1.Terminator lysis. <br /> | ||
+ | 2-4.“B0014+E1010” 1 Lysis. <br /> | ||
+ | 5.Ladder<br /> | ||
+ | 6.E/X terminator. <br /> | ||
+ | 7, 10, 13. Lysis B0014+E1010 E digestion. <br /> | ||
+ | 8,11, 14. Lysis B0014+E1010 P digestion. <br /> | ||
+ | 9, 12,15.Lysis B0014+E1010 E/P digestion. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/9/95/UnamgenomicsoANDcadmio07_26_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/9/95/UnamgenomicsoANDcadmio07_26_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionazul'> | ||
+ | <p class='captionInside'>1.1 kb ladder. <br /> | ||
+ | 2.E1010. <br /> | ||
+ | 3.B0014 Lysis. <br /> | ||
+ | 4.B0014 Lysis. <br /> | ||
+ | 5.B0014 E/X digestion. <br /> | ||
+ | 6.B0014 E/X digestion. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/2/25/UnamgenomicsoANDcadmio07_26_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/2/25/UnamgenomicsoANDcadmio07_26_2012_3.jpg' height="300" /></a> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'>1. RFP for extraction. <br /> | ||
+ | 2. RFP for extraction. <br /> | ||
+ | 3. 1 kb ladder. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/e/e2/UnamgenomicsoANDcadmio07_26_2012_4.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e2/UnamgenomicsoANDcadmio07_26_2012_4.jpg' height="300" /></a> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'>1. Extracted band. <br /> | ||
+ | 2. Extracted band. <br /> | ||
+ | 3. 1 kb ladder. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <h2>07/26/12</h2><br /> | ||
+ | In the previous gel we observed that cultures grown were actually re-ligated vectors. <br /> | ||
+ | We need to put ligations again. <br /> | ||
+ | |||
+ | >E1010 doesn’t look as it should, we’ll extract from band. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | GEL EXTRACTION PROTOCOL]]<br /> | ||
+ | |||
+ | We ligated B0014+E1010 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/8/86/UnamgenomicsoANDcadmio07_27_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/8/86/UnamgenomicsoANDcadmio07_27_2012.jpg' height="300" /></a> | ||
+ | <div class='captionrojo'> | ||
+ | <p class='captionInside'>1. 1 kb Ladder. <br /> | ||
+ | 2. RFP E1010 purified. <br /> | ||
+ | 3. RFP E1010 purified. <br /> | ||
+ | >We now have LasR. <br /></p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>07/27/12</h2><br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <h2>07/30/12</h2><br /> | ||
+ | >We transformed the ligations. <br /> | ||
+ | |||
+ | E1010+B0014 dephosphated. <br /> | ||
+ | E1010+B0014. <br /> | ||
+ | B0014 dephosphated. <br /> | ||
+ | B0014. <br /> | ||
+ | Negative Control. <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <h2>07/31/12</h2><br /> | ||
+ | The colonies from the transformation grew well, though we believe the dephosphatase isn’t working properly. <br /> | ||
+ | We took 103 colonies and put 18 cultures to do the alkaline lysis. <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | ::::::::::::::::::::::::::::::::::::::[[File:UnamgenomcisUp.png|right | 120px |link=Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#Cadmium.2FHeavy_metals_AND_Gate_Notebook]] | ||
+ | <h1>August</h1> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/6/6f/UnamgenomicsoANDcadmio08_01_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/6/6f/UnamgenomicsoANDcadmio08_01_2012.jpg' height="300" /></a> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2-18 E1010+B0014 lysis colony 1-17<br /> | ||
+ | 19. Terminator lysis <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <h2>08/01/12</h2><br /> | ||
+ | |||
+ | We digested with XbaI and PstI colonies 3,5,8,9,14. <br /> [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/4/4a/UnamgenomicsoANDcadmio08_02_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/4/4a/UnamgenomicsoANDcadmio08_02_2012.jpg' height="300" /></a> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'>1.1 kb ladder. <br /> | ||
+ | 2, 5,8,11,14. XbaI/PstI. <br /> | ||
+ | 3,6,9,12,15. XbaI. <br /> | ||
+ | 4,7,10,13,16. PstI. <br /> | ||
+ | 17.--------------<br /> | ||
+ | 18.B0014 X<br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>08/02/12</h2><br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/c/c3/UnamgenomicsoANDcadmio08_03_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/c/c3/UnamgenomicsoANDcadmio08_03_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionrosa'> | ||
+ | <p class='captionInside'>1. CI lysis. <br /> | ||
+ | 2. 97 lysis. <br /> | ||
+ | 3. 98 lysis. <br /> | ||
+ | 4. 99 lysis. <br /> | ||
+ | 5. 1 kb ladder. <br /> | ||
+ | 6. RFP lysis. <br /> | ||
+ | 7. Terminator lysis. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/9/99/UnamgenomicsoANDcadmio08_03_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/9/99/UnamgenomicsoANDcadmio08_03_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionaqua'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2 ,5 ,8 ,11. E1010+B0014 EcoRI. <br /> | ||
+ | 3, 9. E1010+B01014 XbaI. <br /> | ||
+ | 4, 10. E1010+B0014 EcroRI/XbaI. <br /> | ||
+ | 6, 12. E1010+B0014 PstI. <br /> | ||
+ | 7, 13. E1010+B0014 PstI/EcoRI. <br /> | ||
+ | 14, 15. P4. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/5/5b/UnamgenomicsoANDcadmio08_03_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/5/5b/UnamgenomicsoANDcadmio08_03_2012_3.jpg' height="300" /></a> | ||
+ | <div class='captionmoradoclaro'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2, 5. 02 CI EcoRI. <br /> | ||
+ | 3. 02 CI XbaI. <br /> | ||
+ | 4. 02 CI EcroRI/XbaI. <br /> | ||
+ | 6. 02 CI PstI. <br /> | ||
+ | 7. 02 CI PstI/EcoRI. <br /> | ||
+ | 8. 97 CZrA_ArsR EcoRI. <br /> | ||
+ | 9. 97 CZrA_ArsR PstI<br />. | ||
+ | 10. 97 CZrA_ArsR EcoRI/PstI. <br /> | ||
+ | 11. 98 CZrA_ArsR EcoRI. <br /> | ||
+ | 12. 98 CZrA_ArsR PstI. <br /> | ||
+ | 13. 98 CZrA_ArsR EcoRI/PstI. <br /> | ||
+ | 14. 99 CZrA_ArsR EcoRI. <br /> | ||
+ | 15. 99 CZrA_ArsR PstI. <br /> | ||
+ | 16. 99 CZrA_ArsR EcoRI/PstI. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>08/03/12</h2><br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/e/ed/UnamgenomicsoANDcadmio08_07_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/e/ed/UnamgenomicsoANDcadmio08_07_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionmorado'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. LasR PCR (-).<br /> | ||
+ | 3. LasR 1 PCR. <br /> | ||
+ | 4. LasR 2 PCR. <br /> | ||
+ | 5. P4 PCR (-).<br /> | ||
+ | 6. P4 PCR. <br /> | ||
+ | 7. P4 purification. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/f/f9/UnamgenomicsoANDcadmio08_07_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/f/f9/UnamgenomicsoANDcadmio08_07_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionazul'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. LasR (-).<br /> | ||
+ | 3. LasR PCR. <br /> | ||
+ | 4. LasR PCR. <br /> | ||
+ | 5. P4 PCR<br />. | ||
+ | 6. Purified P4. <br /> | ||
+ | We ligated CI+P4 and plated in Cm25. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>08/07/12</h2><br /> | ||
+ | >P4 Purification. <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/0/0c/UnamgenomicsoANDcadmio08_08_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/0/0c/UnamgenomicsoANDcadmio08_08_2012.jpg' height="300" /></a> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. CI 02 EcoRI. <br /> | ||
+ | 3. 02 CI XbaI. <br /> | ||
+ | 4. 02 CI EcroRI/XbaI. <br /> | ||
+ | 5. CI 02 EcoRI/XbaI dephosphated. <br /> | ||
+ | 6. P4 E/S. <br /> | ||
+ | 7. P4 PCR. <br /> | ||
+ | 8. P4 PCR (-).<br /> | ||
+ | 9. LasR 1 PCR. <br /> | ||
+ | 10. LasR 2 PCR. <br /> | ||
+ | 11. LasR PCR from yesterday. <br /> | ||
+ | 12. LasR PCR (-).<br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>08/08/12</h2><br /> | ||
+ | We ligated CI+P4 and plated in Cm25. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]] <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/a/a4/UnamgenomicsoANDcadmio08_09_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/a/a4/UnamgenomicsoANDcadmio08_09_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'>1. LasR 1 PCR. <br /> | ||
+ | 2. LasR dephosphated (*) PCR. <br /> | ||
+ | 3. 1 kb Ladder. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/8/89/UnamgenomicsoANDcadmio08_09_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/8/89/UnamgenomicsoANDcadmio08_09_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. Purified LasR 1. <br /> | ||
+ | 3. Purified LasR *.<br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>08/09/12</h2><br /> | ||
+ | >We transformed the CI+P4 ligation in DH5α and plated it in Cm25. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]¬. <br /> | ||
+ | |||
+ | >We purified LasR PCRs so we could have linear LasR. <br /> | ||
+ | |||
+ | We digested LasR* with EcoRI and SpeI. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br /> | ||
+ | We ligated CI+LasR. <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/2/2a/UnamgenomicsoANDcadmio08_10_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/2/2a/UnamgenomicsoANDcadmio08_10_2012.jpg' height="300" /></a> | ||
+ | <div class='captionrojo'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2. CI EcoRI/XbaI. <br /> | ||
+ | 3. LasR EcoRI/SpeI. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>08/10/12</h2><br /> | ||
+ | We plated CI+LasR ligation in Cm25. <br /> | ||
+ | >We only obtained colonies in the CI+LasR plates and not in the CI. <br /> | ||
+ | > We put cultures so we could then do the P4+CI and CI+LasR lysis. <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <h2>08/13/12</h2><br /> | ||
+ | >We did CI+P4 and CI+LasR lysis by miniprep. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Lysis_protocol | Lysis protocol]]. <br /> | ||
+ | > We digested the lysis to free the fragment with EcoRI, EcoRI/PstI, PstI. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]]. <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/e/e0/UnamgenomicsoANDcadmio08_14_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e0/UnamgenomicsoANDcadmio08_14_2012.jpg' height="300" /></a> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'>1. CI+P4 1 EcoRI<br /> | ||
+ | 2. CI+P4 1 PstI<br /> | ||
+ | 3. CI+P4 1 EcoRI/Pst<br />I | ||
+ | 4. CI+P4 2 EcoRI<br /> | ||
+ | 5. CI+P4 2 PstI<br /> | ||
+ | 6. CI+P4 2 EcoRI/PstI<br /> | ||
+ | 7. CI+P4 3 EcoRI<br /> | ||
+ | 8. CI+P4 3 PstI<br /> | ||
+ | 9. CI+P4 3 EcoRI/PstI | ||
+ | 10. CI+P4 4 EcoRI<br /> | ||
+ | 11. CI+P4 4 PstI<br /> | ||
+ | 12. CI+P4 4 EcoRI/PstI<br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <br /> | ||
+ | <h2>08/14/12</h2><br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/1/1e/UnamgenomicsoANDcadmio08_15_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/1/1e/UnamgenomicsoANDcadmio08_15_2012.jpg' height="300" /></a> | ||
+ | <div class='captionrosa'> | ||
+ | <p class='captionInside'>1.1 kb ladder. <br /> | ||
+ | 2-17.P4CI lysis. <br /> | ||
+ | 18.CI lysis 02. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/e/e4/UnamgenomicsoANDcadmio08_15_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e4/UnamgenomicsoANDcadmio08_15_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionmoradoclaro'> | ||
+ | <p class='captionInside'>1.1 kb ladder. <br /> | ||
+ | 2.LasR CI lysis 5<br /> | ||
+ | 3.LasR CI lysis 6 <br /> | ||
+ | 4.LasR CI lysis 8<br /> | ||
+ | 5.LasR CI lysis 9 <br /> | ||
+ | 6.LasR CI lysis 10<br /> | ||
+ | 7.CI lysis 02<br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>08/15/12</h2><br /> | ||
+ | We did lysis of the rest of the colonies for the P4CI and LasRCI ligation. <br /> | ||
+ | |||
+ | >From these lysis we left digestions with EcoRI and PstI. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br /> | ||
+ | |||
+ | We put digestions for these lysis with E/P. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/d/d7/UnamgenomicsoANDcadmio08_16_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/d/d7/UnamgenomicsoANDcadmio08_16_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionmorado'> | ||
+ | <p class='captionInside'> | ||
+ | 1. 1 kb ladder. <br /> | ||
+ | 2-17. P4CI EcoRI/PstI Diferent colonies<br /> | ||
+ | 18. CI02 EcoRI<br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/0/0e/UnamgenomicsoANDcadmio08_16_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/0/0e/UnamgenomicsoANDcadmio08_16_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionazul'> | ||
+ | <p class='captionInside'> | ||
+ | 1. 1 kb ladder. <br /> | ||
+ | 2. LasRCI EcoRI 5. <br /> | ||
+ | 3. LasRCI EcoRI 6. <br /> | ||
+ | 4. LasRCI EcoRI 8. <br /> | ||
+ | 5. LasRCI EcoRI 9. <br /> | ||
+ | 6. LasRCI EcoRI 10. <br /> | ||
+ | 7. CI. <br /> | ||
+ | 8. - <br /> | ||
+ | 9. E/X digested Dephosphated CI. <br /> | ||
+ | 10. E/X digested CI. <br /> | ||
+ | 11. E/S digested LasR. <br /> | ||
+ | 12. E/S P4. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>08/16/12</h2><br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/e/e0/UnamgenomicsoANDcadmio08_17_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e0/UnamgenomicsoANDcadmio08_17_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'> | ||
+ | |||
+ | 1.P4CI lysis with kit 7. <br /> | ||
+ | 2.P4CI lysis with kit 7. <br /> | ||
+ | 3.P4CI lysis with kit 7. <br /> | ||
+ | 4.1 kb ladder. <br /> | ||
+ | 5.AmyE 5’ lysis from kit 1. <br /> | ||
+ | 6.AmyE 5’ lysis from kit 2. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/2/28/UnamgenomicsoANDcadmio08_17_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/2/28/UnamgenomicsoANDcadmio08_17_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'> | ||
+ | |||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.97 Promoter XbaI/PstI. <br /> | ||
+ | 3.98 Promoter XbaI/PstI. <br /> | ||
+ | 4.99 Promoter XbaI/PstI. <br /> | ||
+ | 5.AmyE 5’ lysis 1. <br /> | ||
+ | 6.AmyE 5’ lysis 2. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>08/17/12</h2><br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/7/75/UnamgenomicsoANDcadmio08_20_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/7/75/UnamgenomicsoANDcadmio08_20_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionrojo'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.97 promoter XbaI/PstI. <br /> | ||
+ | 3.98 promoter XbaI/PstI. <br /> | ||
+ | 4.99 promoter XbaI/PstI. <br /> | ||
+ | 5.P4CI EcoRI/SpeI. <br /> | ||
+ | 6.P4CI EcoRI/SpeI. <br /> | ||
+ | 7.P4CI SpeI. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/5/5d/UnamgenomicsoANDcadmio08_20_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/5/5d/UnamgenomicsoANDcadmio08_20_2012_2.jpg' height="300" /></a> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'> | ||
+ | 1. 1 kb ladder. <br /> | ||
+ | 2-8. LasRCI * lysis. <br /> | ||
+ | 8. CI lysis. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/d/d7/UnamgenomicsoANDcadmio08_20_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/d/d7/UnamgenomicsoANDcadmio08_20_2012_3.jpg' height="300" /></a> | ||
+ | <div class='captionrosa'> | ||
+ | <p class='captionInside'> | ||
+ | 1-8. LasR E/S lysis. <br /> | ||
+ | 9. 1 kb Ladder. <br /> | ||
+ | 10. -----<br /> | ||
+ | 11. P4CI EcoR<br />I. | ||
+ | 12. P4CI PstI. <br /> | ||
+ | 13. P4CI EcoRI/PstI. <br /> | ||
+ | 14. P4CI EcoRI/PstI. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>08/20/12</h2><br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <a href='https://static.igem.org/mediawiki/2012/0/09/UnamgenomicsoANDcadmio08_21_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/0/09/UnamgenomicsoANDcadmio08_21_2012_1.jpg' height="300" /></a> | ||
+ | <div class='captionaqua'> | ||
+ | <p class='captionInside'> | ||
+ | 1. P4CI BcuI/EcoRI<br /> | ||
+ | 2. 1 kb ladder. <br /> | ||
+ | 3. LasRCI * lysis 2. <br /> | ||
+ | 4. LasRCI * lysis 3. <br /> | ||
+ | 5. LasRCI * lysis 4. <br /> | ||
+ | 6. LasRCI lysis 4. <br /> | ||
+ | 7. LasRCI lysis 6. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/7/71/UnamgenomicsoANDcadmio08_21_2012_2.jpg' height="300" /> | ||
+ | <div class='captionmoradoclaro'> | ||
+ | <p class='captionInside'> | ||
+ | 1. 1 kb ladder. <br /> | ||
+ | 2. LasRCI * lysis 2. <br /> | ||
+ | 3. LasRCI * lysis 3. <br /> | ||
+ | 4. LasRCI * lysis 4. <br /> | ||
+ | 5. LasRCI lysis 4. <br /> | ||
+ | 6. LasRCI lysis 6. <br /> | ||
+ | 7. CI lysis. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <h2>08/21/12</h2><br /> | ||
+ | >We decided to use BcuI instead of SpeI because SpeI is not working properly. <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/b/b8/UnamgenomicsoANDcadmio08_22_2012.jpg' height="300" /> | ||
+ | <div class='captionmoradoclaro'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.B0014/E1010 * ExoRI/XbaI. <br /> | ||
+ | 3.B0014/E1010 ExoRI/XbaI. <br /> | ||
+ | 4.P4CI EcoRI/BcuI. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>08/22/12</h2><br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/8/8f/UnamgenomicsoANDcadmio08_23_2012.jpg' height="300" /> | ||
+ | <div class='captionmoradoclaro'> | ||
+ | <p class='captionInside'> | ||
+ | 1.LasR PCR. <br /> | ||
+ | 2.1 kb ladder. <br /> | ||
+ | 3.LasR PCR. <br /> | ||
+ | 4.LasR PCR. <br /> | ||
+ | 5.LasR * PCR. <br /> | ||
+ | 6.LasR control PCR. <br /> | ||
+ | 7.97 promoter XbaI/PstI. <br /> | ||
+ | 8.97 promoter XbaI/PstI. <br /> | ||
+ | 9.1 kb ladder. <br /> | ||
+ | 10.99 promoter X/P. <br /> | ||
+ | 11-18.LasRCI 1 lysis. <br /> | ||
+ | 19.1 kb ladder. | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>08/23/12</h2><br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/e/ed/UnamgenomicsoANDcadmio08_24_2012_1.jpg' height="300" /> | ||
+ | <div class='captionmorado'> | ||
+ | <p class='captionInside'> | ||
+ | 1. -<br /> | ||
+ | 2-9. LasRCI digestions EcoRI/PstI. <br /> | ||
+ | 10. 1 kb ladder. <br /> | ||
+ | 11. LasR 1 purification<br />. | ||
+ | 12. LasR 1 putification. <br /> | ||
+ | 13. LasR 1 purification. <br /> | ||
+ | 14. LasR purification from PCR which was done twice in the same batch. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/3/33/UnamgenomicsoANDcadmio08_24_2012_2.jpg' height="300" /> | ||
+ | <div class='captionazul'> | ||
+ | <p class='captionInside'> | ||
+ | 1.LasRCI 1. <br /> | ||
+ | 2.1 kb Ladder. <br /> | ||
+ | 3.LasRCI 2. <br /> | ||
+ | 4.LasRCI 3. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>08/24/12</h2><br /> | ||
+ | >We repeated LasR PCR but it didn’t work. <br /> | ||
+ | >We ligated RFP terminatr (E1010+B0014)+P4+CI(97/98/99) amyE 5’.[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]] <br /> | ||
+ | > We transformed this ligation. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]] | ||
+ | <h2>08/25/12</h2><br /> | ||
+ | We removed the plates from 37ºC. <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <h2>08/26/12</h2><br /> | ||
+ | We plated the colonies from the ligation P4CI+E1010+B0014 in Km30. We put liquid cultures of LB Km30 so we can do the lysis. <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/d/d3/UnamgenomicsoANDcadmio08_27_2012.jpg' height="300" /> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'> | ||
+ | 1. 1 kb ladder. <br /> | ||
+ | 2-19. P4CI+E1010B0014 lysis. <br /> | ||
+ | 20. E1010B0014 lysis. <br /> | ||
+ | 21. 1 kb ladder. <br /> | ||
+ | 22-39. P4CI+E1010B0014 lysis. <br /> | ||
+ | 40. E1010B0014 lysis. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>08/27/12</h2><br /> | ||
+ | We did alkaline lysis [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Lysis_protocol | LYSIS PROTOCOL]] of P4CI+E1010B0014. <br /> | ||
+ | |||
+ | >We did digestions of the lysis with EcoRI and PstI [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]]. <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/0/0b/UnamgenomicsoANDcadmio08_28_2012_1.jpg' height="300" /> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2 - 19.AmyE 5’ 97 E1010 B0014 lysis E/P digestion. <br /> | ||
+ | 20.AmyE 5’ lysis<br /> | ||
+ | 21.1 kb ladder. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/1/1d/UnamgenomicsoANDcadmio08_28_2012_2.jpg' height="300" /> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.LasR digested with E/S. <br /> | ||
+ | 3.CI digested with E/X. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/7/7e/UnamgenomicsoANDcadmio08_28_2012_3.jpg' height="300" /> | ||
+ | <div class='captionrojo'> | ||
+ | <p class='captionInside'> | ||
+ | 1. 1 kb ladder. <br /> | ||
+ | 2-7. AmyE 5’ 99 E/P . <br /> | ||
+ | 8-13. AmyE 5’ 97 E/P . <br /> | ||
+ | 14-19. AmyE 5’ 98 E/P . <br /> | ||
+ | 20. AmyE 5’ E/P . <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/9/97/UnamgenomicsoANDcadmio08_28_2012_4.jpg' height="300" /> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2-19.P4+CI+RFPterm E/P digestion I. <br /> | ||
+ | 20.RFPterm E/P digestion. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <h2>08/28/12</h2><br /> | ||
+ | We ligated LasRCI at 20 µl. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/2/27/UnamgenomicsoANDcadmio08_29_2012.jpg' height="300" /> | ||
+ | <div class='captionrosa'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2-3.AmyE 5’ 99 lysis from kit. <br /> | ||
+ | 4-5.AmyE 5’ 98 lysis from kit. <br /> | ||
+ | 6-7.AmyE 5’ 97 lysis from kit. <br /> | ||
+ | 8-11.P4 CI + E1010 B0014 Lysis from kit. <br /> | ||
+ | 12.CI 02 lysis from kit. <br /> | ||
+ | 13.AmyE 5’ lysis from kit. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>08/29/12</h2><br /> | ||
+ | We transformed the LasRCI ligation previously plated on Cm25. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]] <br /> | ||
+ | <br /> | ||
+ | We digested in 20µl with EcoRI/PstI AmyE’5 promoter lysis. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br /> | ||
+ | We counted and took LasRCI colonies and re-plated them. <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/1/1b/UnamgenomicsoANDcadmio08_31_2012_1.jpg' height="300" /> | ||
+ | <div class='captionrosa'> | ||
+ | <p class='captionInside'> | ||
+ | 1-2. AmyE 5’ 97 digestion E/P. <br /> | ||
+ | 3-4. AmyE 5’ 98 digestion E/P. <br /> | ||
+ | 5-6. AmyE 5’ 99 digestion E/P. <br /> | ||
+ | 7. AmyE 5’ digestion E . <br /> | ||
+ | 8. 1 kb ladder. <br /> | ||
+ | 9-12. P4CI E1010 B0014 E/P digestion I. <br /> | ||
+ | 13. 02 CI E/P. <br /> | ||
+ | 14. 1 kb ladder. <br /> | ||
+ | 15. BcuI 99 digestion. <br /> | ||
+ | 16. SpeI/PstI 99 digestion. <br /> | ||
+ | 17. S/P 98 digestion. <br /> | ||
+ | 18. S/P 97 digestion. <br /></p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/f/f0/UnamgenomicsoANDcadmio08_31_2012_2.jpg' height="300" /> | ||
+ | <div class='captionaqua'> | ||
+ | <p class='captionInside'> | ||
+ | 1. 1 kb ladder. <br /> | ||
+ | 2. Arsr-CzrA 97 promoter S/P. <br /> | ||
+ | 3. Arsr-CzrA 98 promoter S/P. <br /> | ||
+ | 4. Arsr-CzrA 99 promoter S/P. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>08/31/12</h2><br /> | ||
+ | |||
+ | We digested the promoters with S/P to ligate it with GFP+terminator so we could characterize them. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br /> | ||
+ | We left cultures with LasRCI to make lyses. <br /> | ||
+ | |||
+ | >We ran a gel with the promoter’s digestions with S/P to extract and ligate to E0040B0014. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]] [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | GEL EXTRACTION PROTOCOL]]. <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | ::::::::::::::::::::::::::::::::::::::[[File:UnamgenomcisUp.png|right | 120px |link=Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#Cadmium.2FHeavy_metals_AND_Gate_Notebook]] | ||
+ | =SEPTEMBER= | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/7/7b/UnamgenomicsoANDcadmio09_01_2012.jpg' height="300" /> | ||
+ | <div class='captionmoradoclaro'> | ||
+ | <p class='captionInside'> | ||
+ | 1. 1 kb ladder. <br /> | ||
+ | 2-12. LasRCI lysis. <br /> | ||
+ | 13. CI 02 lysis I. <br /> | ||
+ | 14. 1 kb ladder. <br /> | ||
+ | 15-25. LasR CI lysis XII. <br /> | ||
+ | 26. CI 02 lysis. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>09/01/12</h2><br /> | ||
+ | |||
+ | We digested these lysis [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] with EcoRI and PstI. <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/d/dd/UnamgenomicsoANDcadmio09_02_2012.jpg' height="300" /> | ||
+ | <div class='captionazul'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2-23.E/P LasRCI digestion. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>09/02/12</h2><br /> | ||
+ | >The fragment is not being freed. (LasRCI=1499 bp expected size). We will do a PCR to obtain more LasR since we have run out. <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/1/15/UnamgenomicsoANDcadmio09_03_2012_1.jpg' height="300" /> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.LasR PCR 1. <br /> | ||
+ | 3.Negative. <br /> | ||
+ | 4.LasR PCR 2. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/0/02/UnamgenomicsoANDcadmio09_03_2012_2.jpg' height="300" /> | ||
+ | <div class='captionrosa'> | ||
+ | <p class='captionInside'> | ||
+ | 1. 1 kb ladder. <br /> | ||
+ | 2. LasR1 purified. <br /> | ||
+ | 3. LasR2 purified. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/3/31/UnamgenomicsoANDcadmio09_03_2012_3.jpg' height="300" /> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.CI digested with E/X I. <br /> | ||
+ | 3.CI digested with E/X II. <br /> | ||
+ | 4.P4CI E1010 B0014 E/X I. <br /> | ||
+ | 5.P4CI E1010 B0014 E/X II. <br /> | ||
+ | 6.LasR SpeI. <br /> | ||
+ | 7.AmyE 5’ 97 SpeI III. <br /> | ||
+ | 8.AmyE 5’ 98 SpeI V. <br /> | ||
+ | 9.AmyE 5’ 99 SpeI V. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>09/03/12</h2><br /> | ||
+ | >We extracted from gel [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | GEL EXTRACTION PROTOCOL]]. <br /> | ||
+ | |||
+ | We digested CI with E/P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] . <br /> | ||
+ | |||
+ | We digested P4CI E1010 B0014 with EcoRI and XbaI. <br /> | ||
+ | |||
+ | LasR with SpeI. <br /> | ||
+ | |||
+ | AmyE 5’ CzrA ArsR 97,98,99 with SpeI. <br /> | ||
+ | |||
+ | >We digested AmyE 5’ CzrA-ArsR que E/S to ligate it with P4CI E1010B0014. <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/6/65/UnamgenomicsoANDcadmio09_04_2012_1.jpg' height="300" /> | ||
+ | <div class='captionrojo'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.E/S AmyE 5’ 97 digestion. <br /> | ||
+ | 3.E/S AmyE 5’ 98 digestion<br />. | ||
+ | 4.E/S AmyE 5’ 99 digestion. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/2/23/UnamgenomicsoANDcadmio09_04_2012_2.jpg' height="300" /> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'> | ||
+ | 1. 1 kb ladder. <br /> | ||
+ | 2. Amy E 5’ 97 SpeI/EcoRI. <br /> | ||
+ | 3. Amy E 5’ 97 SpeI/EcoRI. <br /> | ||
+ | 4. Amy E 5’ 98 SpeI/EcoRI. <br /> | ||
+ | 5. Amy E 5’ 98 SpeI/EcoRI. <br /> | ||
+ | 6. Amy E 5’ 99 SpeI/EcoRI. <br /> | ||
+ | 7. Amy E 5’ 99 SpeI/EcoRI. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/f/f8/UnamgenomicsoANDcadmio09_04_2012_3.jpg' height="300" /> | ||
+ | <div class='captionrosa'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.E/S AmyE 5’ 97 digestion. <br /> | ||
+ | 3.E/S AmyE 5’ 98 digestion. <br /> | ||
+ | 4.E/S AmyE 5’ 99 digestion. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>09/04/12</h2><br /> | ||
+ | |||
+ | |||
+ | E/S AmyE 5’ 99 digestion. <br /> | ||
+ | >The digestions have a low quality and concentration, which is why we’ll put new S digestions to obtain enough to extract. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br /> | ||
+ | |||
+ | •We ligated AmyE 5’ ArsR-CzrA 97/98/99 with E0040B0014. <br /> | ||
+ | •We ligated linearized plasmid PSBIC3 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/a/a2/UnamgenomicsoANDcadmio09_05_2012_1.jpg' height="300" /> | ||
+ | <div class='captionaqua'> | ||
+ | <p class='captionInside'> | ||
+ | 1-13. 1 kb ladder. <br /> | ||
+ | 14. AraR-CzrA 99 lysis. <br /> | ||
+ | 15-20. ArsR-CzrA 98-E0040B0014. <br /> | ||
+ | 21. 1 kb ladder<br /> | ||
+ | 22-27. ArsR-CzrA 98-E0040B0014. <br /> | ||
+ | 28. ArsR-CzrA 99<br /> | ||
+ | 29-40. ArsR-CzrA 99-E0040B0014. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/a/a8/UnamgenomicsoANDcadmio09_05_2012_2.jpg' height="300" /> | ||
+ | <div class='captionmoradoclaro'> | ||
+ | <p class='captionInside'> | ||
+ | 1-6.97 GFP term. <br /> | ||
+ | 7.1 kb ladder. <br /> | ||
+ | 8.98 GFP term I. <br /> | ||
+ | 9.98 GFP term VII. <br /> | ||
+ | 10.10 kb ladder. <br /> | ||
+ | 11-15. 99 GFP term III. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>09/05/12</h2><br /> | ||
+ | •We digested PstI/EcoRI ArsR-CzrA 97/98/99+E0040B0014 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTIONS PROTOCOL]]. <br /> | ||
+ | |||
+ | •The DNA seemed degraded. <br /> | ||
+ | |||
+ | •We made liquid cultures for the new lysis from the ligation ArsR-CzrA 97/98/99-E0040B0014 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE PROTOCOL]]. <br /> | ||
+ | |||
+ | •Transformed ligation AmyE 5’ ArsR-CzrA 97/98/99 + E0040B0014 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/d/dc/UnamgenomicsoANDcadmio09_06_2012_1.jpg' height="300" /> | ||
+ | <div class='captionmorado'> | ||
+ | <p class='captionInside'> | ||
+ | 1. 1 kb ladder. <br /> | ||
+ | 2-7. ArsR-CzrA_97_E0040B0014. <br /> | ||
+ | 8-13. ArsR-CzrA_98_E0040B0014 XII. <br /> | ||
+ | 14-19. ArsR-CzrA_99_E0040B0014 XIII. <br /> | ||
+ | 20. ArsR-CzrA 99<br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>09/06/12</h2><br /> | ||
+ | |||
+ | •We ligated AmyE 5’_97/98/99_P4CI_E0040B0014 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br /> | ||
+ | |||
+ | •We ligated AmyE 5’_ArsR-CzrA 97/98/99_E0040B0014 again [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | |||
+ | <h2>09/07/12</h2><br /> | ||
+ | |||
+ | •We made liquid cultures of AmyE 5’_97/98/99_P4CI_E1010B0014 in Km30 ans psbIc3c3 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE PROTOCOL]]. <br /> | ||
+ | •We transformed in DH5α LasRCI ligation and AmyE 5’_ArsR-CzrA 97/98/99_E0040B0014 and ArsR-CzrA 97/98/99_E0040B0014 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br /> | ||
+ | |||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/5/51/UnamgenomicsoANDcadmio09_09_2012.jpg' height="300" /> | ||
+ | <div class='captionazul'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2-10.AmyE 5’_ArsR-CzrA-97_P4CI_E1010B0014. <br /> | ||
+ | 11. P4 CI B0014 E1010 lysis. <br /> | ||
+ | 12-20. AmyE 5’_ArsR-CzrA-98_P4CI_E1010B0014. <br /> | ||
+ | 21. 1 kb ladder. <br /> | ||
+ | 22-30. AmyE 5’_ArsR-CzrA-99_P4CI_E1010B0014. <br /> | ||
+ | 31. P4 CI B0014 E1010 lysis. <br /> | ||
+ | 32-40. PSBIC3 lysis. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>08/09/12</h2><br /> | ||
+ | |||
+ | •Pellets grown in Km30 were pink and the plates where these were grown smell different. <br /> | ||
+ | |||
+ | •We put liquid cultures of this transformation to do lysis by kit [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE PROTOCOL]]. <br /> | ||
+ | |||
+ | •We streaked what grew Km30 from LasRCI transformation in Cm25, AmyE 5’_ArsR-CzrA-97/98/99_E1010B0014 in Km30 and ArsR-CzrA-97/98/99_E1010B0014 in Cm25. <br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/e/ea/UnamgenomicsoANDcadmio09_10_2012.jpg' height="300" /> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.PSBIC3 EcoRI I. <br /> | ||
+ | 3.PSBIC3 EcoRI III. <br /> | ||
+ | 4.PSBIC3 EcoRI V. <br /> | ||
+ | 5.PSBIC3 EcoRI VI. <br /> | ||
+ | 6.PSBIC3 EcoRI VII<br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/f/f5/UnamgenomicsoANDcadmio09_10_2012_2.jpg' height="300" /> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb Ladder. <br /> | ||
+ | 2-14.LasRCI lysis I. <br /> | ||
+ | 15.CI 02 lysis. <br /> | ||
+ | 16-20. ---<br /> | ||
+ | 21.1kb ladder. <br /> | ||
+ | 22-25.Amy E 5’ 97 GFP term. <br /> | ||
+ | 26-30.Amy E 5’ 98 GFP term I. <br /> | ||
+ | 31-34.Amy E 5’ 99 GFP term II. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>09/10/12</h2><br /> | ||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/9/96/UnamgenomicsoANDcadmio09_11_2012_1.jpg' height="300" /> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2-5.LasRCI E/P. <br /> | ||
+ | 6.--------<br /> | ||
+ | 7-8.Amy E 5’ 97 SpeI. <br /> | ||
+ | 9-10. Amy E 5’ 98 SpeI. <br /> | ||
+ | 11-12. Amy E 5’ 99 SpeI. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/3/34/UnamgenomicsoANDcadmio09_11_2012_2.jpg' height="300" /> | ||
+ | <div class='captionrojo'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.Amy E 5’ 97 lysis from kit. <br /> | ||
+ | 3.Amy E 5’ 98 lysis from kit. <br /> | ||
+ | 4.Amy E 5’ 99 lysis from kit. <br /> | ||
+ | 5.pSBIC3 lysis. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/7/77/UnamgenomicsoANDcadmio09_11_2012_4.jpg' height="300" /> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'> | ||
+ | 1-4.pSBIC3 E/P digestion. <br /> | ||
+ | 5. 1 kb ladder. <br /> | ||
+ | 6. 99 EcoRI. <br /> | ||
+ | 7-10.Amy E 5’ 99 EcoRI. <br /> | ||
+ | 11-14. Amy E 5’ 98 E/S. <br /> | ||
+ | 15-18. Amy E 5’ 97 E/S. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/e/e4/UnamgenomicsoANDcadmio09_11_2012_3.jpg' height="300" /> | ||
+ | <div class='captionrosa'> | ||
+ | <p class='captionInside'> | ||
+ | 1.Amy E 5’ 97 E/S. <br /> | ||
+ | 2.Amy E 5’ 98 E/S. <br /> | ||
+ | 3.Amy E 5’ 99 E/S. <br /> | ||
+ | 4.LasR M I PCR. <br /> | ||
+ | 5.LasR M II PCR. <br /> | ||
+ | 6.LasR (-) PCR. <br /> | ||
+ | 7.C0179 LasR I. <br /> | ||
+ | 8.C0179 LasR II. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>09/11/12</h2><br /> | ||
+ | |||
+ | •We digested pSBIC3 E/P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTIONS PROTOCOL]]. | ||
+ | •Amy 99 EcoRI 4 times. <br /> | ||
+ | •Amy 98 E/S twice. <br /> | ||
+ | •Amy 98 E twice. <br /> | ||
+ | •Amy 97 E/S 4 times. <br /> | ||
+ | •We did another LasR PCR [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#PCR_Protocol_.2850.C2.B5l.29 | PCR PROTOCOL]]. <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/b/bc/UnamgenomicsoANDcadmio09_12_2012_1.jpg' height="300" /> | ||
+ | <div class='captionaqua'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.LasR PCR M I. <br /> | ||
+ | 3.LasR PCR M II. <br /> | ||
+ | 4.LasR PCR (-).<br /> | ||
+ | 5.1 kb ladder. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/c/cb/UnamgenomicsoANDcadmio09_12_2012_2.jpg' height="300" /> | ||
+ | <div class='captionmoradoclaro'> | ||
+ | <p class='captionInside'> | ||
+ | 1.Amy E 5’ 98 E/S. <br /> | ||
+ | 2.Amy E 5’ 97 E/S. <br /> | ||
+ | 3.Amy E 5’ 97 E/S. <br /> | ||
+ | 4.1 kb ladder. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <h2>09/12/12</h2><br /> | ||
+ | |||
+ | We did a new LasR PCR with a new oligo stock [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#PCR_Protocol_.2850.C2.B5l.29 | PCR PROTOCOL]]. <br /> | ||
+ | |||
+ | 1.Amy E 5’ 98 purified E/S. <br /> | ||
+ | 2.Amy E 5’ 97 purified E/S. <br /> | ||
+ | 3.1 kb ladder<br /> | ||
+ | 4.CI 02 Lysis from kit. <br /> | ||
+ | 5.ArsR-CzrA 97 lysis. <br /> | ||
+ | 6.ArsR-CzrA 98 lysis. <br /> | ||
+ | 7.ArsR-CzrA 99 lysis. <br /> | ||
+ | 8.P4 lysis from kit. <br /> | ||
+ | 9.P4 CI E1010 B0014 lysis from kit. <br /> | ||
+ | 10.1 kb ladder. <br /> | ||
+ | 11.LasR PCR with new primer stock without DMSO. <br /> | ||
+ | 12.LasR PCR with new primer stock without DMSO. <br /> | ||
+ | 13.LasR PCR with new primer stock without DMSO. <br /> | ||
+ | 14.LasR PCR with new primer stock without DMSO (-).<br /> | ||
+ | 15.LasR PCR with new primer stock with DMSO. <br /> | ||
+ | 16.LasR PCR with new primer stock with DMSO. <br /> | ||
+ | 17.PCR LasrR (-).<br /> | ||
+ | 18.LasR PCR with new primer stock DMSO. <br /> | ||
+ | 19.LasR PCR with new primer stock DMSO. <br /> | ||
+ | 20.LasR PCR with new primer stock DMSO (-).<br /> | ||
+ | |||
+ | •We digested previous lysis with E/P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTIONS PROTOCOL]]. <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/9/91/UnamgenomicsoANDcadmio09_13_2012.jpg' height="300" /> | ||
+ | <div class='captionmorado'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2-5.PCR LasR. <br /> | ||
+ | 6.PCR LasR (-).<br /> | ||
+ | 7.P4 PCR. <br /> | ||
+ | 8.P4 PCR. <br /> | ||
+ | 9.P4 PCR (-).<br /> | ||
+ | 10.97 digested with E/P. <br /> | ||
+ | 11.98 digested with E/P. <br /> | ||
+ | 12.99 digested with E/P. <br /> | ||
+ | 13.CI digested with E/P. <br /> | ||
+ | 14.1 kb ladder. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/4/42/UnamgenomicsoANDcadmio09_13_2012_2.jpg' height="300" /> | ||
+ | <div class='captionazul'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.P4CI E1010B0014 E/X I. <br /> | ||
+ | 3.P4CI E1010B0014 E/X II. <br /> | ||
+ | 4.Amy E 5’ 97 E/S. <br /> | ||
+ | 5.Amy E 5’ 98 E/S. <br /> | ||
+ | 6.Amy E 5’ 98 E/S. <br /> | ||
+ | 7.Amy E 5’ 99 E/S. <br /> | ||
+ | 8.Amy E 5’ 99 E/S. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/f/fb/UnamgenomicsoANDcadmio09_13_2012_3.jpg' height="300" /> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'> | ||
+ | 1.Amy 98 E/S. <br /> | ||
+ | 2.Amy 99 E/S. <br /> | ||
+ | 3.Amy 99 E/S. <br /> | ||
+ | 4.1 kb ladder. <br /> | ||
+ | 5-9.LasR PCR. <br /> | ||
+ | 10.LasR PCR (-).<br /> | ||
+ | 11.P4 PCR. <br /> | ||
+ | 12.P4 PCR. <br /> | ||
+ | 13.P4 PCR (-).<br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/7/79/UnamgenomicsoANDcadmio09_13_2012_4.jpg' height="300" /> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'> | ||
+ | 1.Cut Amy 98 E/S. <br /> | ||
+ | 2.Cut Amy 99 E/S. <br /> | ||
+ | 3.Cut Amy 99 E/S. <br /> | ||
+ | 4.1 kb ladder. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/2/22/UnamgenomicsoANDcadmio09_13_2012_5.jpg' height="300" /> | ||
+ | <div class='captionrojo'> | ||
+ | <p class='captionInside'> | ||
+ | 1.1 kb ladder. <br /> | ||
+ | 2.97 E/P. <br /> | ||
+ | 3.97 E/P. <br /> | ||
+ | 4.98 E/P. <br /> | ||
+ | 5.98 E/P. <br /> | ||
+ | 6.99 E/P. <br /> | ||
+ | 7.99 E/P. <br /> | ||
+ | 8.CI E/P. <br /> | ||
+ | 9.CI E/P. <br /> | ||
+ | </p> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </html> | ||
+ | <h2>09/13/12</h2><br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/5/5c/UnamgenomicsoANDcadmio09_14_2012.jpg' width="300"/> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'>1.ArsR-CzrA 97 E/P. <br /> | ||
+ | 2.ArsR-CzrA 98 E/P. <br /> | ||
+ | 3.ArsR-CzrA 99 E/P. <br /> | ||
+ | 4.CI 02 E/P. <br /> | ||
+ | 5.P4 PCR. <br /> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/0/04/UnamgenomicsoANDcadmio09_14_2012_2.jpg' height="300"/> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'>We extracted the correct band by kit <br /> | ||
+ | 1.ArsR-CzrA 97 E/P. <br /> | ||
+ | 2.ArsR-CzrA 98 E/P. <br /> | ||
+ | 3.ArsR-CzrA 99 E/P. <br /> | ||
+ | 4.CI 02 E/P. <br /> | ||
+ | 5.P4 PCR. <br /> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/e/ea/UnamgenomicsoANDcadmio09_14_2012_3.jpg' height="300"/> | ||
+ | <div class='captionrojo'> | ||
+ | <p class='captionInside'>1. 1 kb ladder. <br /> | ||
+ | 2.00179 Lasr lysis<br />. | ||
+ | 3.00179 LasR. <br /> | ||
+ | 4.00179 Lasr (-).<br /> | ||
+ | 5.LasR 00179 new primers. <br /> | ||
+ | 6.LasR 00179 new primers. <br /> | ||
+ | 7.LasR 00179 new primers (-).<br /> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/9/9e/UnamgenomicsoANDcadmio09_14_2012_4.jpg' height="300"/> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'>1.1 kb ladder. <br /> | ||
+ | 3.ArsR-CzrA 97 E/P. <br /> | ||
+ | 5.ArsR-CzrA 98 E/P. <br /> | ||
+ | 7.ArsR-CzrA 99 E/P. <br /> | ||
+ | 9.CI 02 E/P. <br /> | ||
+ | 11.AmyE 5’ ArsR-CzrA 97 E/S. <br /> | ||
+ | 13.AmyE 5’ ArsR-CzrA 98 E/S. <br /> | ||
+ | 15.AmyE 5’ ArsR-CzrA 99 E/S. <br /> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/5/55/UnamgenomicsoANDcadmio09_14_2012_5.jpg' height="300"/> | ||
+ | <div class='captionrosa'> | ||
+ | <p class='captionInside'>1.ArsR-CzrA 97 E/P. <br /> | ||
+ | 2.ArsR-CzRA 98 E/P. <br /> | ||
+ | 3.1 kb ladder. <br /> | ||
+ | 4.ArsR-CzRA 99 E/P. <br /> | ||
+ | 5.CI 02 E/P. <br /> | ||
+ | 6.AmyE 5’ 97 E/S. <br /> | ||
+ | 7.AmyE 5’ 98 E/S. <br /> | ||
+ | 8.1 kb ladder. <br /> | ||
+ | 9.AmyE 5’ 99 E/S. <br /> | ||
+ | 10.LasR PCR. <br /> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/2/2f/UnamgenomicsoANDcadmio09_14_2012_6.jpg' height="300"/> | ||
+ | <div class='captionaqua'> | ||
+ | <p class='captionInside'>1.ArsR-CzrA 97 E/P. <br /> | ||
+ | 2.ArsR-CzRA 98 E/P. <br /> | ||
+ | 3.1 kb ladder. <br /> | ||
+ | 4.ArsR-CzRA 99 E/P. <br /> | ||
+ | 5.CI 02 E/P. <br /> | ||
+ | 6.AmyE 5’ 97 E/S. <br /> | ||
+ | 7.AmyE 5’ 98 E/S. <br /> | ||
+ | 8.1 kb ladder. <br /> | ||
+ | 9.AmyE 5’ 99 E/S. <br /> | ||
+ | 10.LasR PCR. <br /> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | |||
+ | <h2>09/14/12</h2><br /> | ||
+ | |||
+ | We extracted the correct band by kit [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | GEL EXTRACTION PROTOCOL]]. <br /><br /> | ||
+ | >We transformed ligation psB1c3+ArsR-CzrA 97/98/99/CI in competent DH5α cells from the pBad/pXyl AND team and in our own DH5α competent cells[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br /><br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <h2>09/15/12</h2><br /> | ||
+ | >We checked our transformations an did liquid cultures and passed the colonies to new plates [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE PROTOCOL]]. <br /> | ||
+ | >We digested E0040+B0014 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTIONS PROTOCOL]]. <br /> | ||
+ | |||
+ | >We ligated 97/98/99 psBIC3 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/a/a8/UnamgenomicsoANDcadmio09_16_2012.jpg' height="300"/> | ||
+ | <div class='captionaqua'> | ||
+ | <p class='captionInside'>1.AmyE 5’ 97 S/P. <br /> | ||
+ | 2. | ||
+ | 3.AmyE 5’ 98 S/P. <br /> | ||
+ | 4. | ||
+ | 5.1 kb ladder. <br /> | ||
+ | 6.AmyE 5’ 99 S/P. <br /> | ||
+ | 7.AmyE 5’ 99 S/P. <br /> | ||
+ | 8.E0040 B0014 X/P. <br /> | ||
+ | 9. | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/8/89/UnamgenomicsoANDcadmio09_16_2012_2.jpg' width="300"/> | ||
+ | <div class='captiongray'> | ||
+ | <p class='captionInside'>1.E0040 B0014 X/P to extract. <br /> | ||
+ | 2.1 kb ladder. <br /> | ||
+ | 3.Lysis. <br /> | ||
+ | 4.-19. Amy 5’ 99/97/P4CIE1010B0014 lysis. <br /> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/b/b0/UnamgenomicsoANDcadmio09_16_2012_3.jpg' height="300"/> | ||
+ | <div class='captionnaranja'> | ||
+ | <p class='captionInside'>1.LasR PCR. <br /> | ||
+ | 2.LasR PCR. <br /> | ||
+ | 3.LasR PCR. <br /> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/c/c1/UnamgenomicsoANDcadmio09_16_2012_4.jpg' height="300"/> | ||
+ | <div class='captionrojo'> | ||
+ | <p class='captionInside'>1.1 kb ladder. <br /> | ||
+ | 2.Purified P4. <br /> | ||
+ | 3.Purified LasR. <br /> | ||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/3/38/UnamgenomicsoANDcadmio09_16_2012_5.jpg' height="300"/> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'>Top part is degraded. | ||
+ | Bottom: | ||
+ | 1.99 E/P. <br /> | ||
+ | 2.99 E/P. <br /> | ||
+ | 3.CI 02 E/P. <br /> | ||
+ | 4.CI 02 E/P. <br /> | ||
+ | |||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | <h2>09/16/12</h2><br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/d/d6/UnamgenomicsoANDcadmio09_18_2012.jpg' height="300"/> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'>A3/Pveg lysis. <br /><br /> | ||
+ | |||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/8/8f/UnamgenomicsoANDcadmio09_18_2012_2.jpg' height="300"/> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'>1.-12. psCIC3 omega lysis. <br /> | ||
+ | 13. 1 kb ladder. <br /> | ||
+ | 14. psBIc3-GusA. <br /> | ||
+ | <br /> | ||
+ | |||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/e/ec/UnamgenomicsoANDcadmio09_18_2012_3.jpg' height="300"/> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'> | ||
+ | |||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/f/fa/UnamgenomicsoANDcadmio09_18_2012_4.jpg' height="300"/> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'>Digested A3 and pVeg with E/P. <br /> | ||
+ | |||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | |||
+ | |||
+ | <html> | ||
+ | <div class='thumbnailWrapper'> | ||
+ | <ul> | ||
+ | <li> | ||
+ | <img src='https://static.igem.org/mediawiki/2012/9/94/UnamgenomicsoANDcadmio09_18_2012_5.jpg' height="300"/> | ||
+ | <div class='captionverde'> | ||
+ | <p class='captionInside'>1.ArsR-CzrA 97 E/P. <br /> | ||
+ | 2.ArsR-CzrA 98 E/P. <br /> | ||
+ | 3.ArsR-CzrA 99 E/P. <br /> | ||
+ | 4.02-CI E/P. <br /> | ||
+ | 5.PCR P4 purified. <br /> | ||
+ | |||
+ | </div> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | <br /><br /> | ||
+ | </html> | ||
+ | |||
+ | <h2>09/18/12</h2><br /> | ||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | |||
+ | <br /> | ||
+ | <h2>09/19/12</h2> | ||
+ | ::::::::::::::::::::::::::::::::::::::[[File:UnamgenomcisUp.png|right | 120px |link=Team:UNAM_Genomics_Mexico/Notebook/ANDMetal#Cadmium.2FHeavy_metals_AND_Gate_Notebook]] | ||
}} | }} |
Latest revision as of 23:34, 26 October 2012
Cadmium/Heavy metals AND Gate Notebook
MAY
05/29/2012
Our group is in charge of building part of the “and” construction. We started analyzing if the plasmid we have with P4 actually had what we needed.
The plasmid PRMn25 contains the protein P4. It has Amp100 resistance and comes in Escherichia coli NFI. Cells were lysed to make sure the plasmid was present in these cells (5000bp). We ran a gel with 3 lysis, a sample from the plasmid PFRC54 (A3 promoter) and a sample of total DNA from the strain from which PFRC54 was obtained.
05/31/2012
Plasmid PRMn25 was digested with SpeI and EcoRI. We do not have the sequence of the plasmid, but there seem to be several restriction sites for SpeI and just one site for EcoRI. The digestions were left for 4 hours and they were plused in the microwave 3 times, 10 seconds each time. Only Dulce’s digestion worked, even though it was the “dirtiest” sample.
JUNE
06/06/2012
We repeated the lysis of PRMn25.
Digestions (20 µl)
H2O 12 µl
Enzime 1 µl
Buffer 10x 2 µl
Plasmid 5 µl
37ºC
PRMn25 was digested with EcoRi and BamHI. Since we don’t have the sequence we used these enzyme to confirm the restriction sites mentioned in Rojo et al. (1990). These sites were corroborated and the vector was linearized. We recycled the gel used for the PRMn25 lysis, which is why the gel seems out of phase.
06/08/12
The lysis worked so we transformed PRMn25 in DH5α. We performed a lysis on these cells to see if they had been transformed correctly with PRMn25.
We also transformed PFRC54. TRANSFORMATION PROTOCOL
06/11/12
We designed primers for our project. (Note from 07/10/12: we redesigned the primer for LasR, since the sequence was incorrect.)
OLIGOS 14/06/12
LASR
UPPER 5'-3'
PREFIX+RBS+SPACER+LASR
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCATTAGTAGAT
LOWER 5'-3'
SUFIX+LASR
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA TCATAATGTAATTAA
P4 5'-3'
PREFIX+RBS+SPACER+P4
upper
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGCCTAAAACACAA
SUFIX+P4
lower 5'-3'
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CTACACCATACTTTT
A3 (PROMOTER)
UPPER 5'-3'
PREFIX+A3
5' GTTTCTTCGAATTCGCGGCCGCTTCTAGAG taactttttgcaaga 3'
LOWER 5'-3'
SUFIX+A3
5'GTTTCTTCCTGCAGCGGCCGCTACTAGTA ctacttaattatacc 3'
RFP
UPPER 5'-3'
PREFIX+RBS+SPACER+RFP
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCTTCCTCCGAA
LOWER 5'-3'
SUFIX+RFP
GTTTCTTCCTGCAGCGGCCGCTACTAGTA TTATTAAGCACCGGT
GUSA
UPPER 5'-3'
PREFIX+RBS+SPACER+GUSA
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG atgttacgtcctgta
LOWER 5'-3'
SUFIX+GUSA
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA tcattgtttgcctcc
ARAC without LVA (version 2 registry part: BBa_C0080)
UPPER 5'-3'
PREFIX+RBS+SPACER+ARAC
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCTGAAGCGCAA
LOWER 5'-3'
SUFIX+ARAC
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CAACTTGACGGCTAC
06/14/2012
We obtained the terminator from the 2012 distribution (plate 2 24C) and we transformed the DNA in DH5α TRANSFORMATION PROTOCOL. The terminator (BBa_B0014) comes in the PSBIAK3 plasmid with resistance to Amp and Km. The RFP (BBa_E1010) comes in the plasmid PSBI2K3 with resistance to Amp and we obtained it from the 2012 distribution plate 2 (17E). We obtained the purified plasmid of the RFP from the AraC AND team. (Diego, Jonathan, and Abiel).
06/15/12
Due to the failed digestions, we did the RFP and terminator lysis again.
The AraC team has the terminator plasmid purified, we are thinking of using that one.
06/18/12
We used the RFP that we transformed and the RFP that the AraC team did as a positive control. The terminator still looks strange, since we can’t observe supercoling which is normally observed.
We are waiting for our primers, and the team will be going to a math modeling course for a week.
JULY
07/02/12
We did 2 PCRs, since the primers have arrived. We purified by miniprep RFP and P4. With this PCR we will add the prefix (EcoRI and XbaI) and RBS to the beginning of the sequence, and suffix (restiction sites for SpeI asn PstI).
RFP, P4 PCR PROTOCOL
TM’s
RFP UP 78ºC
RFP LW 75.5 ºC
P4 UP 73.6 ºC
P4 LW 73.9ºC
Taking into account both TM’s, we used the same amplification program for both, thermocycle B progam iGEM.
We ran a gel and we observed fragments that correspond to the RFP and P4, we can also observe other fragments which means we will have to purify the bands.
07/03/12
We used Roche kit for band purification.
The P4 purification turned out slightly dirty and the RFP turned out completely dirty. We repeated the purifications by loading the previously “purified” sample and repeating the procedure.
07/04/2012
We repeated the gel where we checked the re-purification, and indeed we need to repeat P4’s PCR.
The PCR worked, but a band purification will be needed. We fused all of the PCR product and loaded it.
We grew bacterial culture in antibiotics for LasR lysis.
Rfp+terminator ligation LIGATION PROTOCOL
07/05/12
Cells were transformed with DH5α with RFP+terminator ligation.TRANSFORMATION PROTOCOL
LasR lysis were digested. We ran a gel with LasR PCRs to add RBS prefix and suffix.
07/06/12
We ran LasR’s PCRs again, the last PCR didn’t work, which is why we lowered the temperature to 65ºC. We left the digestions all night. PCR PROTOCOL
Since they didn’t work, we decided to do it directly from the distribution from 2012 and 2010.
We noticed our mistake…. The sequence we designed our primers for was an incorrect sequence!
We need to redo LasR primers.
Our ligation didn’t work.
We redid RFP+terminator ligation and left it for the weekend. LIGATION PROTOCOL
07/09/12
We transformed the RFP+terminator ligation in DH5α and plated it in LB Km30. TRANSFORMATION PROTOCOL
We digested RFP with EcoRI and SpeI. DIGESTION PROTOCOL
07/10/12
By 9am we didn’t observe colonies in our LB Km30 with yesterday’s transformation, so using yesterday’s RFP digestions we redid the ligation.
We did another PCR of RFP because we ran out of it.
We ran a gel with the dephosphated terminator and digested RFP.
The PCR turned out ok except for some non-specific bands, we will need to extract the correct DNA band.
07/11/12
We loaded the whole PCR product from the PCR.
>We took a picture of the gel to check the purification elutions but we did not observe anything so we quantified it on the nanodrop.
Sample 1) 5.9 ng/µl
Sample 2) 2.5 ng/µl
>With the RFP digested with EcoRI and SpeI we did another ligation with the terminator digested with EcoRI and XbaI and left it at 22ºC.
>We transformed yesterday’s ligation in DH5α and plated it in LB Km30. Since our ligations have not worked we decided to redo the digestions on the terminator (E0014). We asked the other AND team to give us the purified plasmid, but it wasn’t enough so we streaked 2 plates LB Km30 so we could have the strain with the terminator. Tomorrow we will put liquid cultures and do lysis.
>We did digestions in another vector to see the efficiency of the enzymes as a test. We used PBBR-GusA with 5 µl of PBBR GusA, one digestion with 1.5 µl of EcoRI, one with 1 µl of SpeI and one with 1 µl of SpeI and 1.5 µl of EcoRI.
We left them at 37ºC.
>We did 5 new RFP PCRs.
>We streaked again the following strains:
-DH5α +PRFc54
-DH5α +Terminator
The PCRs seem to show the band we need, we will have to extract them.
07/12/12
We checked the transformations from the ligation “3” from RFP+terminator. We didn’t observe colonies.
>We transformed the ligation “4” RFP+terminator in DH5α, they were plated in LB Km30 .
>We ran a gel with GusA digestions.
>We digested 80 µl of the purified RFP with EcoRI and SpeI DIGESTION PROTOCOL.
>We left liquid cultures in LB Km30 so we can do an alkaline lysis of the plasmid containing the terminator (B0014).
07/13/12
>We did alkaline lysis of the terminator cultures from last night. We ran it and they all look ok, but we’ll use the first one because it seems to be the cleanest.
We ligated RFP/terminator and ran a gel to see RFP and the terminator. LIGATION PROTOCOL.
>We checked the transformations and didn’t see colonies.
07/16/12
We ran a gel with the RFP digestion, the purified terminator, and the RFP terminator ligation that was left for the whole weekend. (GEL NOT SHOWN)
>We digested the terminator with EcoRI and XbaI DIGESTION PROTOCOL.
> We digested RFP 1 with EcoRI and SpeI DIGESTION PROTOCOL.
In the gel we can see that the terminator digestion in ok, although it is still partial. We need to leave it for the whole night. We can’t see the RFP digestion; it is possible that it degraded. We will concentrate RFP.
07/17/12
We ran 6 50 µl reactions of the PCR to amplify RFP. We will use as DNA RFP from the lysis, one from 2012, and one from 2010. We will make a dilution, use 1 µl of lysis and diluted them in H2O.
PCR protocol.
>We can still observe bands in the purification, we will try to do a better PCR.
>We digested the terminator lysis with EcoRI and XbaI and we decided to switch buffers. We used buffer 2 even though EcoRI might have a star effect. DIGESTION PROTOCOL
07/18/12
We did a PCR using hot star and without MgCl2. HOT START PCR PROTOCOL
We left an RFP digestion and took the DNA from the RFP PCR which looked good. PCR PROTOCOL
From these PCR products we left the PCR digestion with EcoRI and SpeI and used enzymes from the same company. DIGESTION PROTOCOL
07/19/12
From the three RFP digestions we left yesterday we ran a gel to prove that our DNA wasn’t being degraded, as it had been happening.
> Our DNA wasn’t degraded, we will use these digestions to do the ligation.
>We did lysis of the terminator cultures by miniprep. LYSIS PROTOCOL
We ligated RFP+terminator. LIGATION PROTOCOL
We transformed the ligation. TRANFORMATION PROTOCOL
07/20/12
We observed two colonies, we put them in liquid LB.
07/23/12
We made a lysis of the ligation using miniprep.
>We did the following digestions
DIGESTION PROTOCOL
•EcoRI/PstI ligation
•EcoRI ligation
•PstI ligation
The results indicate that the vector only ligated with itself.
We put B0014 and E1010 digestions. DIGESTION PROTOCOL
Boo14 EcoRI
Boo14-XbaI
B0014 EcoRI/XbaI
E1010 EcoRI
E1010 SpeI
E1010 EcoRI/SpeI
07/24/12
We dephosphated the B0014-E/X digestion. DEPHOSPHORYLATION PROTOCOL
>We inactivated every digestion 10 minutes at 70ºC. We ran an agarose gel at 100 volts.
We put 4 ligations: LIGATION PROTOCOL
B0014 dephosphated + E1010
B0014 + E1010
B0014
B0014 dephosphated
07/25/12
At 9:30 we still didn’t observe colonies of the ligation transformation.
At 1:35 20 colonies were cultivated so we could digest them (XbaI/PstI) DIGESTION PROTOCOL.
07/26/12
In the previous gel we observed that cultures grown were actually re-ligated vectors.
We need to put ligations again.
>E1010 doesn’t look as it should, we’ll extract from band. GEL EXTRACTION PROTOCOL
We ligated B0014+E1010 LIGATION PROTOCOL.
07/27/12
07/30/12
>We transformed the ligations.
E1010+B0014 dephosphated.
E1010+B0014.
B0014 dephosphated.
B0014.
Negative Control.
07/31/12
The colonies from the transformation grew well, though we believe the dephosphatase isn’t working properly.
We took 103 colonies and put 18 cultures to do the alkaline lysis.
August
08/01/12
We digested with XbaI and PstI colonies 3,5,8,9,14.
DIGESTION PROTOCOL
08/02/12
08/03/12
08/07/12
>P4 Purification.
08/08/12
We ligated CI+P4 and plated in Cm25. LIGATION PROTOCOL
08/09/12
>We transformed the CI+P4 ligation in DH5α and plated it in Cm25. TRANSFORMATION PROTOCOL¬.
>We purified LasR PCRs so we could have linear LasR.
We digested LasR* with EcoRI and SpeI. DIGESTION PROTOCOL
We ligated CI+LasR.
08/10/12
We plated CI+LasR ligation in Cm25.
>We only obtained colonies in the CI+LasR plates and not in the CI.
> We put cultures so we could then do the P4+CI and CI+LasR lysis.
08/13/12
>We did CI+P4 and CI+LasR lysis by miniprep. Lysis protocol.
> We digested the lysis to free the fragment with EcoRI, EcoRI/PstI, PstI. DIGESTION PROTOCOL.
08/14/12
08/15/12
We did lysis of the rest of the colonies for the P4CI and LasRCI ligation.
>From these lysis we left digestions with EcoRI and PstI. DIGESTION PROTOCOL
We put digestions for these lysis with E/P. DIGESTION PROTOCOL
08/16/12
08/17/12
08/20/12
08/21/12
>We decided to use BcuI instead of SpeI because SpeI is not working properly.
08/22/12
08/23/12
08/24/12
>We repeated LasR PCR but it didn’t work.
>We ligated RFP terminatr (E1010+B0014)+P4+CI(97/98/99) amyE 5’. LIGATION PROTOCOL
> We transformed this ligation. TRANSFORMATION PROTOCOL
08/25/12
We removed the plates from 37ºC.
08/26/12
We plated the colonies from the ligation P4CI+E1010+B0014 in Km30. We put liquid cultures of LB Km30 so we can do the lysis.
08/27/12
We did alkaline lysis LYSIS PROTOCOL of P4CI+E1010B0014.
>We did digestions of the lysis with EcoRI and PstI DIGESTION PROTOCOL.
08/28/12
We ligated LasRCI at 20 µl. LIGATION PROTOCOL.
08/29/12
We transformed the LasRCI ligation previously plated on Cm25. TRANSFORMATION PROTOCOL
We digested in 20µl with EcoRI/PstI AmyE’5 promoter lysis. DIGESTION PROTOCOL
We counted and took LasRCI colonies and re-plated them.
08/31/12
We digested the promoters with S/P to ligate it with GFP+terminator so we could characterize them. DIGESTION PROTOCOL
We left cultures with LasRCI to make lyses.
>We ran a gel with the promoter’s digestions with S/P to extract and ligate to E0040B0014. LIGATION PROTOCOL GEL EXTRACTION PROTOCOL.
SEPTEMBER
09/01/12
We digested these lysis DIGESTION PROTOCOL with EcoRI and PstI.
09/02/12
>The fragment is not being freed. (LasRCI=1499 bp expected size). We will do a PCR to obtain more LasR since we have run out.
09/03/12
>We extracted from gel GEL EXTRACTION PROTOCOL.
We digested CI with E/P DIGESTION PROTOCOL .
We digested P4CI E1010 B0014 with EcoRI and XbaI.
LasR with SpeI.
AmyE 5’ CzrA ArsR 97,98,99 with SpeI.
>We digested AmyE 5’ CzrA-ArsR que E/S to ligate it with P4CI E1010B0014.
09/04/12
E/S AmyE 5’ 99 digestion.
>The digestions have a low quality and concentration, which is why we’ll put new S digestions to obtain enough to extract. DIGESTION PROTOCOL
•We ligated AmyE 5’ ArsR-CzrA 97/98/99 with E0040B0014.
•We ligated linearized plasmid PSBIC3 LIGATION PROTOCOL.
09/05/12
•We digested PstI/EcoRI ArsR-CzrA 97/98/99+E0040B0014 DIGESTIONS PROTOCOL.
•The DNA seemed degraded.
•We made liquid cultures for the new lysis from the ligation ArsR-CzrA 97/98/99-E0040B0014 LIQUID CULTURE PROTOCOL.
•Transformed ligation AmyE 5’ ArsR-CzrA 97/98/99 + E0040B0014 LIGATION PROTOCOL.
09/06/12
•We ligated AmyE 5’_97/98/99_P4CI_E0040B0014 LIGATION PROTOCOL.
•We ligated AmyE 5’_ArsR-CzrA 97/98/99_E0040B0014 again LIGATION PROTOCOL.
09/07/12
•We made liquid cultures of AmyE 5’_97/98/99_P4CI_E1010B0014 in Km30 ans psbIc3c3 LIQUID CULTURE PROTOCOL.
•We transformed in DH5α LasRCI ligation and AmyE 5’_ArsR-CzrA 97/98/99_E0040B0014 and ArsR-CzrA 97/98/99_E0040B0014 TRANSFORMATION PROTOCOL.
08/09/12
•Pellets grown in Km30 were pink and the plates where these were grown smell different.
•We put liquid cultures of this transformation to do lysis by kit LIQUID CULTURE PROTOCOL.
•We streaked what grew Km30 from LasRCI transformation in Cm25, AmyE 5’_ArsR-CzrA-97/98/99_E1010B0014 in Km30 and ArsR-CzrA-97/98/99_E1010B0014 in Cm25.
09/10/12
09/11/12
•We digested pSBIC3 E/P DIGESTIONS PROTOCOL.
•Amy 99 EcoRI 4 times.
•Amy 98 E/S twice.
•Amy 98 E twice.
•Amy 97 E/S 4 times.
•We did another LasR PCR PCR PROTOCOL.
09/12/12
We did a new LasR PCR with a new oligo stock PCR PROTOCOL.
1.Amy E 5’ 98 purified E/S.
2.Amy E 5’ 97 purified E/S.
3.1 kb ladder
4.CI 02 Lysis from kit.
5.ArsR-CzrA 97 lysis.
6.ArsR-CzrA 98 lysis.
7.ArsR-CzrA 99 lysis.
8.P4 lysis from kit.
9.P4 CI E1010 B0014 lysis from kit.
10.1 kb ladder.
11.LasR PCR with new primer stock without DMSO.
12.LasR PCR with new primer stock without DMSO.
13.LasR PCR with new primer stock without DMSO.
14.LasR PCR with new primer stock without DMSO (-).
15.LasR PCR with new primer stock with DMSO.
16.LasR PCR with new primer stock with DMSO.
17.PCR LasrR (-).
18.LasR PCR with new primer stock DMSO.
19.LasR PCR with new primer stock DMSO.
20.LasR PCR with new primer stock DMSO (-).
•We digested previous lysis with E/P DIGESTIONS PROTOCOL.
09/13/12
09/14/12
We extracted the correct band by kit GEL EXTRACTION PROTOCOL.
>We transformed ligation psB1c3+ArsR-CzrA 97/98/99/CI in competent DH5α cells from the pBad/pXyl AND team and in our own DH5α competent cells TRANSFORMATION PROTOCOL.
09/15/12
>We checked our transformations an did liquid cultures and passed the colonies to new plates LIQUID CULTURE PROTOCOL.
>We digested E0040+B0014 DIGESTIONS PROTOCOL.
>We ligated 97/98/99 psBIC3 LIGATION PROTOCOL.
09/16/12
09/18/12