"
Team:University College London/LabBook/Week12
From 2012.igem.org
Sednanalien (Talk | contribs) (→28.08.12) |
Sednanalien (Talk | contribs) (→28.08.12) |
||
| Line 115: | Line 115: | ||
| - | Ligation Number Components Amounts | + | {| class="wikitable" |
| - | 1 PCR amplified Curli 12 ul | + | !Ligation Number !!Components !!Amounts |
| - | + | |- | |
| - | + | |rowspan="3" |1 ||PCR amplified Curli ||12 ul | |
| - | 2 PCR amplified Curli 6 ul | + | |- |
| - | + | |Constitutive promoter + RBS construct ||0.5ul | |
| - | + | |- | |
| - | 3 Nuclease in puc57 2.5ul | + | |PSB1C3 ||4.0ul |
| - | + | |- | |
| - | + | |rowspan="3" |2 ||PCR amplified Curli ||6 ul | |
| - | + | |- | |
| - | 4 | + | |Constitutive promoter + RBS construct ||0.5ul |
| - | + | |- | |
| - | 5 | + | |PSB1C3 ||4.0ul |
| - | + | |- | |
| - | 6 | + | |rowspan="3" |3 ||Nuclease in puc57 ||2.5ul |
| - | + | |- | |
| + | |Constitutive promoter + RBS construct ||0.5ul | ||
| + | |- | ||
| + | |PSB1C3 ||4.0ul | ||
| + | |- | ||
| + | |rowspan="2" |4 ||pSB1C3 ||4.0ul | ||
| + | |- | ||
| + | |PCR amplified Curli ||12 ul | ||
| + | |- | ||
| + | |rowspan="2" |5 ||pSB1C3 ||4.0ul | ||
| + | |- | ||
| + | |PCR amplified Laccase ||6.0ul | ||
| + | |- | ||
| + | |rowspan="2" |6 ||pSB1C3 ||4.0ul | ||
| + | |- | ||
| + | |Nuclease in puc57 ||2.5ul | ||
| + | |} | ||
== Wednesday (29.08.12) == | == Wednesday (29.08.12) == | ||
Revision as of 03:35, 27 September 2012
Contents |
27.8.12
Aim- Repeat inocculation of nuclease + curli ligation transformations. Inoculation was repeated due to no growth the first time round.
Step 2 - Inoculating Colonies into a Selective Broth:: Add Yul of antibiotic to reach desired antibiotic concentration.
(For Ampicillin this is 50ug/ml, For Kanamycin it is 25ug/ml, for Tetracycline it is 15ug/ml, and for Chloramphenicol it is 25ug/ml)
Step 4 – Selecting a Colony: Select a clear, isolated colony and using an inoculation hoop scoop up a colony onto the tip. Deposit in the falcon tube
Step 5 - Culture: Culture your falcon tubes overnight at a temperature of 37 oC. Leave for no longer than 16 hours.
30.08.12
Aim- To carry out mini-prep of curli+TT and Nuclease + CP DNA from the previous day’s inoculations.
Results- Once the mini-prep was carried out, the concentration of each sample was measured, and the following results obtained:
| Sample | Concentration | Notes |
|---|---|---|
| Nuclease +CP (1) | 245.8 ng/uL | |
| Nulcease+ CP (2) | 235.3 ng/uL | |
| Curli + TT (3) | 50.2 ng/uL | Curve showed irregular spikes, indicating unreliability of DNA. Hence, sample was discarded. |
| Curli + TT (4) | 212.8 ng/uL | |
| Curli + TT (5) | 438.2 ng/uL | Grown from the glycerol stock from the previous day |
Analytical Digest
In addition, an analytical digest was carried out in order to confirm DNA identity. The following recipes were used for the samples and controls:
| Ligations | Control | |||||||
| 1 | 2 | 4 | 5 | 1 | 2 | 4 | 5 | |
| dH2O | 3.5 | 3.5 | 3.5 | 3.5 | 4.5 | 4.5 | 4.5 | 4.5 |
| NEB | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
| DNA | 3 | 3 | 3 | 3 | 3 | 3 | 3 | 3 |
| BSA | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| XBal | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
| SpeI | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 |
| TOTAL | 10 | 10 | 10 | 10 | 10 | 10 | 10 | 10 |
Each digest was then run on a gel in order to check whether band sizes are as expected. Each 10ul digest was supplemented with 2ul of loading dye.
28.08.12
Digestions:
PSB1C3 with E + P
PCR amplified Laccase with E + P
PCR amplified Curli with E+ P
Nuclease in Puc57 with E + P
Constitutive promoter + RBS construct with E + S
PCR amplified Laccase X + P
PCR amplified Laccase X + P
Nuclease in puc57 with X + P
Digestion protocol:
250ng vector: xuL
Enzyme 1: 1uL
Enzyme 2: 1uL
NEB buffer 2: 2uL
BSA: 0.5 uL
dH2O: made up to 20uL
Incubated at 37C for 30mins and heat inactivated at 80C for 20mins.
The following ligations were then performed:
Ligations were preformed using NEB quick ligase.
50ng of vector, 4uL,
Combined in a (3:1) molar ratio with insert
10uL 2X Quick ligation buffer
1uL quick ligase
Incubate at room temperature at 5mins
Transform immediately or store at -20
| Ligation Number | Components | Amounts |
|---|---|---|
| 1 | PCR amplified Curli | 12 ul |
| Constitutive promoter + RBS construct | 0.5ul | |
| PSB1C3 | 4.0ul | |
| 2 | PCR amplified Curli | 6 ul |
| Constitutive promoter + RBS construct | 0.5ul | |
| PSB1C3 | 4.0ul | |
| 3 | Nuclease in puc57 | 2.5ul |
| Constitutive promoter + RBS construct | 0.5ul | |
| PSB1C3 | 4.0ul | |
| 4 | pSB1C3 | 4.0ul |
| PCR amplified Curli | 12 ul | |
| 5 | pSB1C3 | 4.0ul |
| PCR amplified Laccase | 6.0ul | |
| 6 | pSB1C3 | 4.0ul |
| Nuclease in puc57 | 2.5ul |
Wednesday (29.08.12)
Aim: To carry out transformation of the ligation product using chemically competent E. coli w3110.
Methods:
Transformation of chemically competent cells:
Add 1-5uL of DNA to frozen cells and leave to thaw for 45mins. For thorough mixing of the DNA.
Heat shock at 37C for 10 mins in the thermomixer.
Return to ice for 2mins.
Add 1.3ml of LB. And transfer to 25ml falcons and incubate for 1hr at 37C at 200rpm.
Transfer contents to 1.5ml eppendorfs and sediment cells at 6000g for 2mins.
Resuspend pellet with 100uL LB and spread on plates supplemented with appropriate antibiotic.
Plates prepared with LB agar supplemented with 1uL of antibiotic at 1000x concentration per 1ml of agar.
Plates were incubated at 37C overnight.
Controls: The transformation control: Dh20 in place of h20 and spread onto LB + CMP and LB no Drug.
Ligations controls: Cut Plasmid backbone with and without ligase, spread on CMP supplemented plates.
30.08.12
Aim: Inoculate previous days ligation.
Results:
Ligations were successful. Transformation controls – Negative control, no growth on CMP plate. Positive control - growth on LB plate. Ligation controls – With ligase, colonies. No ligase - no colonies. Hence, colonies were picked from each plate into 5ml selective LB + CMP and incubated overnight at 37°C at 200rpm.
Friday 31/08
Aim: To carry out mini-prep of the Curli, Laccase and Nuclease ligations to psb1c3 and to constitutive + rbs.
Results: Since the inoculation grew overnight, a mini-prep was carried out. After this, concentration of each sample was measures, giving the following results:
Ligation Concentration (ng/ul) Pc + RBS +LAC 276.4 Pc + RBS + LAC 235.9 pSB1C3 + CUR 425.3 pSB1C3 + LAC 305.7 pSB1C3 + NUC 290.0 Pc + RBS + CUR 279.3 pSB1C3 + LAC 335.5
Monday (27.08.12)
Aim: To find the right concentration of W3110 E. coli cells in LB that would be later used to streak out on the agar plates to obtain an optimal amount of colonies.
Methods: 1. The colony was inoculated the night before in 10ml of LB plus 10 ul CMP
2. The day after 5 dilutions were made from the sample
3. First solution - 1ml of the original solution & 4ml of the LB
Second – 1ml of the first solution & 4ml of the LB
Third – 1 ml of the second solution & 4ml of the LB
Fourth – 1 ml of the third solution & 4ml of the LB
Fifth – 1ml of the fourth solution & 4ml of the LB
Tuesday 28/08
Aim: (on Monday grew WNu o/n in prep for miniprep. This miniprep will be used as a template for pcr of a 2nd nuclease.
Not the synthesised staph aureus nuclease (Plan A). The Wnu Nuclease is considered our plan B.
Methods: (10ul cells, 10ul, amp, 10ml (LB). Wnu cells were obtained from a glycerol stock.
Optimal number of colonies was achieved using the fourth solution/dilution (24 colonies). Using the dilution number 4 we plated out 12 plates.
Wednesday 29/08
Aim: To test whether IPTG induces the lac promoter. Method: we applied HCL to the plates previously streaked. On addition of HCL, DNA precipitates out of solution producing a cloudy appearance. The absence of DNA, due to Nuclease activity, creates cleared zones around colonies.
Friday 31/08
Nuclease test: 21 plates, three plates tested (HCL applied every time) every time, every three hours.
27.8.12
Aim - Amplify irrE from Deinococcus radiodurans.
Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below
| PCR Components | Volume (ul) |
|---|---|
| 5x Reaction Buffer | 10 |
| 25mM MgCl2 | 4 |
| 10mM dNTPs | 1 |
| 10uM Forward primer | 5 |
| 10uM Reverse primer | 5 |
| DNA Polymerase | 0.25 |
| Nuclease Free Water | 24.25 |
| Template DNA | 0.5 |
| Total Volume | 0.5 |
Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.
| PCR conditions | Temp (oC) | Time (s) |
|---|---|---|
| Initial Denaturation (1 cycle) | 95 | 30 |
| Denaturation/Annealing/Extension (30 cycles) | 95/55/72 | 10/25/120 |
| Final Extension (1 cycle) | 72 | 600 |
| Hold | 4 | ∞ |
Method
Colony PCR was preformed on Deinococcus radiodurans. 5uL of colony matter was resuspended in 10uL dH2O and added to boiling water in a screw top vial,and left to return to ambient room temperature.
1uL was used as PCR template. The following reaction was set up in 50uL:
All primers were prepared to a concentration of 1pmol.uL, from 100pmol.uL stocks. Primers ordered from MWG operon
Step 1 - Setting up PCR tubes: The table below gives the identity of the primers used for each reaction.
| DNA Template | Function | Module | Primer Pair | Primer | Primer Sequence |
|---|---|---|---|---|---|
| Deinococcus radioduran colony | irrE | Salt Tolerance | STF1/ST2R | STF1 | atggggccaaaagctaaagctgaagcc |
| ST2R | tcactgtgcagcgtcctgcg | ||||
| STF3/ST4R | STF3 | gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc | |||
| ST4R | gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg | ||||
| No Template (Negative Control) | N/A | Salt Tolerance | STF1/STF2 | STF1 | atggggccaaaagctaaagctgaagcc |
| ST2R | tcactgtgcagcgtcctgcg |
Results:
PCR successful, band corresponding to approx 930bp length.
PCR cleanup of Irre followed with Anachem PCR cleanup kit.
Concentration determined by nanodrop: 9ng.uL-1
Conclusion: We will revise the protocol to see if we can detect any bands.
