From 2012.igem.org

(Difference between revisions)

Revision as of 03:32, 27 September 2012

UNAM-Genomics_Mexico

Complete Notebook

MAY

1. 10 kb ladder
2. Lysis PRMn25
3. Lysis PRMn25
4. Lysis PRMn25
5. Purified PFRC54(A3)
6. Total DNA (PFRC54)

05/29/2012

METAL

Our group is in charge of building part of the ìandî construction. We started analyzing if the plasmid we have with P4 actually had what we needed.

The plasmid PRMn25 contains the protein P4. It has Amp100 resistance and comes in Escherichia coli NFI. Cells were lysed to make sure the plasmid was present in these cells (5000bp). We ran a gel with 3 lysis, a sample from the plasmid PFRC54 (A3 promoter) and a sample of total DNA from the strain from which PFRC54 was obtained.

1. 10 kb ladder
2. SpeI PRMn25 digestion
3. EcoRI PRMn25 digestion
4. PRMn25 lysis
5. SpeI PRMn25 digestion
6. EcoRI PRMn25 digestion
7. PRMn25 lysis
8. SpeI PRMn25 digestion
9. EcoRI PRMn25 digestion
10. PRMn25 lysis

05/31/2012

METAL

Plasmid PRMn25 was digested with SpeI and EcoRI. We do not have the sequence of the plasmid, but there seem to be several restriction sites for SpeI and just one site for EcoRI. The digestions were left for 4 hours and they were plused in the microwave 3 times, 10 seconds each time. Only Dulceís digestion worked, even though it was the ìdirtiestî sample.

JUNE

1.10 kb ladder
2. PRMn25 (P4) lysis 1
3. PRMn25 (P4) lysis 2
4. ---------------
5. 10 kb ladder
6. EcoRI PRMn25 digestion
7. BamHI PRMn25 digestion

06/06/2012

METAL

We repeated the lysis of PRMn25.
Digestions (20 µl)
H2O 12 µl
Enzime 1 µl
Buffer 10x 2 µl
Plasmid 5 µl
37∫C

PRMn25 was digested with EcoRi and BamHI. Since we donít have the sequence we used these enzyme to confirm the restriction sites mentioned in Rojo et al. (1990). These sites were corroborated and the vector was linearized. We recycled the gel used for the PRMn25 lysis, which is why the gel seems out of phase.

1. 10kb ladder
2. PRMn25 (P4) lysis 1
3-12. Cell lysis of cells transformed with lysis 1

06/07/12

METAL

PY BROTH 10g salt/L
PSB2K3 kanamicin
We transformed RFP E1010.
plate 1 18F
plate 2 17E
Stock 50 mg/mL
E.coli 1/1000
TRANSFORMATION PROTOCOL.
We made liquid cultures with colonies LIQUID CULTURE.
We extracted plasmids PLASMID EXTRACTION PROTOCOL.
We ran a gel to check the extraction GEL ELECTROPHORESIS PROTOCOL.

06/08/12

SUGAR

The lysis worked so we transformed PRMn25 in DH5a. We performed a lysis on these cells to see if they had been transformed correctly with PRMn25.

We also transformed PFRC54. TRANSFORMATION PROTOCOL

06/11/12

METAL

We designed primers for our project. (Note from 07/10/12: we redesigned the primer for LasR, since the sequence was incorrect.)
OLIGOS 14/06/12
LASR
UPPER 5'-3'
PREFIX+RBS+SPACER+LASR
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCATTAGTAGAT
LOWER 5'-3'
SUFIX+LASR
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA TCATAATGTAATTAA

P4 5'-3'
PREFIX+RBS+SPACER+P4
upper
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGCCTAAAACACAA
SUFIX+P4
lower 5'-3'
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CTACACCATACTTTT

A3 (PROMOTER)
UPPER 5'-3'
PREFIX+A3
5' GTTTCTTCGAATTCGCGGCCGCTTCTAGAG taactttttgcaaga 3'
LOWER 5'-3'
SUFIX+A3
5'GTTTCTTCCTGCAGCGGCCGCTACTAGTA ctacttaattatacc 3'

RFP
UPPER 5'-3'
PREFIX+RBS+SPACER+RFP
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCTTCCTCCGAA
LOWER 5'-3'
SUFIX+RFP
GTTTCTTCCTGCAGCGGCCGCTACTAGTA TTATTAAGCACCGGT

GUSA
UPPER 5'-3'
PREFIX+RBS+SPACER+GUSA
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG atgttacgtcctgta
LOWER 5'-3'
SUFIX+GUSA
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA tcattgtttgcctcc

ARAC without LVA (version 2 registry part: BBa_C0080)
UPPER 5'-3'
PREFIX+RBS+SPACER+ARAC
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCTGAAGCGCAA
LOWER 5'-3'
SUFIX+ARAC
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CAACTTGACGGCTAC

1. 1 kb ladder.
2.BBa_B0014 (1) ñ terminator
3.BBa_B0014 (4) ñ terminator
4.BBa_E1010 (RFP) Lysis
5.purified BBa_E1010 PSB12K3 (AraC AND team)
6.700 bp ladder

06/12/12

SUGAR

We made glycerols of the bacteria
GLYCEROL PROTOCOL .
We transformed plasmid pHp45 TRANSFORMATION PROTOCOL.

1. 1 kb ladder
2.E1010

06/13/12

SUGAR

We ran gel and extracted from gel LIQUID CULTURE.
We made liquid cultures LIQUID CULTURE and lysed [LYSIS PROTOCOL].

1. 1 kb ladder
We extracted from gel

06/14/12

SUGAR

We extracted from gel LIQUID CULTURE.
We made glycerols of pHp45 O GLYCEROL PROTOCOL .
We transformed PSB2K3 Km (Kanamycin) 5C BBa_J04450 PSB4A5 Am (ampicillin) 1I BBa_J04450 AraC BBa_C0080
2012 14L plate 1 pSB2K3 Km+
2011 14L plate 1 pSB2K3 Km+
2012 14L plate 1 pSB2K3 Km+
TRANSFORMATION PROTOCOL.

1. 1 kb ladder
pHp45 O with E/P
We extracted from gel

06/14/2012

METAL

We obtained the terminator from the 2012 distribution (plate 2 24C) and we transformed the DNA in DH5a TRANSFORMATION PROTOCOL. The terminator (BBa_B0014) comes in the PSBIAK3 plasmid with resistance to Amp and Km. The RFP (BBa_E1010) comes in the plasmid PSBI2K3 with resistance to Amp and we obtained it from the 2012 distribution plate 2 (17E). We obtained the purified plasmid of the RFP from the AraC AND team. (Diego, Jonathan, and Abiel).

1. 1 kb ladder
2. Terminator lysis (BBa_B0014)
3. RFP lysis (BBa_E1010)

06/15/12

METAL

Due to the failed digestions, we did the RFP and terminator lysis again.
The AraC team has the terminator plasmid purified, we are thinking of using that one.

1. 700 bp ladder
2. BBa_B0014 lysis (terminator)
3. BBa_E1010 lysis (RFP)
4. BBa_E1010 lysis (RFP AraC team)
5. 1 kb ladder

06/15/12

SUGAR

> Digested pHp45 O with E/P LIQUID CULTURE.
> We extracted plasmid with kit.
> Ran a gel GEL ELECTROPHORESIS PROTOCOL . (5)
>Extracted from gel LIQUID CULTURE.

ARAC
>From the overnight plate we prepared liquid culture LIQUID CULTURE.
>We left them incubating overnight.
>We left a plate (LB Km DH5a C0080 and a control).

06/18/12

SUGAR

>Plasmid extraction AraC with kit.
>C0080-psB2K3 915 bp
>Streaked 4 LB Km 30 plates DH5a psB2K3.
>It seemed as though there were two different colonies (white) and there had been a mutation. Normally they are red.
>Ran gel with Spr/Strr (eppendorf -20∫C) GEL ELECTROPHORESIS PROTOCOL.
>Made glycerols from one tube of DH5a C0080 Km 50 -> 04.
>Made glycerols from one tube of DH5a PSB4A5 Amp 100 -> 05 GLYCEROL PROTOCOL.
>Digested C0080 X,S.
>Digested B0014 E,P LIQUID CULTURE.

1. 1 kb ladder
Digested B0014 with E, P and with E,X

06/18/12

METAL

We used the RFP that we transformed and the RFP that the AraC team did as a positive control. The terminator still looks strange, since we canít observe supercoling which is normally observed.

We are waiting for our primers, and the team will be going to a math modeling course for a week.

1. 1 kb ladder
2. PCR RFP
3. negative control PCR RFP
4. P4 PCR
5. negative control PCR P4

06/19/12

SUGAR

>Digested B0014 with E, P and with E,X. LIQUID CULTURE.
>Ran gels with yesterdayís digestions GEL ELECTROPHORESIS PROTOCOL .
2 B0014 E,X and 3 B0014 E,P were discarded because of problems in the preparation.
C0080 is in the first lane.
>Extracted from gel C0080 X,S LIQUID CULTURE.
>Made glycerols from 4 plates LB Km DH5a pSB2K3 GLYCEROL PROTOCOL .
>Take out AmyE 5í from distribution [DNA KIT PLATE INSTRUCTIONS].
AmyE 5í 18K plate 3 2010, 2011, 2012
AmyE 3í 18M plate 3 2010, 2011, 2012
>Digested B0014 with E,X and E,P again LIQUID CULTURE.

06/22/12

SUGAR

>Ran gels with digestions B0014 with E,X and E,P GEL ELECTROPHORESIS PROTOCOL.

>Dephosphated B0014 E,X and B0014 E,P [DESPHOPHORYLATION PROTOCOL].

06/25/12

SUGAR

>Took LasR BBa_B0079 plate 1 2010,2011,2012 psB1A2 Amp+ from distribution [DNA KIT PLATE INSTRUCTIONS].

06/26/12

SUGAR

>Ran gel with psB2K3 and psB4A5 GEL ELECTROPHORESIS PROTOCOL .

06/27/12

SUGAR

>Transformed with plasmid B0079 1576 bp psB1A2 12A TRANSFORMATION PROTOCOL.
LasR B0079 plasmid Amp+ 12A plate 1 2010,2011
AmyE 5í BBa_K143001 Km+ 18K plate 3 2010 and 16M, 18K 2011
AmyE 3í BBa_K143002 Km+ 18M plate 3 2010 and 16O, 18M 2011
AmyE 5í grew 2 colonies.

06/29/12

SUGAR

>We did a DH5a K143001 Km30 Amp 100 glycerol GLYCEROL PROTOCOL 07.
>We plated twice DH5a K143002 Km 30 Amp 100 + control and twice DH5a B0079 Amp 100 + control
These were both plated in 2 plates each.
They were left overnight since they had not grown by 7:00 pm so the next day glycerols were made.
>Liquid cultures LIQUID CULTURE.

2 tubes DH5a K143001 Km30 Amp 100
2 tubes DH5a K143002 Km30 Amp 100
2 tubes DH5a B0079 Amp 100
1 tube LB Km 30 Amp 100 control
1 tube LB Amp 100 control
>From the 6 tubes we extracted plasmid from kit.

JULY

07/02/12
SUGAR >Digestions LIQUID CULTURE.
B0079 digestion with S,P
K143001 with S,P
K143002 with S,P
>PCRís
ïAraC
ïCassete OSpr/Strr
PCR PROTOCOL

After Cassete OSpr/Strr PCR we ran a gel

B0079 digestion with S,P
K143001 with S,P
K143002 with S,P

07/02/12

METAL

We did 2 PCRs, since the primers have arrived. We purified by miniprep RFP and P4. With this PCR we will add the prefix (EcoRI and XbaI) and RBS to the beginning of the sequence, and suffix (restiction sites for SpeI asn PstI).
RFP, P4 PCR PROTOCOL
TMís
RFP UP 78∫C
RFP LW 75.5 ∫C
P4 UP 73.6 ∫C
P4 LW 73.9∫C
Taking into account both TMís, we used the same amplification program for both, thermocycle B progam iGEM.
We ran a gel and we observed fragments that correspond to the RFP and P4, we can also observe other fragments which means we will have to purify the bands.

1. 1 kb ladder
2. PCR product P4
3. PCR product RFP

1. 1kb ladder
2. P4 purification
3. RFP purification

07/03/12

METAL

We used Roche kit for band purification.

The P4 purification turned out slightly dirty and the RFP turned out completely dirty. We repeated the purifications by loading the previously ìpurifiedî sample and repeating the procedure.

1. Degraded P4.
2. Purified RFP.
3. 1kb Ladder.

1. 1 kb ladder
2. P4 PCR (1)
3. P4 PCR (2)
4. Negative control P4 PCR

1. P4 purified from band
2. 1 kb ladder
3. (Do not pay attention to this well).

07/04/12

SUGAR

>We dephosphated B0079 S,P, K143001 S,P, K143002 E,X (9.1) [DESPHOPHORYLATION PROTOCOL].
>Ligated Cassete OSpr/Strr +K143002 dephosphated(digested with E,X and E,S) LIGATION PROTOCOL].
>Transformed ligation and left overnight plated TRANSFORMATION PROTOCOL.
>Extracted plasmid PBBR1 GusA in 2 1.5 mL eppendorfs [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL].
>Digested with PstI LIQUID CULTURE.

07/04/2012

METAL

We repeated the gel where we checked the re-purification, and indeed we need to repeat P4ís PCR.

The PCR worked, but a band purification will be needed. We fused all of the PCR product and loaded it.

We grew bacterial culture in antibiotics for LasR lysis.

Rfp+terminator ligation LIGATION PROTOCOL

1. 1 kb ladder
2-9. LasR lysis

1. 1 kb ladder
2. Terminator digested with EcoRI and XbaI/ dephophatated
3. RFP digested with EcoRI and SpeI.

1-4. XbaI SpeI LasR digestion (3 hours)
5. 1 kb ladder
6-9. LasR PCR
10. Negative control LasR PCR

07/05/12

METAL

Cells were transformed with DH5a with RFP+terminator ligation.TRANSFORMATION PROTOCOL
LasR lysis were digested. We ran a gel with LasR PCRs to add RBS prefix and suffix.

1-8. LasR PCR
9. Negative control LasR PCR
10. 1 kb ladder
11-15. X/S LasR digestion

1. 1 kb Ladder
2. LasR 2012
3. LasR 2012
4. LasR 2010
5. LasR 2010
6. Negative Control (-)

07/06/12

METAL

We ran LasRís PCRs again, the last PCR didnít work, which is why we lowered the temperature to 65∫C. We left the digestions all night. PCR PROTOCOL
Since they didnít work, we decided to do it directly from the distribution from 2012 and 2010.

We noticed our mistakeÖ. The sequence we designed our primers for was an incorrect sequence!

We need to redo LasR primers.
Our ligation didnít work.
We redid RFP+terminator ligation and left it for the weekend. LIGATION PROTOCOL

07/06/12

SUGAR

4 LB Km30 Spec60 DH5a OSpr/Strr +K143002 still have not grown.
Ran a gel with yesterdayís digestions to chek if they were done properly (10)
GEL ELECTROPHORESIS PROTOCOL .
Ran another gel with the rest of the samples.
Extracted GusA fragment
LIQUID CULTURE.
Repeated ligation OSpr/Strr +K143002 E,X dephosphated LIGATION PROTOCOL.
Repeated OSpr/Strr PCR.

07/07/12

SUGAR

Transformed DH5a OSpr/Strr +K143002 ligation LIGATION PROTOCOL.
Plated LB Km30 Spec 60 DH5a OSpr/Strr +K143002 .

07/08/12

SUGAR

Transformed DH5a OSpr/Strr +K143002 ligation LIGATION PROTOCOL.
Plated LB Km30 Spec 60 DH5a OSpr/Strr +K143002.

We dephosphated B0079 S,P, K143001 S,P, K143002 E,X

1 PCR omega P
2 PCR omega I
3 PCR AraC P
4 PCR AraC I
5 ladder 1 Kb

07/09/12

SUGAR

From yesterdayís transformations only one colony grew.
From the previous transformation only 2 colonies grew.
These 3 were streaked in 3 plates:
DH5a OSpr/Strr +K143002 LB Km 30 Sp 100 1.
DH5a OSpr/Strr +K143002 LB Km 30 Sp 100 2.
DH5a OSpr/Strr +K143002 LB Km 30 Sp 100 3.
LB Km 30 Sp 100 control.
Did liquid cultures in 3 tubes:
OSpr/Strr +K143002 LB Km 30 Sp 100 1.
OSpr/Strr +K143002 LB Km 30 Sp 100 2.
OSpr/Strr +K143002 LB Km 30 Sp 100 3.
LB Km30 Sp 100 control.
LIQUID CULTURE.

Ran a gel with: (11)
GusA P
PBBR1 GusA
O E PCR P
O PCR P
O PCR I
O E
O PCR I
GEL ELECTROPHORESIS PROTOCOL
Did GusA primers dissolution for PCR.
GusA PCR
[PCR PROTOCOL]
Gel Extraction by kit of lanes 3 and 5 LIQUID CULTURE.

PCR omega P, PCR omega I, PCR AraC P, PCR AraC I
Add 10 µl of each primer (LW and UP).
Add 3 µl of plasmid (P).
Add 30.4 µl buffer.
Add 5 µl Mg.
Add 8 µl DNTpís.
Add 42.6µl H2O miliQ.
Add 1 µl RTTG polymerase.
Centrifuge (spin) 8 secs.
Add vegetable oil till the eppendorf is full.
Place eppendorf 1 mL in thermocycler.
Run PCR with program ìBERNAî.

GusA digestions with X,P; O+AmyE 3í with E,X; AraC PCR with E,S

07/09/12

METAL

We transformed the RFP+terminator ligation in DH5a and plated it in LB Km30. TRANSFORMATION PROTOCOL
We digested RFP with EcoRI and SpeI. DIGESTION PROTOCOL

1. 1 kb Ladder
2. RFP digested with EcoRI and SpeI
3. Dephosphated terminator digested with EcoRI and XbaI
4. RFP PCR (Prefix+RBS+RFP+Suffix)
5. PCR RFP (-)

07/10/12

METAL

By 9am we didnít observe colonies in our LB Km30 with yesterdayís transformation, so using yesterdayís RFP digestions we redid the ligation.
We did another PCR of RFP because we ran out of it.
We ran a gel with the dephosphated terminator and digested RFP.
The PCR turned out ok except for some non-specific bands, we will need to extract the correct DNA band.

1. 1 kb ladder
2. RFP PCR to extract the band

1. 1kb Ladder
2. RFP 1 PCR
3. RFP 2 PCR
4. RFP 3 PCR
5. RFP 4 PCR
6. RFP 5 PCR
7. RFP (-) PCR

1.1 kb ladder.
2. RFP PCR.
3. RFP PCR.

1. 1 kb ladder.
2. RFP PCR extracted.
3. RFP PCR extracted.

07/10/12

SUGAR

ïGusA digestions with X,P; O+AmyE 3í with E,X; AraC PCR with E,S (2 times) DIGESTIONS. (11.2)

07/11/12

SUGAR

ïGusA PCR digestions with E,S; O+AmyE 3í with E,X LIQUID CULTURE.
ïT.V. AraC PCR+ O+AmyE 3í E,X dephosphated ligation LIGATION PROTOCOL.

1. ladder.
2. GusA PCR E,S.
3. O+AmyE 3í with E,X.

07/11/12

METAL

We loaded the whole PCR product from the PCR.
>We took a picture of the gel to check the purification elutions but we did not observe anything so we quantified it on the nanodrop.
Sample 1) 5.9 ng/µl
Sample 2) 2.5 ng/µl

>With the RFP digested with EcoRI and SpeI we did another ligation with the terminator digested with EcoRI and XbaI and left it at 22∫C.

>We transformed yesterdayís ligation in DH5a and plated it in LB Km30. Since our ligations have not worked we decided to redo the digestions on the terminator (E0014). We asked the other AND team to give us the purified plasmid, but it wasnít enough so we streaked 2 plates LB Km30 so we could have the strain with the terminator. Tomorrow we will put liquid cultures and do lysis.

>We did digestions in another vector to see the efficiency of the enzymes as a test. We used PBBR-GusA with 5 µl of PBBR GusA, one digestion with 1.5 µl of EcoRI, one with 1 µl of SpeI and one with 1 µl of SpeI and 1.5 µl of EcoRI.

We left them at 37∫C.
>We did 5 new RFP PCRs.
>We streaked again the following strains:
-DH5a +PRFc54
-DH5a +Terminator

The PCRs seem to show the band we need, we will have to extract them.

1. 1 kb ladder.
2. GusA-PBBR
3. PBBR-GusA digested with SpeI.
4. PBBR-GusA digested with EcoRI.
5. PBBR-GusA digested with SpeI/EcoRI.
6. RFP+terminator ligation.

07/12/12

METAL

We checked the transformations from the ligation ì3î from RFP+terminator. We didnít observe colonies.
>We transformed the ligation ì4î RFP+terminator in DH5a, they were plated in LB Km30 .
>We ran a gel with GusA digestions.

>We digested 80 µl of the purified RFP with EcoRI and SpeI DIGESTION PROTOCOL.
>We left liquid cultures in LB Km30 so we can do an alkaline lysis of the plasmid containing the terminator (B0014).

1. 1 kb ladder.
2. Terminator alkaline lysis.
3. Terminator alkaline lysis.
4. Terminator alkaline lysis.
5. Terminator alkaline lysis.
6. 1 kb ladder.
7. Terminator digested with E/X.
8. RFP. digested with E/S.

07/12/12

SUGAR

ïRan a gel with yesterdayís digestions: (12)

GEL ELECTROPHORESIS PROTOCOL .

ïTransformed AraC PCR+ O+AmyE 3í ligation in two tubes TRANSFORMATION PROTOCOL.

ïFrom pfrc54 liquid cultures (A3) that were grown overnight we extracted plasmid [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL].
ïMade glycerols from 2 LB Km 30 Sp100 DH5a O+AmyE 3í plates and from 1 LB Amp100 pfrc54 (A3) plates with control GLYCEROL PROTOCOL .
ïLigated GusA PCR with B0014 E,X desphophorylated LIGATION PROTOCOL.

ïDigested Pfrc54 (A3) with S,P LIQUID CULTURE.

ïDesphophorylated O+AmyE 3í E,X [DESPHOPHORYLATION PROTOCOL].

ïRan gel with pfrc54 S,P

07/13/12

SUGAR

ïRan gel with pfrc54 S,P GEL ELECTROPHORESIS PROTOCOL . (13)
ïTransformation of GusA PCR + B0014 ligation TRANSFORMATION PROTOCOL.
ïTransformed with GFP E0040 psBIA2.
ïLiquid Cultures with ligation: AraC+ O+AmyE 3í for plasmid extraction at night TRANSFORMATION PROTOCOL.
ïB. Subtitils competent cells [B.Subtilis group protocol].

07/13/12

METAL

>We did alkaline lysis of the terminator cultures from last night. We ran it and they all look ok, but weíll use the first one because it seems to be the cleanest.
We ligated RFP/terminator and ran a gel to see RFP and the terminator. LIGATION PROTOCOL.

>We checked the transformations and didnít see colonies.

1. 1 kb Ladder.
2. B0014/terminator E/X digestion.
3. E0010/RFP E/S digestion.
4. RFP from the other team.

1. 1 kb ladder.
2. RFP pcr.
3. RFP pcr.
4. RFP pcr.

1. 1 kb ladder.
2. Purified RFP.
3. Purified RFP.
4. Purified RFP.

07/14/12

SUGAR

ïFrom 24 AraC+ O+AmyE 3í LB Km 30 Sp 100 DH5a tubes:
ïExtracted pellets
ïExtracted plasmids [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL].
ïRan gel GEL ELECTROPHORESIS PROTOCOL .

ïFrom transformed DH5a km 30:
GusA+B0014 DH5a Km50 24 pellets
E0040 DH5a LB Amp100
From these two we:
ïDid liquid cultures LIQUID CULTURE.
ïExtracted plasmid [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL].
ïFrom the GusA+E0014 transformation we took 24 colonies, did liquid cultures and extracted plasmid LIQUID CULTURE.
ïRan gel with this transformation GEL ELECTROPHORESIS PROTOCOL .

07/16/12

SUGAR

ïDigested E,P AraC+ O+AmyE 3í
ïO+AmyE 3í E,P LIQUID CULTURE.

Digested E,P AraC+ O+AmyE 3í
O+AmyE 3í E,P

07/16/12

METAL

We ran a gel with the RFP digestion, the purified terminator, and the RFP terminator ligation that was left for the whole weekend. (GEL NOT SHOWN)

>We digested the terminator with EcoRI and XbaI DIGESTION PROTOCOL.

> We digested RFP 1 with EcoRI and SpeI DIGESTION PROTOCOL.

In the gel we can see that the terminator digestion in ok, although it is still partial. We need to leave it for the whole night. We canít see the RFP digestion; it is possible that it degraded. We will concentrate RFP.

1. 1 kb ladder
2. RFP lysis.
3. RFP lysis 2010
4. Terminator Digestion.
5. RFP Digestion.

1. 1 kb ladder.
2. RFP PCR lysis.
3. RFP PCR lysis.
4. RFP PCR lysis.
5. RFP PCR lysis.
6. RFP PCR lysis.
7. RFP PCR lysis.
8. Negative control.

1. 1 kb ladder.
2. PCR RFP lysis.
3. PCR RFP lysis.
4. PCR RFP lysis.
The pcr looks fine, now we will run 3 samples in fused wells so we can cut them and extract the DNA.

1. 1kb ladder.
2. Purified RFP.
3. Purified RFP.
4. Purified RFP.

07/17/12

METAL

We ran 6 50 µl reactions of the PCR to amplify RFP. We will use as DNA RFP from the lysis, one from 2012, and one from 2010. We will make a dilution, use 1 µl of lysis and diluted them in H2O.
PCR protocol.

>We can still observe bands in the purification, we will try to do a better PCR.
>We digested the terminator lysis with EcoRI and XbaI and we decided to switch buffers. We used buffer 2 even though EcoRI might have a star effect. DIGESTION PROTOCOL

2. 1 kb ladder.
3. Terminator digested E/X.

1. 1 kb ladder
2. RFP PCR with hot start
3. Negative Control
4. Terminator Lysis
5. Terminator digestion E/X.

1. 1 kb ladder.
2. RFP lysis PCR.
3. RFP lysis (other team).
4. Negative control.

07/17/12

SUGAR

ïRan gel with yesterdayís digestions LIQUID CULTURE. (14)
ïThe gel we ran didnít work, probably because the agarose was not prepared correctly.
ïDigested 12, 15, 18, 21 with AraC+ O+AmyE 3 with E and also with Pí; B0014 with E,X; E0040 with X,S LIQUID CULTURE.

ïDigested 12, 15, 18, 21 with AraC+ O+AmyE 3 with E and also with Pí; B0014 with E,X; E0040 with X,S

07/18/12

SUGAR

ïFrom yesterdayís digestions we ran a gel GEL ELECTROPHORESIS PROTOCOL . (15)

ïWe made liquid cultures of AraC+ O+AmyE 3í 12, 15, 21 LIQUID CULTURE.

ïWe ligated AraC PCR E,S dephosphated with + O+AmyE 3í LIGATION PROTOCOL.

ïWe digested 1 + O+AmyE 3í E,P LIQUID CULTURE.

07/18/12

METAL

We did a PCR using hot star and without MgCl2. HOT START PCR PROTOCOL

We left an RFP digestion and took the DNA from the RFP PCR which looked good. PCR PROTOCOL

From these PCR products we left the PCR digestion with EcoRI and SpeI and used enzymes from the same company. DIGESTION PROTOCOL

1. 1 kb ladder.
2. E/S RFP digestion.
3. E/S RFP digestion (RFP PCR lysis).
4. E/S RFP digestion (Cut RFP PCR from the other team).

1. 1 kb ladder.
2. E/X terminator 1 digestion.
3. E/X terminator 2 digestion.

1. 1 kb ladder.
2. Terminator Lysis 1.
3. RFP Lysis 2.

1. 1 kb ladder.
2. RFP E/S digestion.
3. Terminator 2 E/X digestion.

07/19/12

METAL

From the three RFP digestions we left yesterday we ran a gel to prove that our DNA wasnít being degraded, as it had been happening.

> Our DNA wasnít degraded, we will use these digestions to do the ligation.
>We did lysis of the terminator cultures by miniprep. LYSIS PROTOCOL

We ligated RFP+terminator. LIGATION PROTOCOL
We transformed the ligation. TRANFORMATION PROTOCOL

07/19/12

SUGAR

ïWe ran We digested 1 + O+AmyE 3í E,P with Miguelís enzymes and with Abielís enzymes LIQUID CULTURE.

ïWe transformed with ligations AraC+ O+AmyE 3í E and + O+AmyE 3í E TRANSFORMATION PROTOCOL.

ïExtracted plasmids from AraC+ O+AmyE 3í 12,15,21 [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL].

ïDigested E0040 X,S 2,3,4,5,6; ligations AraC+ O+AmyE 3í E 12,15,21; ligations AraC+ O+AmyE 3í P LIQUID CULTURE.

Digested E0040 X,S 2,3,4,5,6; ligations AraC+ O+AmyE 3í E 12,15,21; ligations AraC+ O+AmyE 3í P

07/20/12

SUGAR

ïRan gel with yesterdayís digestions GEL ELECTROPHORESIS PROTOCOL . (16)
ïTransformed GusA+B0014 in two tubes TRANSFORMATION PROTOCOL.
ïMade liquid cultures from AraC+ O+AmyE 3ís transformation LB Km30 Sp 100 and control LB Km 30 Sp100 LIQUID CULTURE.

07/20/12

METAL

We observed two colonies, we put them in liquid LB.

1.1 kb ladder.
2.RFP-terminator lysis.
3.RFP-termintor lysis.

1.1 kb ladder.
2.E ligation 1 digestion.
3.P ligation 1 digestion.
4.E/P ligation 1 digestion.
5.E ligation 2 digestion.
6.P ligation 2 digestion.
7.E/P ligation 2 digestion.

07/23/12

METAL

We made a lysis of the ligation using miniprep.

>We did the following digestions
DIGESTION PROTOCOL
ïEcoRI/PstI ligation
ïEcoRI ligation
ïPstI ligation

The results indicate that the vector only ligated with itself.

We put B0014 and E1010 digestions. DIGESTION PROTOCOL
Boo14 EcoRI
Boo14-XbaI
B0014 EcoRI/XbaI
E1010 EcoRI
E1010 SpeI
E1010 EcoRI/SpeI

1.1 kb Ladder.
2.B0014 EcoRI.
3.B0014 XbaI.
4.B0014 EcoRI-XbaI.
5.B0014 EcoRI-XbaI dephosphated.
6.E1010 EcoRI.
7.E1010 SpeI.
8.E1010 EcoRI-SpeI.
9.E1010 EcoRI-SpeI.

1.1 kb ladder.
2.B0014 lysis.
3.B0014 lysis.
The buffer had been used previously and this is probably why the gel didnít come out well.

07/23/12

SUGAR

ïFrom 24 GusA+B0014 tubes (-) we didnít do anything.
ïFrom 4 AraC+ O+AmyE 3í we extracted plasmid [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL].
ïDigested from the 4 AraC+ O+AmyE 3í E,X; X; P and GusA PCR with X,P LIQUID CULTURE.

07/24/12

SUGAR

ïDigested B0014 E with X B0014 X with E
ïDigested AraC+ O+AmyE 3í 1,2,3,4 with E,P LIQUID CULTURE.

07/24/12

METAL

We dephosphated the B0014-E/X digestion. DEPHOSPHORYLATION PROTOCOL
>We inactivated every digestion 10 minutes at 70∫C. We ran an agarose gel at 100 volts.

We put 4 ligations: LIGATION PROTOCOL
B0014 dephosphated + E1010
B0014 + E1010
B0014
B0014 dephosphated

1. 1 kb ladder.
2. B0014 lisis.
3. B0014 lisis.

07/25/12

METAL

At 9:30 we still didnít observe colonies of the ligation transformation.
At 1:35 20 colonies were cultivated so we could digest them (XbaI/PstI) DIGESTION PROTOCOL.

1.Terminator lysis.
2-4.ìB0014+E1010î 1 Lysis.
5.Ladder
6.E/X terminator.
7, 10, 13. Lysis B0014+E1010 E digestion.
8,11, 14. Lysis B0014+E1010 P digestion.
9, 12,15.Lysis B0014+E1010 E/P digestion.

1.1 kb ladder.
2.E1010.
3.B0014 Lysis.
4.B0014 Lysis.
5.B0014 E/X digestion.
6.B0014 E/X digestion.

1. RFP for extraction.
2. RFP for extraction.
3. 1 kb ladder.

1. Extracted band.
2. Extracted band.
3. 1 kb ladder.

07/25/12

SUGAR

ïRan gel of digested AraC+ O+AmyE 3í 1,2,3,4 with E,P LIQUID CULTURE.
ïJoined B0014 E with X B0014 X with E digestions.
ïMade liquid cultures from 2 days old plated GusA+B0014 and extracted plasmid LIQUID CULTURE [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL]. Transformed TRANSFORMATION PROTOCOL.
ïFrom LasR DH5a make liquid cultures and plate LIQUID CULTURE.
ïDigested O+AmyE 3í with X,P; E,S; C0080 X,P; E,S; S,P LIQUID CULTURE.
ïLigated Gus PCR X,P with B0079 S,P dephosphorylated LIGATION PROTOCOL.

1.O+AmyE 3í X,P
2. O+AmyE 3í E,S
3.C0080 X,P
4.C0080 E,S
5.C0080 S,P
6.ladder

07/26/12

SUGAR

ïFrom C0179 (LasR) transformation which grew colonies, we made two liquid cultures: DH5a C0179 LB Cb 100 (two cultures) and a control without bacteria LIQUID CULTURE.

ïWe extracted plasmid from 8 C0179 tubes, from 2 tubes of C0179 (Miguelís transformation), Puc, B.S. control and PSB4AE [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL].

ïDue to problems with the way we did the transformations of ligations we repeated them:
GusAPCR X,P+ B0079 S,P dephosphorylated

GusAPCR X,P+ B0079 S,P dephosphorylated (-)

GusAPCR X,P+ A3 S,P dephosphorylated

GusAPCR X,P+ A3 S,P dephosphorylated (-)
TRANSFORMATION PROTOCOL.

ïDid the following digestions LIQUID CULTURE.
ïAraC+ O+AmyE 3í S,P 1,2,3,4
ïK143002 X,P
ïAraC+ O S,P
ïC0179 X,S

07/26/12

METAL

In the previous gel we observed that cultures grown were actually re-ligated vectors.
We need to put ligations again.

>E1010 doesnít look as it should, weíll extract from band. GEL EXTRACTION PROTOCOL

We ligated B0014+E1010 LIGATION PROTOCOL.

1. 1 kb Ladder.
2. RFP E1010 purified.
3. RFP E1010 purified.
>We now have LasR.

07/27/12

METAL

07/27/12

SUGAR

Ligated AraC+ O S,P dephosphorylated + K143002 X,P LIGATION PROTOCOL.

07/30/12

SUGAR

ïTransformed with ligations:
ïAraC+ O dephosphprylated +K143002 X,P
ïGusAPCR X,P+ A3 S,P dephosphorylated
ïGusAPCR X,P+ B0079 S,P dephosphorylated
ïTransformed the following sythesis:
ï91996 Pveg 140 bp
ï91997 ArsR-CzrA_promoter 1 194 bp
ï91998 ArsR-CzrA_promoter 2 221 bp
ï91999 ArsR-CzrA_promoter 3 213 bp
ï92000 pBad-pXyl 387 bp
ï92001 XylR 1117pb
ï92002 CI_pro_(NAND_INHIBITOR) 774
ïThese synthesis come in pJ209 and supposedly come with Chloramphenicol+ and Gentamicin+ resistance, but we discovered that only Chloramphenicol worked. TRANSFORMATION PROTOCOL.

ïMake liquid cultures of the following transformations for tomorrow LIQUID CULTURE:
ïAraC+ O+K143002
ïGusA+A3
ïGusA+B0079
ïSynthesis

07/30/12

METAL

>We transformed the ligations.

E1010+B0014 dephosphated.
E1010+B0014.
B0014 dephosphated.
B0014.
Negative Control.

07/31/12

METAL

The colonies from the transformation grew well, though we believe the dephosphatase isnít working properly.
We took 103 colonies and put 18 cultures to do the alkaline lysis.

07/31/12

SUGAR

Extracted plasmids from yesterdayís cultures and from K143002 cultures that were in the other lab [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL].

AUGUST

08/01/12

SUGAR

Digested XylR 01 X,P; pBAD-pXyl X,P; Pveg 96 S,P LIQUID CULTURE.

1 PCR GusA I
2 PCR GusA I
3 PCR GusA P
4 PCR GusA P
5 ladder 1 Kb

1. 1 kb ladder.
2-18 E1010+B0014 lysis colony 1-17
19. Terminator lysis

08/01/12

METAL

We digested with XbaI and PstI colonies 3,5,8,9,14.
DIGESTION PROTOCOL

1.1 kb ladder.
2, 5,8,11,14. XbaI/PstI.
3,6,9,12,15. XbaI.
4,7,10,13,16. PstI.
17.--------------
18.B0014 X

08/02/12

METAL

1. CI lysis.
2. 97 lysis.
3. 98 lysis.
4. 99 lysis.
5. 1 kb ladder.
6. RFP lysis.
7. Terminator lysis.

1. 1 kb ladder.
2 ,5 ,8 ,11. E1010+B0014 EcoRI.
3, 9. E1010+B01014 XbaI.
4, 10. E1010+B0014 EcroRI/XbaI.
6, 12. E1010+B0014 PstI.
7, 13. E1010+B0014 PstI/EcoRI.
14, 15. P4.

1. 1 kb ladder.
2, 5. 02 CI EcoRI.
3. 02 CI XbaI.
4. 02 CI EcroRI/XbaI.
6. 02 CI PstI.
7. 02 CI PstI/EcoRI.
8. 97 CZrA_ArsR EcoRI.
9. 97 CZrA_ArsR PstI
. 10. 97 CZrA_ArsR EcoRI/PstI.
11. 98 CZrA_ArsR EcoRI.
12. 98 CZrA_ArsR PstI.
13. 98 CZrA_ArsR EcoRI/PstI.
14. 99 CZrA_ArsR EcoRI.
15. 99 CZrA_ArsR PstI.
16. 99 CZrA_ArsR EcoRI/PstI.

08/02/12

SUGAR

ïExtracted plasmids from liquid cultures[PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL]:
AraC+ O+K143002
ïGusA+A3
ïGusA+BBR1

PCR GusA, GusA I, PCR GusA P, PCR GusA I

ïAdd 10 µl of each primer (LW and UP).
ïAdd 3 µl of plasmid (P).
ïAdd 30.4 µl buffer.
ïAdd 5 µl Mg.
ïAdd 8 µl DNTpís.
ïAdd 42.6µl H2O miliQ.
ïAdd 1 µl RTTG polymerase.
ïCentrifuge (spin) 8 secs.
ïAdd mineral oil till the eppendorf is full.
ïPlace eppendorf 1 mL in thermocycler.
ïRun PCR with program ìBERNAî.

1.GusA PCR 1
2.GusA PCR 2
3.A3+GusA 1
4.A3+GusA 2
5.A3+GusA 3
6.P GusA
7.P GusA 2
8.Ladder
9.01
10.06
11.96

08/03/12

SUGAR

ï Ran a gel with: (18)

GEL ELECTROPHORESIS PROTOCOL .
ïRan another gel to extract with:
1.GusA PCR 1
2.GusA PCR 2
3.00
4.01
GEL ELECTROPHORESIS PROTOCOL .
ïDid the following digestions LIQUID CULTURE:

ï O+K143002 E,X; A3+GusA E,S; GusAPCR X,P

ïExtracted GusAPCR X,P digestion LIQUID CULTURE.

ïLeft the following ligation: AraC+ O+K143002 LIGATION PROTOCOL.

1.A3+GusA 2
2.A3+GusA 3
3. O+AmyE 3í 2
4. O+AmyE 3í 3
5.XylR X,P
6.pBad-pXyl X,P
7.GusA PCR X,P

08/03/12

METAL

1. 1 kb ladder.
2. LasR PCR (-).
3. LasR 1 PCR.
4. LasR 2 PCR.
5. P4 PCR (-).
6. P4 PCR.
7. P4 purification.

1. 1 kb ladder.
2. LasR (-).
3. LasR PCR.
4. LasR PCR.
5. P4 PCR
. 6. Purified P4.
We ligated CI+P4 and plated in Cm25.

08/06/12

SUGAR

ïMade liquid cultures of O+K143002 (2 cultures+1 control) and AraC+ O+K143002 (2 cultures+1 control) LIQUID CULTURE.
ïLigated GusAPCR X,P+B0079 S,P dephosphorylated LIGATION PROTOCOL.
ïRan a Gel with: (19)

Digested 14 tubes of AraC+ O+AmyE 3í E,P

08/07/12

METAL

>P4 Purification.

1. 1 kb ladder.
2. CI 02 EcoRI.
3. 02 CI XbaI.
4. 02 CI EcroRI/XbaI.
5. CI 02 EcoRI/XbaI dephosphated.
6. P4 E/S.
7. P4 PCR.
8. P4 PCR (-).
9. LasR 1 PCR.
10. LasR 2 PCR.
11. LasR PCR from yesterday.
12. LasR PCR (-).

08/08/12

METAL

We ligated CI+P4 and plated in Cm25. LIGATION PROTOCOL

1. LasR 1 PCR.
2. LasR dephosphated (*) PCR.
3. 1 kb Ladder.

1. 1 kb ladder.
2. Purified LasR 1.
3. Purified LasR *.

08/08/12

SUGAR

BBa_B0040 6I psB1A2 Amp+ plate 1
Digested 14 tubes of AraC+ O+AmyE 3í E,P LIQUID CULTURE. (19.1)

08/09/12

SUGAR

ïFrom yesterdayís PCRís :
ï E0040 plasmid 1
E0040 plasmid 2
E0040 digested 1
E0040 digested 2
We purified with PCR kit

ïRan a gel GEL ELECTROPHORESIS PROTOCOL .
ïMade 14 PCRís from AraC+ O+AmyE 3í.
ïFrom B0079+GusA ligation and B0040 transformation: ïGrew colonies.
ïMade liquid cultures LIQUID CULTURE.
ïStreaked these in a new plate.
ïDiluted plasmid E0080 2 1/50.

08/09/12

METAL

>We transformed the CI+P4 ligation in DH5a and plated it in Cm25. TRANSFORMATION PROTOCOL¨.

>We purified LasR PCRs so we could have linear LasR.

We digested LasR* with EcoRI and SpeI. DIGESTION PROTOCOL
We ligated CI+LasR.

1. 1 kb ladder.
2. CI EcoRI/XbaI.
3. LasR EcoRI/SpeI.

08/10/12

METAL

We plated CI+LasR ligation in Cm25.
>We only obtained colonies in the CI+LasR plates and not in the CI.
> We put cultures so we could then do the P4+CI and CI+LasR lysis.

08/13/12

SUGAR

ïAfter running a gel with 14 PCRís AraC+ O+AmyE 3í and it did not come out as expected, we ran a gel with the ligation AraC+ O+AmyE 3í to select candidate (that weight the same as the ligation) GEL ELECTROPHORESIS PROTOCOL : (20)

ïExtracted pasmids form liquid cultures: B0049, B0079+GusA [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL].

ïAraC+ O+AmyE 3í undigested didnít run in the gel as expected, it ran similarly to AraC+ O

ï We repeated the ligation AraC+ O S,P dephosphorylated+K143002 X,P LIGATION PROTOCOL.

ï GFP PCR gel came out with two bands one is GFP and the other one are the primers, even after purifying by kit. We joined 2 GFP PCR tubes.

ï We ran a gel to extract.

1.6 AraC+ O+AmyE 3í E with P.

2.8 AraC+ O+AmyE 3í E with P.
3.11 AraC+ O+AmyE 3í E with P.
4.12 AraC+ O+AmyE 3í E with P.
5.6 AraC+ O+AmyE 3í with E,X.
6.8 AraC+ O+AmyE 3í with E,X.
7.11 AraC+ O+AmyE 3í with E,X.
8.12 AraC+ O+AmyE 3í with E,X.
9.00 pBad/pXyl with S,P.
10.Ladder.
11.E0040 PCR E,S to extract the correct band.

08/13/12

METAL

>We did CI+P4 and CI+LasR lysis by miniprep. Lysis protocol.
> We digested the lysis to free the fragment with EcoRI, EcoRI/PstI, PstI. DIGESTION PROTOCOL.

1. CI+P4 1 EcoRI
2. CI+P4 1 PstI
3. CI+P4 1 EcoRI/Pst
I 4. CI+P4 2 EcoRI
5. CI+P4 2 PstI
6. CI+P4 2 EcoRI/PstI
7. CI+P4 3 EcoRI
8. CI+P4 3 PstI
9. CI+P4 3 EcoRI/PstI 10. CI+P4 4 EcoRI
11. CI+P4 4 PstI
12. CI+P4 4 EcoRI/PstI

08/14/12

METAL

1.1 kb ladder.
2-17.P4CI lysis.
18.CI lysis 02.

1.1 kb ladder.
2.LasR CI lysis 5
3.LasR CI lysis 6
4.LasR CI lysis 8
5.LasR CI lysis 9
6.LasR CI lysis 10
7.CI lysis 02

08/15/12

METAL

We did lysis of the rest of the colonies for the P4CI and LasRCI ligation.

>From these lysis we left digestions with EcoRI and PstI. DIGESTION PROTOCOL

We put digestions for these lysis with E/P. DIGESTION PROTOCOL

1. 1 kb ladder.
2-17. P4CI EcoRI/PstI Diferent colonies
18. CI02 EcoRI

1. 1 kb ladder.
2. LasRCI EcoRI 5.
3. LasRCI EcoRI 6.
4. LasRCI EcoRI 8.
5. LasRCI EcoRI 9.
6. LasRCI EcoRI 10.
7. CI.
8. -
9. E/X digested Dephosphated CI.
10. E/X digested CI.
11. E/S digested LasR.
12. E/S P4.

08/16/12

METAL

1.P4CI lysis with kit 7.
2.P4CI lysis with kit 7.
3.P4CI lysis with kit 7.
4.1 kb ladder.
5.AmyE 5í lysis from kit 1.
6.AmyE 5í lysis from kit 2.

1.1 kb ladder.
2.97 Promoter XbaI/PstI.
3.98 Promoter XbaI/PstI.
4.99 Promoter XbaI/PstI.
5.AmyE 5í lysis 1.
6.AmyE 5í lysis 2.

08/16/12

SUGAR

ïRan a gel with yesterdayís digestions [GEL ELECTROPHORESIS (22)PROTOCOL]:

ïDigested:
ArSR-CzrA 97 with S,P
ArSR-CzrA 98 with S,P
ArSR-CzrA 99 with S,P
E0040 PCR with E,S
Digestion Protocol.

08/17/12

METAL

1.1 kb ladder.
2.97 promoter XbaI/PstI.
3.98 promoter XbaI/PstI.
4.99 promoter XbaI/PstI.
5.P4CI EcoRI/SpeI.
6.P4CI EcoRI/SpeI.
7.P4CI SpeI.

1. 1 kb ladder.
2-8. LasRCI * lysis.
8. CI lysis.

1-8. LasR E/S lysis.
9. 1 kb Ladder.
10. -----
11. P4CI EcoR
I. 12. P4CI PstI.
13. P4CI EcoRI/PstI.
14. P4CI EcoRI/PstI.

08/20/12

METAL

1. P4CI BcuI/EcoRI
2. 1 kb ladder.
3. LasRCI * lysis 2.
4. LasRCI * lysis 3.
5. LasRCI * lysis 4.
6. LasRCI lysis 4.
7. LasRCI lysis 6.

1. 1 kb ladder.
2. LasRCI * lysis 2.
3. LasRCI * lysis 3.
4. LasRCI * lysis 4.
5. LasRCI lysis 4.
6. LasRCI lysis 6.
7. CI lysis.

08/20/12

SUGAR

ïLigated B0079 S,P dephosphorylated + GusA PCR X,P and pVeg S,P dephosphorylated + XylR X,P LIGATION PROTOCOL.

08/21/12

SUGAR

ïJoined both .6 ml tubes of B0014 EX and B0014 XE in one and dephosphorylated [DEPHOSPHORYLATION PROTOCOL].
ïExtracted plasmid from the 24 tubes of of ligation K143001+pBad/pXylR [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL].
ïDigested O+AmyE 3í with E,X and + O+AmyE 3í II with E,X (obtained these two from glycerols stored at -80∫C LIQUID CULTURE.

Digested K143001+PBad, pXyl with E,S

1.K143001+PBad, pXyl E,S 10
2.K143001+PBad, pXyl E,S 11
3.K143001+PBad, pXyl E,S 12
4.A3 PCR
5.A3 PCR
6.E0040 PCR E,S
7.B0014 E,X dephosphorylated
8. O+AmyE 3í E,X
9. O+AmyE 3í E,X II
10.Ladder

08/21/12

METAL

>We decided to use BcuI instead of SpeI because SpeI is not working properly.

1.1 kb ladder.
2.B0014/E1010 * ExoRI/XbaI.
3.B0014/E1010 ExoRI/XbaI.
4.P4CI EcoRI/BcuI.

08/22/12

METAL

1.LasR PCR.
2.1 kb ladder.
3.LasR PCR.
4.LasR PCR.
5.LasR * PCR.
6.LasR control PCR.
7.97 promoter XbaI/PstI.
8.97 promoter XbaI/PstI.
9.1 kb ladder.
10.99 promoter X/P.
11-18.LasRCI 1 lysis.
19.1 kb ladder.

08/22/12

SUGAR

ïWe did 2 PCRís for A3 [PCR PROTOCOL].

ïDigested K143001+PBad, pXyl with E,S
LIQUID CULTURE. (22.1)

GEL ELECTROPHORESIS PROTOCOL .
ïDid band extraction of:
1. K143001+PBad, pXyl E,S 10
2.K143001+PBad, pXyl E,S 11
3.K143001+PBad, pXyl E,S 12

LIQUID CULTURE.
ïMade liquid cultures from E1010+Boo14 that the other lab gave us and did 2 plates for glycerol Km+ LIQUID CULTURE
GLYCEROL PROTOCOL .

ïDid 2 plates for glycerol of both K143001+pBad/pXyl 10y11 Km+ and AraC+ O+AmyE 3í 6,8,11,12 Km+ and Spectinomycin+ GLYCEROL PROTOCOL .

ïTransformed ligations:
B0079+GusA Amp+
Pveg+XylR Chloramphenicol+ TRANSFORMATION PROTOCOL..

1. O+AmyE 3í E,X 6.2
2.O+AmyE 3í II E,X
3.97 ArsR-CzrA
4.98 ArsR-CzrA
5.99 ArsR-CzrA

08/23/12

SUGAR

ïThe negative controls were contaminated. We didnít manipulate the ones that had grown because of this.
ïRan gel with GEL ELECTROPHORESIS PROTOCOL : (23.01)
Digestion Protocol.

08/23/12

METAL

1. -
2-9. LasRCI digestions EcoRI/PstI.
10. 1 kb ladder.
11. LasR 1 purification
. 12. LasR 1 putification.
13. LasR 1 purification.
14. LasR purification from PCR which was done twice in the same batch.

1.LasRCI 1.
2.1 kb Ladder.
3.LasRCI 2.
4.LasRCI 3.

08/24/12

METAL

>We repeated LasR PCR but it didnít work.
>We ligated RFP terminatr (E1010+B0014)+P4+CI(97/98/99) amyE 5í. LIGATION PROTOCOL
> We transformed this ligation. TRANSFORMATION PROTOCOL

08/24/12

SUGAR

From plate with ligation E0040+B0014, ligation K143001+pBad,pXyl 10 and 11, and ligation AraC+ O+AmyE 3í 6 and 8 we streaked 2 plates for glycerol of each ligation.
Repeated ligation B0079+GusA.

Ligated E0040 PCR E,S+B0014 E,X dephospohylated LIGATION PROTOCOL.

Made 2 new plates from Pveg+XylR ligation and liquid cultures LIQUID CULTURE.

08/25/12

SUGAR

Extracted pellet from 16 tubes of pVeg+XylR that were left overnight [PLASMID EXTRACTION (ìsoftî lysis) PROTOCOL].

Ligated B0079+GusA and B0040+B0014 LIGATION PROTOCOL.

08/25/12

METAL

We removed the plates from 37∫C.

08/26/12

METAL

We plated the colonies from the ligation P4CI+E1010+B0014 in Km30. We put liquid cultures of LB Km30 so we can do the lysis.

1. 1 kb ladder.
2-19. P4CI+E1010B0014 lysis.
20. E1010B0014 lysis.
21. 1 kb ladder.
22-39. P4CI+E1010B0014 lysis.
40. E1010B0014 lysis.

08/27/12

METAL

We did alkaline lysis LYSIS PROTOCOL of P4CI+E1010B0014.

>We did digestions of the lysis with EcoRI and PstI DIGESTION PROTOCOL.

1.1 kb ladder.
2 - 19.AmyE 5í 97 E1010 B0014 lysis E/P digestion.
20.AmyE 5í lysis
21.1 kb ladder.

1.1 kb ladder.
2.LasR digested with E/S.
3.CI digested with E/X.

1. 1 kb ladder.
2-7. AmyE 5í 99 E/P .
8-13. AmyE 5í 97 E/P .
14-19. AmyE 5í 98 E/P .
20. AmyE 5í E/P .

1.1 kb ladder.
2-19.P4+CI+RFPterm E/P digestion I.
20.RFPterm E/P digestion.

08/28/12

METAL

We ligated LasRCI at 20 µl. LIGATION PROTOCOL.

1.1 kb ladder.
2-3.AmyE 5í 99 lysis from kit.
4-5.AmyE 5í 98 lysis from kit.
6-7.AmyE 5í 97 lysis from kit.
8-11.P4 CI + E1010 B0014 Lysis from kit.
12.CI 02 lysis from kit.
13.AmyE 5í lysis from kit.

08/28/12

SUGAR

Made liquid cultures from transformations tht were left overnight -R0079+GusA
-R0079+GusA (-)
-E0040+B0014
-E0040+B0014 (-)
LIQUID CULTURE.

1. A3 PCR 1.
2. A3 PCR 2.
3. O+AmyE 3í S,P *.
4. O+AmyE 3í S,P .
5. Pveg+XylR E,S 2.
6. Pveg+XylR E,S 3.
7. Pveg+XylR E,S 4.

08/29/12

SUGAR

Digested Pveg+XylR 2,3,4 with E,S.

Digested O+AmyE 3í with S,P DIGESTION.

Ran a PCR with A3 PCR (2 .6 ml tubes) [PCR PROTOCOL].

Ran a gel with
GEL ELECTROPHORESIS PROTOCOL : (23.01)

1-23. E0040 + B0014 colonies
24-29. B0079+GusA 1
30. B0079

08/29/12

METAL

We transformed the LasRCI ligation previously plated on Cm25. TRANSFORMATION PROTOCOL

We digested in 20µl with EcoRI/PstI AmyEí5 promoter lysis. DIGESTION PROTOCOL
We counted and took LasRCI colonies and re-plated them.

1-2. AmyE 5í 97 digestion E/P.
3-4. AmyE 5í 98 digestion E/P.
5-6. AmyE 5í 99 digestion E/P.
7. AmyE 5í digestion E .
8. 1 kb ladder.
9-12. P4CI E1010 B0014 E/P digestion I.
13. 02 CI E/P.
14. 1 kb ladder.
15. BcuI 99 digestion.
16. SpeI/PstI 99 digestion.
17. S/P 98 digestion.
18. S/P 97 digestion.

1. 1 kb ladder.
2. Arsr-CzrA 97 promoter S/P.
3. Arsr-CzrA 98 promoter S/P.
4. Arsr-CzrA 99 promoter S/P.

08/30/12

SUGAR

ïRan a gel GEL ELECTROPHORESIS PROTOCOL : (24)

ïDigested PVeg+XylR 1,5,7,10,13,16 with E,S; E0040+B0014 3,4,5,10,11,19,21,22 with X,P; B0079+GusA 3,4,5 E,S LIQUID CULTURE.

1-3B0079+GusA E,S 3.
4-9. PVeg+XylR E,S 1.
10-17. E0040+B0014 X,P 3.
18. 1 kb ladder.

1.A3 PCR.

E0040+B0014 X,P 4 to extract

08/31/12

SUGAR

ïRan a gel GEL ELECTROPHORESIS PROTOCOL : (25)

ïDephosphorylated [DEPHOSPHORYLATION PROTOCOL]:
O+AmyE 3í S,P
O+AmyE 3í II S,P
6 AraC+ O+AmyE 3í E,X
8 AraC+ O+AmyE 3í E,X
11 AraC+ O+AmyE 3í E,X
12 AraC+ O+AmyE 3í E,X

ïRan a gel with A3 PCR GEL ELECTROPHORESIS PROTOCOL : (26)

ïIt was the second time we didnít obtain a band from A3ís PCR.

ïProbably because it had been missing the buffer 2ís ethanol (ìblue lidî) from the PCR purification.

ïRan a gel woth E0040+B0014 X,P 4 to extract [GEL (27) ELECTROPHORESIS PROTOCOL]
Gen extraction protocol.

ïDid an A3 PCR [PCR PROTOCOL].

08/31/12

METAL

We digested the promoters with S/P to ligate it with GFP+terminator so we could characterize them. DIGESTION PROTOCOL
We left cultures with LasRCI to make lyses.

>We ran a gel with the promoterís digestions with S/P to extract and ligate to E0040B0014. LIGATION PROTOCOL GEL EXTRACTION PROTOCOL.

@@ Line 1: / Line 1: @@
 {{:Template:Team:UNAM_Genomics_Mexico/webhtml| content=
+__NOTOC__
+<br />
+<h1>Complete Notebook</h1>
+<br />
+<br />
+=MAY=
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/2/2e/UnamgenomicsoANDcadmio05_29_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/2/2e/UnamgenomicsoANDcadmio05_29_2012.jpg' /></a>
+<div class='captionnaranja'>
+<p class='captionInside'>1. 10 kb ladder <br />
+. Lysis PRMn25 <br />
+. Lysis PRMn25 <br />
+. Lysis PRMn25 <br />
+. Purified PFRC54(A3) <br />
+. Total DNA (PFRC54) <br /></p>
+</div>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
 <br />
-<h1>Under Construction</h1>
 <br />
 <br />
+<br />
+<h2>05/29/2012</h2><br /> METAL
+Our group is in charge of building part of the ìandî construction. We started analyzing if the plasmid we have with P4 actually had what we needed. <br /><br />
+The plasmid PRMn25 contains the protein P4. It has Amp100  resistance and comes in ''Escherichia coli''  NFI. Cells were lysed to make sure the plasmid was present in these cells (5000bp). We ran a gel with 3 lysis, a sample from the plasmid PFRC54 (A3 promoter) and a sample of total DNA from the strain from which PFRC54 was obtained. <br /><br />
+<br /><br />
+<br /><br />
+<br />
 <html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/5/57/UnamgenomicsoANDcadmio05_31_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/5/57/UnamgenomicsoANDcadmio05_31_2012.jpg'  height="300" /></a>
+<div class='captiongray'>
+<p class='captionInside'>1. 10 kb ladder<br />
+. SpeI PRMn25 digestion <br />
+. EcoRI PRMn25 digestion <br />
+. PRMn25 lysis <br />
+. SpeI PRMn25 digestion <br />
+. EcoRI PRMn25 digestion <br />
+. PRMn25 lysis <br />
+. SpeI PRMn25 digestion <br />
+. EcoRI PRMn25 digestion <br />
+. PRMn25 lysis <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
-<table border="0"  height="150" cellspacing="15" bgcolor="transparent" id="tablecontentbg">
+<br />
-<tr>
-<td id="leftcolumn2">Nanotubes!!</td>
-<td  id="contentcolumn2">The logic</td>
+<h2>05/31/2012</h2><br />METAL
-<td id="rightcolumn2">Random info</td>
+Plasmid PRMn25 was digested with SpeI and EcoRI. We do not have the sequence of the plasmid, but there seem to be several restriction sites for SpeI and just one site for EcoRI. The digestions were left for 4 hours and they were plused in the microwave 3 times, 10 seconds each time. Only Dulceís digestion worked, even though it was the ìdirtiestî sample.
-</tr>
+<br />
-</table>
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+=JUNE=
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/a/a2/UnamgenomicsoANDcadmio06_06_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/a/a2/UnamgenomicsoANDcadmio06_06_2012.jpg'  height="300" /></a>
+<div class='captionrojo'>
+<p class='captionInside'>1.10 kb ladder<br />
+. PRMn25 (P4) lysis 1<br />
+. PRMn25 (P4) lysis 2<br />
+. ---------------<br />
+. 10 kb ladder<br />
+. EcoRI PRMn25 digestion<br />
+. BamHI PRMn25 digestion<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+<br /><br />
 </html>
+<br />
+<h2>06/06/2012</h2><br /> METAL
+We repeated the lysis of PRMn25. <br />
+Digestions (20 µl) <br />
+H2O 12 µl<br />
+Enzime 1 µl<br />
+Buffer 10x  2 µl<br />
+Plasmid 5 µl<br />
+∫C<br /><br />
+PRMn25 was digested with EcoRi and BamHI. Since we donít have the sequence we used these enzyme to confirm the restriction sites mentioned in Rojo et al. (1990). These sites were corroborated and the vector was linearized. We recycled the gel used for the PRMn25 lysis, which is why the gel seems out of phase. <br /><br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/4/47/UnamgenomicsoANDcadmio06_08_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/4/47/UnamgenomicsoANDcadmio06_08_2012.jpg'  height="300" /></a>
+<div class='captionverde'>
+<p class='captionInside'>1. 10kb ladder<br />
+. PRMn25 (P4) lysis 1<br />
+-12. Cell lysis of cells transformed with lysis 1  <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<br />
+<h2>06/07/12</h2><br /> METAL
+PY BROTH 10g salt/L<br />
+PSB2K3 kanamicin<br />
+We transformed RFP E1010. <br />
+plate 1 18F<br />
+plate 2 17E<br />
+Stock 50 mg/mL<br />
+''E.coli'' 1/1000<br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+We made liquid cultures with colonies [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+We extracted plasmids [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#PLASMID_EXTRACTION_2 | PLASMID  EXTRACTION PROTOCOL]]. <br />
+We ran a gel to check the extraction [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]]. <br />
+<br />
+<br />
+<br />
+<br />
+<h2>06/08/12</h2><br /><br /> SUGAR
+The lysis worked so we transformed PRMn25 in DH5a. We performed a lysis on these cells to see if they had been transformed correctly with PRMn25. <br /><br />
+We also transformed PFRC54.  [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation |TRANSFORMATION PROTOCOL]] <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>06/11/12</h2><br /> METAL
+We designed primers for our project. (Note from 07/10/12: we redesigned the primer for LasR, since the sequence was incorrect.) <br />
+OLIGOS 14/06/12<br />
+'''LASR'''<br />
+UPPER 5'-3'<br />
+PREFIX+RBS+SPACER+LASR<br />
+GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG  ATGGCATTAGTAGAT<br />
+LOWER 5'-3'<br />
+SUFIX+LASR<br />
+GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA TCATAATGTAATTAA
+<br />
+<br />
+'''P4 5'-3''''<br />
+PREFIX+RBS+SPACER+P4 <br />
+upper<br />
+GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGCCTAAAACACAA<br />
+SUFIX+P4<br />
+lower 5'-3'<br />
+GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CTACACCATACTTTT<br />
+<br />
+<br />
+'''A3 (PROMOTER)''' <br />
+UPPER 5'-3'<br />
+PREFIX+A3<br />
+' GTTTCTTCGAATTCGCGGCCGCTTCTAGAG taactttttgcaaga  3'<br />
+LOWER 5'-3'<br />
+SUFIX+A3<br />
+'GTTTCTTCCTGCAGCGGCCGCTACTAGTA ctacttaattatacc 3'<br />
+<br />
+<br />
+'''RFP'''<br />
+UPPER 5'-3'<br />
+PREFIX+RBS+SPACER+RFP<br />
+GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCTTCCTCCGAA<br />
+LOWER 5'-3'<br />
+SUFIX+RFP<br />
+GTTTCTTCCTGCAGCGGCCGCTACTAGTA TTATTAAGCACCGGT<br />
+<br />
+<br />
+'''GUSA'''<br />
+UPPER 5'-3'<br />
+PREFIX+RBS+SPACER+GUSA<br />
+GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG atgttacgtcctgta<br />
+LOWER 5'-3'<br />
+SUFIX+GUSA<br />
+GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA tcattgtttgcctcc<br />
+<br />
+<br />
+'''ARAC without LVA''' (version 2 registry part: BBa_C0080) <br />
+UPPER 5'-3'<br />
+PREFIX+RBS+SPACER+ARAC<br />
+GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCTGAAGCGCAA<br />
+LOWER 5'-3'<br />
+SUFIX+ARAC<br />
+GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CAACTTGACGGCTAC<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/3/30/UnamgenomicsoANDcadmio06_14_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/3/30/UnamgenomicsoANDcadmio06_14_2012.jpg'  height="300" /></a>
+<div class='captionrosa'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+.BBa_B0014 (1) ñ terminator<br />
+.BBa_B0014 (4) ñ terminator<br />
+.BBa_E1010 (RFP) Lysis<br />
+.purified BBa_E1010 PSB12K3  (AraC AND team) <br />
+.700 bp ladder<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<br />
+<h2>06/12/12</h2><br /> SUGAR
+We made glycerols of the bacteria <br /> [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#GLYCEROL_PROTOCOL | GLYCEROL PROTOCOL]] . <br />
+We transformed plasmid pHp45 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/3/38/UnamgenomicsandsugarBitacora_2.jpg' height="300"/>
+<div class='captiongray'>
+<p class='captionInside'>1. 1 kb ladder <br />
+.E1010
+</div>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>06/13/12</h2><br /> SUGAR
+We ran gel and extracted from gel [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | LIQUID CULTURE]].<br />
+We made liquid cultures [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]] and lysed [LYSIS PROTOCOL]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/2/2d/UnamgenomicsandsugarBitacora_3.jpg' height="300"/>
+<div class='captionrojo'>
+<p class='captionInside'>1. 1 kb ladder <br />
+We extracted from gel
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>06/14/12</h2><br /> SUGAR
+We extracted from gel [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | LIQUID CULTURE]].<br />
+We made glycerols of pHp45 O [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#GLYCEROL_PROTOCOL | GLYCEROL PROTOCOL]] . <br />
+We transformed PSB2K3 Km (Kanamycin) 5C BBa_J04450
+PSB4A5 Am (ampicillin) 1I BBa_J04450
+AraC BBa_C0080 <br />
+	14L	plate 1	pSB2K3	Km+<br />
+	14L	plate 1	pSB2K3	Km+<br />
+	14L	plate 1	pSB2K3	Km+<br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/5/56/UnamgenomicsandsugarBitacora_5.jpg' height="300"/>
+<div class='captionverde'>
+<p class='captionInside'>1. 1 kb ladder <br />
+pHp45 O with E/P<br />
+We extracted from gel<br />
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>06/14/2012</h2><br /> METAL
+We obtained the terminator from the 2012 distribution (plate 2 24C) and we transformed the DNA in DH5a [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation |TRANSFORMATION PROTOCOL]]. The terminator (BBa_B0014) comes in the PSBIAK3 plasmid with resistance to Amp and Km. The RFP (BBa_E1010) comes in the plasmid PSBI2K3 with resistance to Amp and we obtained it from the 2012 distribution plate 2 (17E). We obtained the purified plasmid of the RFP from the AraC AND team. (Diego, Jonathan, and Abiel). <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/3/30/UnamgenomicsoANDcadmio06_14_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/3/30/UnamgenomicsoANDcadmio06_14_2012.jpg'  height="300" /></a>
+<div class='captionaqua'>
+<p class='captionInside'>1. 1 kb ladder<br />
+. Terminator lysis (BBa_B0014) <br />
+. RFP lysis (BBa_E1010) <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>06/15/12</h2><br /> METAL
+Due to the failed digestions, we did the RFP and terminator lysis again. <br />
+The AraC team has the terminator plasmid purified, we are thinking of using that one. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/9/9d/UnamgenomicsoANDcadmio06_18_12.jpg'><img src='https://static.igem.org/mediawiki/2012/9/9d/UnamgenomicsoANDcadmio06_18_12.jpg'  height="300" /></a>
+<div class='captionmoradoclaro'>
+<p class='captionInside'>1. 700 bp ladder<br />
+. BBa_B0014 lysis (terminator) <br />
+. BBa_E1010 lysis (RFP) <br />
+. BBa_E1010 lysis (RFP AraC team) <br />
+. 1 kb ladder <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>06/15/12</h2><br /> SUGAR
+> Digested pHp45 O with E/P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+> We extracted plasmid with kit. <br />
+> Ran a gel [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . (5) <br />
+>Extracted from gel [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | LIQUID CULTURE]]. <br />
+<br />
+ARAC<br />
+>From the overnight plate we prepared liquid culture [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+>We left them incubating overnight. <br />
+>We left a plate (LB Km DH5a C0080 and a control). <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>06/18/12</h2><br /> SUGAR
+>Plasmid extraction AraC with kit. <br />
+>C0080-psB2K3 915 bp<br />
+>Streaked 4 LB Km 30 plates DH5a psB2K3. <br />
+>It seemed as though there were two different colonies (white) and there had been a mutation. Normally they are red. <br />
+>Ran gel with Spr/Strr (eppendorf -20∫C) [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]]. <br />
+>Made glycerols from one tube of DH5a C0080 Km 50 -> 04. <br />
+>Made glycerols from one tube of DH5a PSB4A5 Amp 100 -> 05 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#GLYCEROL_PROTOCOL | GLYCEROL PROTOCOL]]. <br />
+>Digested C0080 X,S. <br />
+>Digested B0014 E,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/5/52/UnamgenomicsandsugarBitacora_6.jpg' height="300"/>
+<div class='captionrosa'>
+<p class='captionInside'>1. 1 kb ladder <br />
+Digested B0014 with E, P and with E,X
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<br />
+<br />
+<h2>06/18/12</h2><br /> METAL
+We used the RFP that we transformed and the RFP that the AraC team did as a positive control. The terminator still looks strange, since we canít observe supercoling which is normally observed. <br /><br />
+We are waiting for our primers, and the team will be going to a math modeling course for a week. <br /><br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/8/88/UnamgenomicsoANDcadmio07_02_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/8/88/UnamgenomicsoANDcadmio07_02_2012.jpg'  height="300" /></a>
+<div class='captionmorado'>
+<p class='captionInside'>1. 1 kb ladder<br />
+. PCR RFP<br />
+. negative control PCR RFP<br />
+. P4 PCR<br />
+. negative control PCR P4<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<h2>06/19/12</h2><br />  SUGAR
+>Digested B0014 with E, P and with E,X. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+>Ran gels with yesterdayís digestions [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . <br />
+B0014 E,X and 3 B0014 E,P were discarded because of problems in the preparation. <br />
+C0080 is in the first lane. <br />
+>Extracted from gel C0080 X,S [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | LIQUID CULTURE]]. <br />
+>Made glycerols from 4 plates LB Km DH5a pSB2K3 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#GLYCEROL_PROTOCOL | GLYCEROL PROTOCOL]] . <br />
+>Take out AmyE 5í from distribution [DNA KIT PLATE INSTRUCTIONS]. <br />
+AmyE 5í	18K	plate 3	2010, 2011, 2012<br />
+AmyE 3í	18M	plate 3	2010, 2011, 2012<br />
+>Digested B0014 with E,X and E,P again [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>06/22/12</h2><br /> SUGAR
+>Ran gels with digestions B0014 with E,X and E,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]]. <br />
+>Dephosphated B0014 E,X and B0014 E,P [DESPHOPHORYLATION PROTOCOL]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>06/25/12</h2><br /> SUGAR
+>Took LasR	BBa_B0079	plate 1	2010,2011,2012	psB1A2	Amp+ from distribution [DNA KIT PLATE INSTRUCTIONS]. <br />
+<h2>06/26/12</h2><br /> SUGAR
+>Ran gel with psB2K3 and psB4A5 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . <br />
+<h2>06/27/12</h2><br /> SUGAR
+>Transformed with plasmid B0079 1576 bp psB1A2 12A [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+LasR B0079	plasmid	Amp+	12A	plate 1	2010,2011<br />
+AmyE 5í BBa_K143001	Km+	18K	plate 3	2010 and 16M, 18K 2011<br />
+AmyE 3í BBa_K143002	Km+	18M	plate 3	2010 and 16O, 18M 2011<br />
+AmyE 5í grew 2 colonies. <br />
+<h2>06/29/12</h2><br /> SUGAR
+>We did a DH5a K143001 Km30 Amp 100 glycerol [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#GLYCEROL_PROTOCOL | GLYCEROL PROTOCOL]]  07. <br />
+>We plated twice DH5a K143002 Km 30 Amp 100 + control and twice DH5a B0079 Amp 100 + control<br />
+These were both plated in 2 plates each. <br />
+They were left overnight since they had not grown by 7:00 pm so  the next day glycerols were made. <br />
+>Liquid cultures [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+tubes DH5a K143001 Km30 Amp 100 <br />
+tubes DH5a K143002 Km30 Amp 100 <br />
+tubes DH5a B0079 Amp 100 <br />
+tube LB Km 30 Amp 100 control<br />
+tube LB Amp 100 control<br />
+>From the 6 tubes we extracted plasmid from kit. <br />
+<br />
+<br />
+=JULY=
+/02/12<br /> SUGAR
+>Digestions [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+B0079 digestion with S,P<br />
+K143001 with S,P<br />
+K143002 with S,P <br />
+>PCRís<br />
+ïAraC<br />
+ïCassete  OSpr/Strr  <br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#PCR_Protocol_.2850.C2.B5l.29 | PCR PROTOCOL]] <br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/b/be/UnamgenomicsandsugarBitacora_8.jpg' height="300"/>
+<div class='captionmoradoclaro'>
+<p class='captionInside'>After Cassete  OSpr/Strr  PCR we ran a gel
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/c/cd/UnamgenomicsandsugarBitacora_9.jpg' height="300"/>
+<div class='captionmorado'>
+<p class='captionInside'>B0079 digestion with S,P<br />
+K143001 with S,P<br />
+K143002 with S,P <br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>07/02/12</h2><br /> METAL
+We did 2 PCRs, since the primers have arrived. We purified by miniprep RFP and P4. With this PCR we will add the prefix (EcoRI and XbaI) and RBS to the beginning of the sequence, and suffix (restiction sites for SpeI asn PstI). <br />
+RFP, P4 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#PCR_Protocol_.2850.C2.B5l.29 | PCR PROTOCOL]] <br />
+TMís <br />
+RFP UP	 78∫C<br />
+RFP LW      75.5 ∫C<br />
+P4 UP    73.6 ∫C<br />
+P4 LW 73.9∫C<br />
+Taking into account both TMís, we used the same amplification program for both, thermocycle B progam iGEM. <br />
+We ran a gel and we observed fragments that correspond to the RFP and P4, we can also observe other fragments which means we will have to purify the bands. <br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/a/a0/UnamgenomicsoANDcadmio07_03_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/a/a0/UnamgenomicsoANDcadmio07_03_2012_1.jpg'  height="300" /></a>
+<div class='captionazul'>
+<p class='captionInside'>1. 1 kb ladder<br />
+. PCR product P4<br />
+. PCR product RFP<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/1/15/UnamgenomicsoANDcadmio07_03_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/1/15/UnamgenomicsoANDcadmio07_03_2012_2.jpg'  height="300" /></a>
+<div class='captiongray'>
+<p class='captionInside'>1. 1kb ladder<br />
+. P4 purification<br />
+. RFP purification<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>07/03/12</h2><br /> METAL
+We used Roche kit for band purification. <br />
+The P4 purification turned out slightly dirty and the RFP turned out completely dirty. We repeated the purifications by loading the previously ìpurifiedî sample and repeating the procedure. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/9/9f/UnamgenomicsoANDcadmio07_04_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/9/9f/UnamgenomicsoANDcadmio07_04_2012_1.jpg'  height="300" /></a>
+<div class='captionnaranja'>
+<p class='captionInside'>1. Degraded P4. <br />
+. Purified RFP. <br />
+. 1kb Ladder. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/d/d7/UnamgenomicsoANDcadmio07_04_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/d/d7/UnamgenomicsoANDcadmio07_04_2012_2.jpg'  height="300" /></a>
+<div class='captionrojo'>
+<p class='captionInside'>1. 1 kb ladder<br />
+. P4 PCR (1) <br />
+. P4 PCR (2) <br />
+. Negative control P4 PCR<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/c/cb/UnamgenomicsoANDcadmio07_04_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/c/cb/UnamgenomicsoANDcadmio07_04_2012_3.jpg'  height="300" /></a>
+<div class='captionverde'>
+<p class='captionInside'>1. P4 purified from band<br />
+. 1 kb ladder<br />
+. (Do not pay attention to this well). <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<br />
+<h2>07/04/12</h2><br /> SUGAR
+>We dephosphated B0079 S,P, K143001 S,P, K143002 E,X (9.1) [DESPHOPHORYLATION PROTOCOL]. <br />
+>Ligated Cassete  OSpr/Strr  +K143002 dephosphated(digested with E,X and E,S) LIGATION PROTOCOL]. <br />
+>Transformed ligation and left overnight plated [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+>Extracted plasmid PBBR1 GusA in 2 1.5 mL eppendorfs [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. <br />
+>Digested with PstI [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/04/2012</h2><br /> METAL
+We repeated the gel where we checked the re-purification, and indeed we need to repeat P4ís PCR. <br />
+The PCR worked, but a band purification will be needed. We fused all of the PCR product and loaded it. <br />
+We grew bacterial culture in antibiotics for LasR lysis. <br />
+Rfp+terminator ligation [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]] <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/b/b1/UnamgenomicsoANDcadmio07_05_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/b/b1/UnamgenomicsoANDcadmio07_05_2012_1.jpg'  height="300" /></a>
+<div class='captionrosa'>
+<p class='captionInside'>1. 1 kb ladder<br />
+-9. LasR lysis<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/a/ae/UnamgenomicsoANDcadmio07_05_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/a/ae/UnamgenomicsoANDcadmio07_05_2012_2.jpg'  height="300" /></a>
+<div class='captionaqua'>
+<p class='captionInside'>1. 1 kb ladder<br />
+. Terminator digested with EcoRI and XbaI/ dephophatated <br />
+. RFP digested with EcoRI and SpeI. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/c/c1/UnamgenomicsoANDcadmio07_05_2012.png'><img src='https://static.igem.org/mediawiki/2012/c/c1/UnamgenomicsoANDcadmio07_05_2012.png'  height="300" /></a>
+<div class='captionazul'>
+<p class='captionInside'>1-4. XbaI SpeI LasR digestion (3 hours) <br />
+. 1 kb ladder<br />
+-9. LasR PCR<br />
+. Negative control LasR PCR<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<h2>07/05/12</h2><br /> METAL
+Cells were transformed with DH5a with RFP+terminator ligation.[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation |TRANSFORMATION PROTOCOL]] <br />
+LasR lysis were digested. We ran a gel with LasR PCRs to add RBS prefix and suffix. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/f/fd/UnamgenomicsoANDcadmio07_06_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/f/fd/UnamgenomicsoANDcadmio07_06_2012.jpg'  height="300" /></a>
+<div class='captionmoradoclaro'>
+<p class='captionInside'>1-8. LasR PCR<br />
+. Negative control LasR PCR<br />
+. 1 kb ladder<br />
+-15. X/S LasR digestion<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/4/4c/UnamgenomicsoANDcadmio07_06_12.png'><img src='https://static.igem.org/mediawiki/2012/4/4c/UnamgenomicsoANDcadmio07_06_12.png'  height="300" /></a>
+<div class='captionmorado'>
+<p class='captionInside'>1. 1 kb Ladder <br />
+. LasR 2012<br />
+. LasR 2012<br />
+. LasR 2010<br />
+. LasR 2010<br />
+. Negative Control (-)<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<h2>07/06/12</h2><br /> METAL
+We ran LasRís PCRs again, the last PCR didnít work, which is why we lowered the temperature to 65∫C. We left the digestions all night. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#PCR_Protocol_.2850.C2.B5l.29 | PCR PROTOCOL]] <br />
+Since they didnít work, we decided to do it directly from the distribution from 2012 and 2010. <br />
+We noticed our mistakeÖ. The sequence we designed our primers for was an incorrect sequence! <br />
+We need to redo LasR primers. <br />
+Our ligation didnít work. <br />
+We redid RFP+terminator ligation and left it for the weekend. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation| LIGATION PROTOCOL]]<br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/06/12</h2><br /> SUGAR
+LB Km30 Spec60 DH5a  OSpr/Strr  +K143002  still have not grown. <br />
+Ran a gel with yesterdayís digestions to chek if they were done properly (10) <br /> [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . <br />
+Ran another gel with the rest of the samples. <br />
+Extracted GusA fragment <br /> [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | LIQUID CULTURE]]. <br />
+Repeated ligation  OSpr/Strr  +K143002 E,X dephosphated [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+Repeated  OSpr/Strr   PCR. <br />
+<br />
+<br />
+<h2>07/07/12</h2><br /> SUGAR
+Transformed DH5a  OSpr/Strr  +K143002  ligation [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+Plated LB Km30 Spec 60 DH5a  OSpr/Strr  +K143002 . <br />
+<br />
+<br />
+<h2>07/08/12</h2><br /> SUGAR
+Transformed DH5a  OSpr/Strr  +K143002  ligation [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+Plated LB Km30 Spec 60 DH5a  OSpr/Strr  +K143002. <br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/1/13/UnamgenomicsandsugarBitacora_11.jpg' height="300"/>
+<div class='captiongray'>
+<p class='captionInside'>We dephosphated B0079 S,P, K143001 S,P, K143002 E,X<br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/b/b2/UnamgenomicsandsugarBitacora_11.1.jpg' height="300"/>
+<div class='captionnaranja'>
+<p class='captionInside'>1 PCR omega P<br />
+PCR omega I<br />
+PCR AraC P<br />
+PCR AraC I<br />
+ladder 1 Kb<br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>07/09/12</h2><br /> SUGAR
+From yesterdayís transformations only one colony grew. <br />
+From the previous transformation only 2 colonies grew. <br />
+These 3 were streaked in 3 plates: <br />
+DH5a  OSpr/Strr  +K143002  LB Km 30 Sp 100 1. <br />
+DH5a  OSpr/Strr  +K143002  LB Km 30 Sp 100 2. <br />
+DH5a  OSpr/Strr  +K143002  LB Km 30 Sp 100 3. <br />
+LB Km 30 Sp 100 control. <br />
+Did liquid cultures in 3 tubes: <br />
+OSpr/Strr  +K143002  LB Km 30 Sp 100 1. <br />
+OSpr/Strr  +K143002  LB Km 30 Sp 100 2. <br />
+OSpr/Strr  +K143002  LB Km 30 Sp 100 3. <br />
+LB Km30 Sp 100 control. <br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+Ran a gel with: (11) <br />
+GusA P<br />
+PBBR1 GusA<br />
+O E PCR P<br />
+O PCR P<br />
+O PCR I<br />
+O E<br />
+O PCR I<br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] <br />
+Did GusA primers dissolution for PCR. <br />
+GusA PCR <br />
+[PCR PROTOCOL] <br />
+Gel Extraction by kit of lanes 3 and 5 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | LIQUID CULTURE]]. <br />
+'''PCR omega P, PCR omega I, PCR AraC P, PCR AraC I'''<br />
+Add 10 µl  of each primer (LW and UP). <br />
+Add 3 µl  of plasmid (P). <br />
+Add 30.4 µl   buffer. <br />
+Add 5 µl   Mg. <br />
+Add 8 µl   DNTpís. <br />
+Add 42.6µl   H2O miliQ. <br />
+Add 1 µl   RTTG polymerase. <br />
+Centrifuge (spin) 8 secs. <br />
+Add vegetable oil till the eppendorf is full. <br />
+Place eppendorf 1 mL in thermocycler. <br />
+Run PCR with program ìBERNAî. <br /><br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/4/4b/UnamgenomicsandsugarBitacora_11.2.jpg' height="300"/>
+<div class='captionverde'>
+<p class='captionInside'>GusA digestions with X,P;  O+AmyE 3í with E,X; AraC PCR with E,S <br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>07/09/12</h2><br /> METAL
+We transformed the RFP+terminator ligation in DH5a and plated it in LB Km30. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]  <br />
+We digested RFP with EcoRI and SpeI. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]]  <br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/2/2e/UnamgenomicsoANDcadmio07_10_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/2/2e/UnamgenomicsoANDcadmio07_10_2012.jpg'  height="300" /></a>
+<div class='captiongray'>
+<p class='captionInside'>1. 1 kb Ladder<br />
+. RFP digested with EcoRI and SpeI<br />
+. Dephosphated terminator digested with EcoRI and XbaI<br />
+. RFP PCR (Prefix+RBS+RFP+Suffix) <br />
+. PCR RFP (-)<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<h2>07/10/12</h2><br /> METAL
+By 9am we didnít observe colonies in our LB Km30  with yesterdayís transformation, so using yesterdayís RFP digestions we redid the ligation. <br />
+We did another PCR of RFP because we ran out of it. <br />
+We ran a gel with the dephosphated terminator and digested RFP. <br />
+The PCR turned out ok except for some non-specific bands, we will need to extract the correct DNA band. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/3/39/UnamgenomicsoANDcadmio07_11_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/3/39/UnamgenomicsoANDcadmio07_11_2012_1.jpg'  height="300" /></a>
+<div class='captionnaranja'>
+<p class='captionInside'>1. 1 kb ladder<br />
+. RFP PCR to extract the band<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/a/ad/UnamgenomicsoANDcadmio07_11_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/a/ad/UnamgenomicsoANDcadmio07_11_2012_2.jpg'  height="300" /></a>
+<div class='captionrojo'>
+<p class='captionInside'>1. 1kb Ladder<br />
+. RFP 1 PCR<br />
+. RFP 2 PCR<br />
+. RFP 3 PCR<br />
+. RFP 4 PCR<br />
+. RFP 5 PCR<br />
+. RFP (-) PCR<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/0/06/UnamgenomicsoANDcadmio07_11_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/0/06/UnamgenomicsoANDcadmio07_11_2012_3.jpg'  height="300" /></a>
+<div class='captionverde'>
+<p class='captionInside'>1.1 kb ladder. <br />
+. RFP PCR. <br />
+. RFP PCR. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/d/df/UnamgenomicsoANDcadmio07_11_2012_4.jpg'><img src='https://static.igem.org/mediawiki/2012/d/df/UnamgenomicsoANDcadmio07_11_2012_4.jpg'  height="300" /></a>
+<div class='captionrosa'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. RFP PCR extracted. <br />
+. RFP PCR extracted. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/10/12</h2><br /> SUGAR
+ïGusA digestions with X,P;  O+AmyE 3í with E,X; AraC PCR with E,S (2 times)[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTIONS]]. (11.2) <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/11/12</h2><br /> SUGAR
+ïGusA PCR digestions with E,S;  O+AmyE 3í with E,X [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+ïT.V. AraC PCR+ O+AmyE 3í  E,X dephosphated ligation [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/0/0a/UnamgenomicsandsugarBitacora_12.jpg' height="300"/>
+<div class='captionrojo'>
+<p class='captionInside'>1. ladder. <br />
+. GusA PCR E,S. <br />
+. O+AmyE 3í with E,X. <br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>07/11/12</h2><br /> METAL
+We loaded the whole PCR product from the PCR. <br />
+>We took a picture of the gel to check the purification elutions but we did not observe anything so we quantified it on the nanodrop. <br />
+Sample 1) 5.9 ng/µl<br />
+Sample 2) 2.5 ng/µl<br /><br />
+>With the RFP digested with EcoRI and SpeI we did another ligation with the terminator digested with EcoRI and XbaI and left it at 22∫C. <br /><br />
+>We transformed yesterdayís ligation in DH5a and plated it in LB Km30. Since our ligations have not worked we decided to redo the digestions on the terminator (E0014). We asked the other AND team to give us the purified plasmid, but it wasnít enough so we streaked 2 plates LB Km30 so we could have the strain with the terminator. Tomorrow we will put liquid cultures and do lysis. <br /><br />
+>We did digestions in another vector to see the efficiency of the enzymes as a test. We used PBBR-GusA with 5 µl of PBBR GusA, one digestion with 1.5 µl of EcoRI, one with 1 µl of SpeI and one with 1 µl of SpeI and 1.5 µl of EcoRI. <br /><br />
+We left them at 37∫C. <br />
+>We did 5 new RFP PCRs. <br />
+>We streaked again the following strains: <br />
+-DH5a +PRFc54<br />
+-DH5a +Terminator<br />
+The PCRs seem to show the band we need, we will have to extract them. <br />
+<br /><br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/2/27/UnamgenomicsoANDcadmio07_12_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/2/27/UnamgenomicsoANDcadmio07_12_2012.jpg'  height="300" /></a>
+<div class='captionaqua'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. GusA-PBBR<br />
+. PBBR-GusA digested with SpeI. <br />
+. PBBR-GusA digested with  EcoRI. <br />
+. PBBR-GusA digested with  SpeI/EcoRI. <br />
+. RFP+terminator ligation. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<br />
+<br />
+<h2>07/12/12</h2><br /> METAL
+We checked the transformations from the ligation ì3î from RFP+terminator. We didnít observe colonies. <br />
+>We transformed the ligation ì4î RFP+terminator in DH5a, they were plated in LB Km30 . <br />
+>We ran a gel with GusA digestions. <br />
+>We digested 80 µl of the purified RFP with EcoRI and SpeI [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]]. <br />
+>We left liquid cultures in LB Km30  so we can do an alkaline lysis of the plasmid containing the terminator (B0014). <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/f/f1/UnamgenomicsoANDcadmio07_13_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/f/f1/UnamgenomicsoANDcadmio07_13_2012_1.jpg'  height="300" /></a>
+<div class='captionmoradoclaro'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. Terminator alkaline lysis. <br />
+. Terminator alkaline lysis. <br />
+. Terminator alkaline lysis. <br />
+. Terminator alkaline lysis. <br />
+. 1 kb ladder. <br />
+. Terminator digested with E/X. <br />
+. RFP. digested with E/S. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<br />
+<h2>07/12/12</h2><br /> SUGAR
+ïRan a gel with yesterdayís digestions: (12) <br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . <br />
+ïTransformed AraC PCR+ O+AmyE 3í ligation in two tubes [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+ïFrom pfrc54 liquid cultures (A3) that were grown overnight we extracted plasmid [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. <br />
+ïMade glycerols from 2 LB Km 30 Sp100 DH5a  O+AmyE 3í plates and from 1 LB Amp100 pfrc54 (A3) plates with control[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#GLYCEROL_PROTOCOL | GLYCEROL PROTOCOL]] . <br />
+ïLigated GusA PCR with B0014 E,X desphophorylated [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+ïDigested Pfrc54 (A3) with S,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+ïDesphophorylated  O+AmyE 3í E,X [DESPHOPHORYLATION PROTOCOL]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/0/0f/UnamgenomicsandsugarBitacora_13.jpg' height="300"/>
+<div class='captionrojo'>
+<p class='captionInside'>ïRan gel with pfrc54 S,P<br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>07/13/12</h2><br /><br /> SUGAR
+ïRan gel with pfrc54 S,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . (13) <br />
+ïTransformation of GusA PCR + B0014 ligation [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+ïTransformed with GFP E0040 psBIA2. <br />
+ïLiquid Cultures with ligation: AraC+ O+AmyE 3í for plasmid extraction at night [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+ï''B. Subtitils'' competent cells [''B.Subtilis'' group protocol]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/13/12</h2><br /> METAL
+>We did alkaline lysis of the terminator cultures from last night. We ran it and they all look ok, but weíll use the first one because it seems to be the cleanest. <br />
+We ligated RFP/terminator and ran a gel to see RFP and the terminator. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+>We checked the transformations and didnít see colonies. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/8/8b/UnamgenomicsoANDcadmio07_16_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/8/8b/UnamgenomicsoANDcadmio07_16_2012_1.jpg'  height="300" /></a>
+<div class='captionmorado'>
+<p class='captionInside'>1. 1 kb Ladder. <br />
+. B0014/terminator E/X digestion. <br />
+. E0010/RFP E/S digestion. <br />
+. RFP from the other team. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/9/9e/UnamgenomicsoANDcadmio07_16_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/9/9e/UnamgenomicsoANDcadmio07_16_2012_2.jpg'  height="300" /></a>
+<div class='captionazul'>
+<p class='captionInside'>1.  1 kb ladder. <br />
+. RFP pcr. <br />
+. RFP pcr. <br />
+. RFP pcr. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/2/29/UnamgenomicsoANDcadmio07_16_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/2/29/UnamgenomicsoANDcadmio07_16_2012_3.jpg'  height="300" /></a>
+<div class='captiongray'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. Purified RFP. <br />
+. Purified RFP. <br />
+. Purified RFP. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>07/14/12</h2><br /><br /> SUGAR
+ïFrom 24 AraC+ O+AmyE 3í LB Km 30 Sp 100 DH5a tubes: <br />
+ïExtracted pellets<br />
+ïExtracted plasmids [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. <br />
+ïRan gel [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . <br /><br />
+ïFrom transformed DH5a km 30: <br />
+GusA+B0014 DH5a Km50 24 pellets <br />
+E0040 DH5a LB Amp100 <br />
+From these two we: <br />
+ïDid liquid cultures [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+ïExtracted plasmid [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. <br />
+ïFrom the GusA+E0014 transformation we took 24 colonies, did liquid cultures and extracted plasmid  [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+ïRan gel with this transformation [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . <br />
+<br />
+<br />
+<br />
+<h2>07/16/12</h2><br /><br /> SUGAR
+ïDigested E,P AraC+ O+AmyE 3í <br />
+ïO+AmyE 3í E,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/4/48/UnamgenomicsandsugarBitacora_14.jpg' height="300"/>
+<div class='captionrosa'>
+<p class='captionInside'>Digested E,P AraC+ O+AmyE 3í <br />
+O+AmyE 3í E,P <br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>07/16/12</h2><br /> METAL
+We ran a gel with the RFP digestion, the purified terminator, and the RFP terminator ligation that was left for the whole weekend. (GEL NOT SHOWN)<br />
+>We digested the terminator with EcoRI and XbaI [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]]. <br />
+> We digested RFP 1 with EcoRI and SpeI [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]]. <br />
+In the gel we can see that the terminator digestion in ok, although it is still partial. We need to leave it for the whole night. We canít see the RFP digestion; it is possible that it degraded. We will concentrate RFP. <br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/f/f6/UnamgenomicsoANDcadmio07_17_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/f/f6/UnamgenomicsoANDcadmio07_17_2012_1.jpg'  height="300" /></a>
+<div class='captionnaranja'>
+<p class='captionInside'>1. 1 kb ladder<br />
+. RFP lysis. <br />
+. RFP lysis 2010<br />
+. Terminator Digestion. <br />
+. RFP Digestion. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/e/e8/UnamgenomicsoANDcadmio07_17_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e8/UnamgenomicsoANDcadmio07_17_2012_2.jpg'  height="300" /></a>
+<div class='captionrojo'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. RFP PCR lysis. <br />
+. RFP PCR lysis. <br />
+. RFP PCR lysis. <br />
+. RFP PCR lysis. <br />
+. RFP PCR lysis. <br />
+. RFP PCR lysis. <br />
+. Negative control. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/4/4f/UnamgenomicsoANDcadmio07_17_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/4/4f/UnamgenomicsoANDcadmio07_17_2012_3.jpg'  height="300" /></a>
+<div class='captionverde'>
+<p class='captionInside'>1. 1 kb  ladder. <br />
+. PCR RFP lysis. <br />
+. PCR RFP lysis. <br />
+. PCR RFP lysis. <br />
+The pcr looks fine, now we will run 3 samples in fused wells so we can cut them and extract the DNA. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/1/10/UnamgenomicsoANDcadmio07_17_2012_4.jpg'><img src='https://static.igem.org/mediawiki/2012/1/10/UnamgenomicsoANDcadmio07_17_2012_4.jpg'  height="300" /></a>
+<div class='captionverde'>
+<p class='captionInside'>1. 1kb ladder. <br />
+. Purified RFP. <br />
+. Purified RFP. <br />
+. Purified RFP. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/17/12</h2><br /> METAL
+We ran 6 50 µl reactions of the PCR to amplify RFP. We will use as DNA RFP from the lysis, one from 2012, and one from 2010. We will make a dilution, use 1 µl of lysis and diluted them in H2O. <br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#PCR_Protocol_.2850.C2.B5l.29 | PCR protocol]]. <br />
+>We can still observe bands in the purification, we will try to do a better PCR. <br />
+>We digested the terminator lysis with EcoRI and XbaI and we decided to switch buffers. We used buffer 2 even though EcoRI might have a star effect. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/6/6d/UnamgenomicsoANDcadmio07_18_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/6/6d/UnamgenomicsoANDcadmio07_18_2012_1.jpg'  height="300" /></a>
+<div class='captionrosa'>
+<p class='captionInside'>2. 1 kb ladder. <br />
+. Terminator digested E/X. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/f/f9/UnamgenomicsoANDcadmio07_18_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/f/f9/UnamgenomicsoANDcadmio07_18_2012_2.jpg'  height="300" /></a>
+<div class='captionaqua'>
+<p class='captionInside'>1. 1 kb ladder <br />
+. RFP PCR with hot start<br />
+. Negative Control<br />
+. Terminator Lysis<br />
+. Terminator digestion E/X. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/4/4b/UnamgenomicsoANDcadmio07_18_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/4/4b/UnamgenomicsoANDcadmio07_18_2012_3.jpg'  height="300" /></a>
+<div class='captionmoradoclaro'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. RFP lysis PCR. <br />
+. RFP lysis (other team). <br />
+. Negative control. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<br />
+<h2>07/17/12</h2><br /><br /> SUGAR
+ïRan gel with yesterdayís digestions [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. (14) <br />
+ïThe gel we ran didnít work, probably because the agarose was not prepared correctly. <br />
+ïDigested 12, 15, 18, 21 with AraC+ O+AmyE 3 with E and also with Pí; B0014 with E,X; E0040 with X,S[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/d/db/Bitacora_15.jpg' height="300"/>
+<div class='captionaqua'>
+<p class='captionInside'>ïDigested 12, 15, 18, 21 with AraC+ O+AmyE 3 with E and also with Pí; B0014 with E,X; E0040 with X,S<br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<br />
+<h2>07/18/12</h2><br /><br /> SUGAR
+ïFrom yesterdayís digestions we ran a gel [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . (15) <br /><br />
+ïWe made liquid cultures of AraC+ O+AmyE 3í 12, 15, 21 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br /><br />
+ïWe ligated AraC PCR E,S dephosphated with + O+AmyE 3í [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br /><br />
+ïWe digested 1 + O+AmyE 3í E,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br /><br />
+<h2>07/18/12</h2><br /> METAL
+We did a PCR using hot star and without MgCl2. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Hot_start_PCR_protocol | HOT START PCR PROTOCOL]] <br />
+<br />
+We left an RFP digestion and took the DNA from the RFP PCR which looked good. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#PCR_Protocol_.2850.C2.B5l.29 | PCR PROTOCOL]]
+<br />
+From these PCR products we left the PCR digestion with EcoRI and SpeI and used enzymes from the same company.  [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/f/fc/UnamgenomicsoANDcadmio07_19_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/f/fc/UnamgenomicsoANDcadmio07_19_2012_1.jpg'  height="300" /></a>
+<div class='captionmorado'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. E/S RFP digestion. <br />
+. E/S RFP digestion (RFP PCR lysis). <br />
+. E/S RFP digestion (Cut RFP PCR from the other team). <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/1/1b/UnamgenomicsoANDcadmio07_19_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/1/1b/UnamgenomicsoANDcadmio07_19_2012_2.jpg'  height="300" /></a>
+<div class='captionazul'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. E/X terminator 1 digestion. <br />
+. E/X terminator 2 digestion. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/5/53/UnamgenomicsoANDcadmio07_19_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/5/53/UnamgenomicsoANDcadmio07_19_2012_3.jpg'  height="300" /></a>
+<div class='captiongray'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. Terminator Lysis 1. <br />
+. RFP Lysis 2. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/6/6d/UnamgenomicsoANDcadmio07_19_2012_4.jpg'><img src='https://static.igem.org/mediawiki/2012/6/6d/UnamgenomicsoANDcadmio07_19_2012_4.jpg'  height="300" /></a>
+<div class='captionnaranja'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. RFP E/S digestion. <br />
+. Terminator 2 E/X digestion. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/19/12</h2><br /> METAL
+From the three RFP digestions we left yesterday we ran a gel to prove that our DNA wasnít being degraded, as it had been happening. <br />
+> Our DNA wasnít degraded, we will use these digestions to do the ligation. <br />
+>We did lysis of the terminator cultures by miniprep. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Lysis_protocol | LYSIS PROTOCOL]] <br />
+We ligated RFP+terminator. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation |  LIGATION PROTOCOL]] <br />
+We transformed the ligation. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation |  TRANFORMATION PROTOCOL]] <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/19/12</h2><br /><br /> SUGAR
+ïWe ran We digested 1 + O+AmyE 3í E,P with Miguelís enzymes and with Abielís enzymes [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br /><br />
+ïWe transformed with ligations AraC+ O+AmyE 3í E and + O+AmyE 3í E [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br /><br />
+ïExtracted plasmids from AraC+ O+AmyE 3í 12,15,21 [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. <br /><br />
+ïDigested E0040 X,S 2,3,4,5,6; ligations AraC+ O+AmyE 3í E 12,15,21; ligations AraC+ O+AmyE 3í P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br /><br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/f/f3/UnamgenomicsandsugarBitacora_16.jpg' height="300"/>
+<div class='captionmoradoclaro'>
+<p class='captionInside'>Digested E0040 X,S 2,3,4,5,6; ligations AraC+ O+AmyE 3í E 12,15,21; ligations AraC+ O+AmyE 3í P <br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>07/20/12</h2><br /><br /> SUGAR
+ïRan gel with yesterdayís digestions [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . (16) <br />
+ïTransformed GusA+B0014 in two tubes [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+ïMade liquid cultures from AraC+ O+AmyE 3ís transformation LB Km30 Sp 100 and control LB Km 30 Sp100 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/20/12</h2><br /> METAL
+We observed two colonies, we put them in liquid LB. <br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/1/11/UnamgenomicsoANDcadmio07_23_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/1/11/UnamgenomicsoANDcadmio07_23_2012_1.jpg'  height="300" /></a>
+<div class='captionrojo'>
+<p class='captionInside'>1.1 kb ladder. <br />
+.RFP-terminator lysis. <br />
+.RFP-termintor lysis. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/b/b5/UnamgenomicsoANDcadmio07_23_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/b/b5/UnamgenomicsoANDcadmio07_23_2012_2.jpg'  height="300" /></a>
+<div class='captionverde'>
+<p class='captionInside'>1.1 kb ladder. <br />
+.E ligation 1 digestion. <br />
+.P ligation 1 digestion. <br />
+.E/P ligation 1 digestion. <br />
+.E ligation 2 digestion. <br />
+.P ligation 2 digestion. <br />
+.E/P ligation 2 digestion. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>07/23/12</h2><br /> METAL
+We made a lysis of the ligation using miniprep. <br />
+>We did the following digestions<br /> [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br />
+ïEcoRI/PstI ligation<br />
+ïEcoRI ligation<br />
+ïPstI ligation<br />
+The results indicate that the vector only ligated with itself. <br />
+We put B0014 and E1010 digestions. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br />
+Boo14 EcoRI<br />
+Boo14-XbaI<br />
+B0014 EcoRI/XbaI<br />
+E1010 EcoRI<br />
+E1010 SpeI<br />
+E1010 EcoRI/SpeI<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/2/2e/UnamgenomicsoANDcadmio07_24_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/2/2e/UnamgenomicsoANDcadmio07_24_2012_1.jpg'  height="300" /></a>
+<div class='captionrosa'>
+<p class='captionInside'>1.1 kb Ladder. <br />
+.B0014 EcoRI. <br />
+.B0014 XbaI. <br />
+.B0014 EcoRI-XbaI. <br />
+.B0014 EcoRI-XbaI dephosphated. <br />
+.E1010 EcoRI. <br />
+.E1010 SpeI. <br />
+.E1010 EcoRI-SpeI. <br />
+.E1010 EcoRI-SpeI. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/e/e6/UnamgenomicsoANDcadmio07_24_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e6/UnamgenomicsoANDcadmio07_24_2012_2.jpg'  height="300" /></a>
+<div class='captionaqua'>
+<p class='captionInside'>1.1 kb ladder. <br />
+.B0014 lysis. <br />
+.B0014 lysis. <br />
+The buffer had been used previously and this is probably why the gel didnít come out well. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>07/23/12</h2><br /><br /> SUGAR
+ïFrom 24 GusA+B0014 tubes (-) we didnít do anything. <br />
+ïFrom 4 AraC+ O+AmyE 3í  we extracted plasmid [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. <br />
+ïDigested from the 4 AraC+ O+AmyE 3í   E,X; X; P and GusA PCR with X,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br /><br />
+<h2>07/24/12</h2><br /><br /> SUGAR
+ïDigested B0014 E with X
+B0014 X with E<br />
+ïDigested AraC+ O+AmyE 3í   1,2,3,4 with E,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+<h2>07/24/12</h2><br /> METAL
+We dephosphated the B0014-E/X digestion. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Dephosphorylation_protocol | DEPHOSPHORYLATION PROTOCOL]] <br />
+>We inactivated every digestion 10 minutes at 70∫C. We ran an agarose gel at 100 volts. <br />
+We put 4 ligations: [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]] <br />
+B0014 dephosphated + E1010 <br />
+B0014 + E1010 <br />
+B0014 <br />
+B0014 dephosphated <br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/0/06/UnamgenomicsoANDcadmio07_25_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/0/06/UnamgenomicsoANDcadmio07_25_2012.jpg'  height="300" /></a>
+<div class='captionaqua'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. B0014 lisis. <br />
+. B0014 lisis. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>07/25/12</h2><br /> METAL
+At 9:30 we still didnít observe colonies of the ligation transformation. <br />
+At 1:35 20 colonies were cultivated so we could digest them (XbaI/PstI) [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/3/33/UnamgenomicsoANDcadmio07_26_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/3/33/UnamgenomicsoANDcadmio07_26_2012_1.jpg'  height="300" /></a>
+<div class='captionmorado'>
+<p class='captionInside'>1.Terminator lysis. <br />
+-4.ìB0014+E1010î 1 Lysis. <br />
+.Ladder<br />
+.E/X terminator. <br />
+, 10, 13. Lysis B0014+E1010 E digestion. <br />
+,11, 14. Lysis B0014+E1010 P digestion. <br />
+, 12,15.Lysis B0014+E1010 E/P digestion. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/9/95/UnamgenomicsoANDcadmio07_26_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/9/95/UnamgenomicsoANDcadmio07_26_2012_2.jpg'  height="300" /></a>
+<div class='captionazul'>
+<p class='captionInside'>1.1 kb ladder. <br />
+.E1010. <br />
+.B0014 Lysis. <br />
+.B0014 Lysis. <br />
+.B0014 E/X digestion. <br />
+.B0014 E/X digestion. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/2/25/UnamgenomicsoANDcadmio07_26_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/2/25/UnamgenomicsoANDcadmio07_26_2012_3.jpg'  height="300" /></a>
+<div class='captiongray'>
+<p class='captionInside'>1. RFP for extraction. <br />
+. RFP for extraction. <br />
+. 1 kb ladder. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/e/e2/UnamgenomicsoANDcadmio07_26_2012_4.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e2/UnamgenomicsoANDcadmio07_26_2012_4.jpg'  height="300" /></a>
+<div class='captiongray'>
+<p class='captionInside'>1. Extracted band. <br />
+. Extracted band. <br />
+. 1 kb ladder. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/25/12</h2><br /><br /> SUGAR
+ïRan gel of digested AraC+ O+AmyE 3í   1,2,3,4 with E,P  [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+ïJoined B0014 E with X B0014 X with E digestions. <br />
+ïMade liquid cultures from 2 days old plated GusA+B0014 and extracted plasmid [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]] [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. Transformed [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+ïFrom LasR DH5a make liquid cultures and plate [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+ïDigested  O+AmyE 3í  with X,P; E,S; C0080 X,P; E,S; S,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+ïLigated Gus PCR X,P with B0079 S,P dephosphorylated [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br /><br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/8/84/UnamgenomicsandsugarBitacora_17.jpg' height="300"/>
+<div class='captionazul'>
+<p class='captionInside'>1.O+AmyE 3í X,P<br />
+. O+AmyE 3í E,S<br />
+.C0080 X,P<br />
+.C0080 E,S<br />
+.C0080 S,P<br />
+.ladder<br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>07/26/12</h2><br /> SUGAR
+ïFrom C0179 (LasR) transformation which grew colonies, we made two liquid cultures: DH5a C0179 LB Cb 100 (two cultures) and a control without bacteria [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+ïWe extracted plasmid from 8 C0179 tubes, from 2 tubes of C0179 (Miguelís transformation), Puc, B.S. control and PSB4AE [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. <br />
+ïDue to problems with the way we did the transformations of ligations we repeated them: <br />
+GusAPCR X,P+ B0079 S,P dephosphorylated<br />
+GusAPCR X,P+ B0079 S,P dephosphorylated (-)<br />
+GusAPCR X,P+ A3 S,P dephosphorylated<br />
+GusAPCR X,P+ A3 S,P dephosphorylated (-)<br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+ïDid the following digestions [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+ïAraC+ O+AmyE 3í   S,P 1,2,3,4<br />
+ïK143002 X,P<br />
+ïAraC+ O S,P<br />
+ïC0179 X,S<br />
+<h2>07/26/12</h2><br /> METAL
+In the previous gel we observed that cultures grown were actually re-ligated vectors. <br />
+We need to put ligations again. <br />
+>E1010 doesnít look as it should, weíll extract from band. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | GEL EXTRACTION PROTOCOL]]<br />
+We ligated B0014+E1010 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/8/86/UnamgenomicsoANDcadmio07_27_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/8/86/UnamgenomicsoANDcadmio07_27_2012.jpg'  height="300" /></a>
+<div class='captionrojo'>
+<p class='captionInside'>1. 1 kb Ladder. <br />
+. RFP E1010 purified. <br />
+. RFP E1010 purified. <br />
+>We now have LasR. <br /></p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>07/27/12</h2><br /> METAL
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/27/12</h2><br /><br /> SUGAR
+Ligated AraC+ O S,P dephosphorylated + K143002 X,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+<h2>07/30/12</h2><br /><br /> SUGAR
+ïTransformed with ligations: <br />
+ïAraC+ O  dephosphprylated +K143002 X,P<br />
+ïGusAPCR X,P+ A3 S,P dephosphorylated<br />
+ïGusAPCR X,P+ B0079 S,P dephosphorylated<br />
+ïTransformed the following sythesis: <br />
+ï91996 Pveg	140 bp<br />
+ï91997 ArsR-CzrA_promoter 1	194 bp<br />
+ï91998 ArsR-CzrA_promoter 2	221 bp<br />
+ï91999 ArsR-CzrA_promoter 3	213 bp<br />
+ï92000 pBad-pXyl			387 bp<br />
+ï92001 XylR				1117pb<br />
+ï92002 CI_pro_(NAND_INHIBITOR)	774 <br />
+ïThese synthesis come in pJ209 and supposedly come with Chloramphenicol+ and Gentamicin+ resistance, but we discovered that only Chloramphenicol worked.
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]. <br />
+ïMake liquid cultures of the following transformations for tomorrow [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]: <br />
+ïAraC+ O+K143002 <br />
+ïGusA+A3<br />
+ïGusA+B0079<br />
+ïSynthesis<br />
+<h2>07/30/12</h2><br /> METAL
+>We transformed the ligations. <br />
+E1010+B0014 dephosphated. <br />
+E1010+B0014. <br />
+B0014 dephosphated. <br />
+B0014. <br />
+Negative Control. <br />
+<br />
+<br />
+<br />
+<br />
+<h2>07/31/12</h2><br /> METAL
+The colonies from the transformation grew well, though we believe the dephosphatase isnít working properly. <br />
+We took 103 colonies and put 18 cultures to do the alkaline lysis. <br />
+<br />
+<br />
+<h2>07/31/12</h2><br /><br /> SUGAR
+Extracted plasmids from yesterdayís cultures and from K143002 cultures that were in the other lab [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. <br />
+<br />
+<br />
+=AUGUST=
+<h2>08/01/12</h2><br /><br /> SUGAR
+Digested XylR 01 X,P; pBAD-pXyl X,P; Pveg 96 S,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br /><br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/b/b1/UnamgenomicsandsugarBitacora_17.1.jpg' height="300"/>
+<div class='captiongray'>
+<p class='captionInside'>1 PCR GusA I<br />
+PCR GusA I<br />
+PCR GusA P<br />
+PCR GusA P<br />
+ladder 1 Kb<br /></p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/6/6f/UnamgenomicsoANDcadmio08_01_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/6/6f/UnamgenomicsoANDcadmio08_01_2012.jpg'  height="300" /></a>
+<div class='captionnaranja'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+-18 E1010+B0014 lysis colony 1-17<br />
+. Terminator lysis <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<br />
+<br />
+<br />
+<h2>08/01/12</h2><br /> METAL
+We digested with XbaI and PstI colonies 3,5,8,9,14. <br /> [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/4/4a/UnamgenomicsoANDcadmio08_02_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/4/4a/UnamgenomicsoANDcadmio08_02_2012.jpg'  height="300" /></a>
+<div class='captionverde'>
+<p class='captionInside'>1.1 kb ladder. <br />
+, 5,8,11,14. XbaI/PstI. <br />
+,6,9,12,15. XbaI. <br />
+,7,10,13,16. PstI. <br />
+.--------------<br />
+.B0014 X<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/02/12</h2><br /> METAL
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/c/c3/UnamgenomicsoANDcadmio08_03_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/c/c3/UnamgenomicsoANDcadmio08_03_2012_1.jpg'  height="300" /></a>
+<div class='captionrosa'>
+<p class='captionInside'>1. CI lysis. <br />
+. 97 lysis. <br />
+. 98 lysis. <br />
+. 99 lysis. <br />
+. 1 kb ladder. <br />
+. RFP lysis. <br />
+. Terminator lysis. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/9/99/UnamgenomicsoANDcadmio08_03_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/9/99/UnamgenomicsoANDcadmio08_03_2012_2.jpg'  height="300" /></a>
+<div class='captionaqua'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+,5 ,8 ,11. E1010+B0014 EcoRI. <br />
+, 9. E1010+B01014 XbaI. <br />
+, 10. E1010+B0014 EcroRI/XbaI. <br />
+, 12. E1010+B0014 PstI. <br />
+, 13. E1010+B0014 PstI/EcoRI. <br />
+, 15. P4. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/5/5b/UnamgenomicsoANDcadmio08_03_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/5/5b/UnamgenomicsoANDcadmio08_03_2012_3.jpg'  height="300" /></a>
+<div class='captionmoradoclaro'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+, 5. 02 CI EcoRI. <br />
+. 02 CI XbaI. <br />
+. 02 CI EcroRI/XbaI. <br />
+. 02 CI PstI. <br />
+. 02 CI PstI/EcoRI. <br />
+. 97 CZrA_ArsR EcoRI. <br />
+. 97 CZrA_ArsR PstI<br />.
+. 97 CZrA_ArsR EcoRI/PstI. <br />
+. 98 CZrA_ArsR EcoRI. <br />
+. 98 CZrA_ArsR PstI. <br />
+. 98 CZrA_ArsR EcoRI/PstI. <br />
+. 99 CZrA_ArsR EcoRI. <br />
+. 99 CZrA_ArsR PstI. <br />
+. 99 CZrA_ArsR EcoRI/PstI. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/02/12</h2><br /><br /> SUGAR
+ïExtracted plasmids from liquid cultures[PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]: <br />
+AraC+ O+K143002 <br />
+ïGusA+A3<br />
+ïGusA+BBR1<br />
+PCR GusA, GusA I, PCR GusA P, PCR GusA I<br />
+ïAdd 10 µl  of each primer (LW and UP). <br />
+ïAdd 3 µl  of plasmid (P). <br />
+ïAdd 30.4 µl   buffer. <br />
+ïAdd 5 µl   Mg. <br />
+ïAdd 8 µl   DNTpís. <br />
+ïAdd 42.6µl   H2O miliQ. <br />
+ïAdd 1 µl   RTTG polymerase. <br />
+ïCentrifuge (spin) 8 secs. <br />
+ïAdd mineral oil till the eppendorf is full. <br />
+ïPlace eppendorf 1 mL in thermocycler. <br />
+ïRun PCR with program ìBERNAî. <br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/8/82/UnamgenomicsandsugarBitacora_18.jpg' height="300"/>
+<div class='captionnaranja'>
+<p class='captionInside'>1.GusA PCR 1<br />
+.GusA PCR 2<br />
+.A3+GusA 1<br />
+.A3+GusA 2<br />
+.A3+GusA 3<br />
+.P GusA<br />
+.P GusA 2<br />
+.Ladder<br />
+.01<br />
+.06<br />
+.96<br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<br />
+<br />
+<h2>08/03/12</h2><br /><br /> SUGAR
+ï Ran a gel with: (18) <br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . <br />
+ïRan another gel to extract with: <br />
+.GusA PCR 1<br />
+.GusA PCR 2<br />
+.00<br />
+.01<br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . <br />
+ïDid the following digestions [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]: <br />
+ï O+K143002  E,X; A3+GusA E,S; GusAPCR X,P <br />
+ïExtracted GusAPCR X,P  digestion [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | LIQUID CULTURE]]. <br />
+ïLeft the following ligation: AraC+ O+K143002  [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br /><br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/1/17/UnamgenomicsandsugarBitacora_19.jpg' height="300"/>
+<div class='captionrojo'>
+<p class='captionInside'>1.A3+GusA 2<br />
+.A3+GusA 3<br />
+. O+AmyE 3í 2<br />
+. O+AmyE 3í 3<br />
+.XylR X,P<br />
+.pBad-pXyl X,P<br />
+.GusA PCR X,P<br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>08/03/12</h2><br /> METAL
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/e/ed/UnamgenomicsoANDcadmio08_07_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/e/ed/UnamgenomicsoANDcadmio08_07_2012_1.jpg'  height="300" /></a>
+<div class='captionmorado'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. LasR PCR (-).<br />
+. LasR 1 PCR. <br />
+. LasR 2 PCR. <br />
+. P4 PCR (-).<br />
+. P4 PCR. <br />
+. P4 purification. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/f/f9/UnamgenomicsoANDcadmio08_07_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/f/f9/UnamgenomicsoANDcadmio08_07_2012_2.jpg'  height="300" /></a>
+<div class='captionazul'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. LasR (-).<br />
+. LasR PCR. <br />
+. LasR PCR. <br />
+. P4 PCR<br />.
+. Purified P4. <br />
+We ligated CI+P4 and plated in Cm25. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/06/12</h2><br /><br /> SUGAR
+ïMade liquid cultures of  O+K143002   (2 cultures+1 control) and AraC+ O+K143002  (2 cultures+1 control) [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+ïLigated GusAPCR X,P+B0079 S,P dephosphorylated [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+ïRan a Gel with: (19) <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/8/8b/UnamgenomicsandsugarBitacora_19.1.jpg' height="300"/>
+<div class='captionverde'>
+<p class='captionInside'>Digested 14 tubes of AraC+ O+AmyE 3í  E,P <br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>08/07/12</h2><br /> METAL
+>P4 Purification. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/0/0c/UnamgenomicsoANDcadmio08_08_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/0/0c/UnamgenomicsoANDcadmio08_08_2012.jpg'  height="300" /></a>
+<div class='captiongray'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. CI 02 EcoRI. <br />
+. 02 CI XbaI. <br />
+. 02 CI EcroRI/XbaI. <br />
+. CI 02 EcoRI/XbaI dephosphated. <br />
+. P4 E/S. <br />
+. P4 PCR. <br />
+. P4 PCR (-).<br />
+. LasR 1 PCR. <br />
+. LasR 2 PCR. <br />
+. LasR PCR from yesterday. <br />
+. LasR PCR (-).<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/08/12</h2><br /> METAL
+We ligated CI+P4 and plated in Cm25. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]] <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/a/a4/UnamgenomicsoANDcadmio08_09_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/a/a4/UnamgenomicsoANDcadmio08_09_2012_1.jpg'  height="300" /></a>
+<div class='captionnaranja'>
+<p class='captionInside'>1.	LasR 1 PCR. <br />
+.	LasR dephosphated (*) PCR. <br />
+.	1 kb Ladder. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/8/89/UnamgenomicsoANDcadmio08_09_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/8/89/UnamgenomicsoANDcadmio08_09_2012_2.jpg'  height="300" /></a>
+<div class='captionnaranja'>
+<p class='captionInside'>1. 1 kb ladder. <br />
+. Purified LasR 1. <br />
+. Purified LasR *.<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/08/12</h2><br /> SUGAR
+BBa_B0040 	6I	psB1A2	Amp+		plate 1<br />
+Digested 14 tubes of AraC+ O+AmyE 3í  E,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. (19.1) <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>08/09/12</h2><br /> SUGAR
+ïFrom yesterdayís PCRís : <br />
+ï E0040 plasmid 1<br />
+E0040 plasmid 2<br />
+E0040 digested 1<br />
+E0040 digested 2<br />
+We purified with PCR kit<br />
+ïRan  a gel [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . <br />
+ïMade 14 PCRís from AraC+ O+AmyE 3í. <br />
+ïFrom B0079+GusA ligation and B0040 transformation:
+ïGrew colonies. <br />
+ïMade liquid cultures [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+ïStreaked these in a new plate. <br />
+ïDiluted plasmid E0080 2 1/50. <br />
+<br />
+<br />
+<h2>08/09/12</h2><br /> METAL
+>We transformed the CI+P4 ligation in DH5a and plated it in Cm25. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]¨. <br />
+>We purified LasR PCRs so we could have linear LasR. <br />
+We digested LasR* with EcoRI and SpeI. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br />
+We ligated CI+LasR. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/2/2a/UnamgenomicsoANDcadmio08_10_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/2/2a/UnamgenomicsoANDcadmio08_10_2012.jpg'  height="300" /></a>
+<div class='captionrojo'>
+<p class='captionInside'>1.	1 kb ladder. <br />
+.	CI EcoRI/XbaI. <br />
+.	LasR EcoRI/SpeI. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/10/12</h2><br /> METAL
+We plated CI+LasR ligation in Cm25. <br />
+>We only obtained colonies in the CI+LasR plates and not in the CI. <br />
+> We put cultures so we could then do the P4+CI and CI+LasR lysis. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>08/13/12</h2><br /> SUGAR
+ïAfter running a gel with 14 PCRís AraC+ O+AmyE 3í  and it did not come out as expected, we ran a gel with the ligation AraC+ O+AmyE 3í to select candidate (that weight the same as the ligation) [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] : (20) <br />
+ïExtracted pasmids form liquid cultures: B0049, B0079+GusA [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. <br />
+ïAraC+ O+AmyE 3í  undigested didnít run in the gel as expected, it ran similarly to AraC+ O<br />
+ï We repeated the ligation AraC+ O S,P dephosphorylated+K143002 X,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+ï	GFP PCR gel came out with two bands one is GFP and the other one are the primers, even after purifying by kit. We joined 2 GFP PCR tubes.
+ï	We ran a gel to extract. <br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/f/f1/UnamgenomicsandsugarBitacora_22.jpg' height="300"/>
+<div class='captionaqua'>
+<p class='captionInside'>1.6 AraC+ O+AmyE 3í  E  with P. <br /><br />
+.8 AraC+ O+AmyE 3í  E  with P. <br />
+.11 AraC+ O+AmyE 3í  E  with P. <br />
+.12 AraC+ O+AmyE 3í  E  with P. <br />
+.6 AraC+ O+AmyE 3í  with E,X. <br />
+.8 AraC+ O+AmyE 3í  with E,X. <br />
+.11 AraC+ O+AmyE 3í  with E,X. <br />
+.12 AraC+ O+AmyE 3í  with E,X. <br />
+.00 pBad/pXyl with S,P. <br />
+.Ladder. <br />
+.E0040 PCR E,S to extract the correct band. <br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>08/13/12</h2><br /> METAL
+>We did CI+P4 and CI+LasR lysis by miniprep. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Lysis_protocol | Lysis protocol]]. <br />
+> We digested the lysis to free the fragment with EcoRI, EcoRI/PstI, PstI.  [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]]. <br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/e/e0/UnamgenomicsoANDcadmio08_14_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e0/UnamgenomicsoANDcadmio08_14_2012.jpg'  height="300" /></a>
+<div class='captionverde'>
+<p class='captionInside'>1.  CI+P4 1 EcoRI<br />
+.  CI+P4 1 PstI<br />
+.  CI+P4 1  EcoRI/Pst<br />I
+.  CI+P4 2 EcoRI<br />
+.  CI+P4 2 PstI<br />
+.  CI+P4 2 EcoRI/PstI<br />
+.  CI+P4 3 EcoRI<br />
+.  CI+P4 3 PstI<br />
+.  CI+P4 3 EcoRI/PstI
+.  CI+P4 4 EcoRI<br />
+.  CI+P4 4 PstI<br />
+. CI+P4 4 EcoRI/PstI<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<h2>08/14/12</h2><br /> METAL
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/1/1e/UnamgenomicsoANDcadmio08_15_2012.jpg'><img src='https://static.igem.org/mediawiki/2012/1/1e/UnamgenomicsoANDcadmio08_15_2012.jpg'  height="300" /></a>
+<div class='captionrosa'>
+<p class='captionInside'>1.1 kb ladder. <br />
+-17.P4CI lysis. <br />
+.CI lysis 02. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/e/e4/UnamgenomicsoANDcadmio08_15_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e4/UnamgenomicsoANDcadmio08_15_2012_2.jpg'  height="300" /></a>
+<div class='captionmoradoclaro'>
+<p class='captionInside'>1.1 kb ladder. <br />
+.LasR CI lysis 5<br />
+.LasR CI lysis 6 <br />
+.LasR CI lysis 8<br />
+.LasR CI lysis 9 <br />
+.LasR CI lysis 10<br />
+.CI lysis 02<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/15/12</h2><br /> METAL
+We did lysis of the rest of the colonies for the P4CI  and LasRCI ligation. <br />
+>From these lysis we left digestions with EcoRI and PstI. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br />
+We put digestions for these lysis with E/P. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/d/d7/UnamgenomicsoANDcadmio08_16_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/d/d7/UnamgenomicsoANDcadmio08_16_2012_1.jpg'  height="300" /></a>
+<div class='captionmorado'>
+<p class='captionInside'>
+.	1 kb ladder. <br />
+-17.	P4CI EcoRI/PstI Diferent colonies<br />
+.	CI02 EcoRI<br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/0/0e/UnamgenomicsoANDcadmio08_16_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/0/0e/UnamgenomicsoANDcadmio08_16_2012_2.jpg'  height="300" /></a>
+<div class='captionazul'>
+<p class='captionInside'>
+.	1 kb ladder. <br />
+.	LasRCI EcoRI 5. <br />
+.	LasRCI EcoRI 6. <br />
+.	LasRCI EcoRI 8. <br />
+.	LasRCI EcoRI 9. <br />
+.	LasRCI EcoRI 10. <br />
+.	CI. <br />
+.	  - <br />
+.	E/X digested Dephosphated CI. <br />
+.	E/X digested CI. <br />
+.	E/S digested LasR. <br />
+.	E/S P4. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/16/12</h2><br /> METAL
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/e/e0/UnamgenomicsoANDcadmio08_17_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/e/e0/UnamgenomicsoANDcadmio08_17_2012_1.jpg'  height="300" /></a>
+<div class='captiongray'>
+<p class='captionInside'>
+.P4CI lysis with kit 7. <br />
+.P4CI lysis with kit 7. <br />
+.P4CI lysis with kit 7. <br />
+.1 kb ladder. <br />
+.AmyE 5í lysis from kit 1. <br />
+.AmyE 5í lysis from kit 2. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/2/28/UnamgenomicsoANDcadmio08_17_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/2/28/UnamgenomicsoANDcadmio08_17_2012_2.jpg'  height="300" /></a>
+<div class='captionnaranja'>
+<p class='captionInside'>
+.1 kb ladder. <br />
+.97 Promoter XbaI/PstI. <br />
+.98 Promoter XbaI/PstI. <br />
+.99 Promoter XbaI/PstI. <br />
+.AmyE 5í lysis 1. <br />
+.AmyE 5í lysis 2. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/16/12</h2><br /> SUGAR
+ïRan a gel with yesterdayís digestions [GEL ELECTROPHORESIS (22)PROTOCOL]: <br />
+ïDigested: <br />
+ArSR-CzrA 97 with S,P<br />
+ArSR-CzrA 98 with S,P<br />
+ArSR-CzrA 99 with S,P<br />
+E0040 PCR with E,S<br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | Digestion Protocol]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>08/17/12</h2><br /> METAL
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/7/75/UnamgenomicsoANDcadmio08_20_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/7/75/UnamgenomicsoANDcadmio08_20_2012_1.jpg'  height="300" /></a>
+<div class='captionrojo'>
+<p class='captionInside'>
+.1 kb ladder. <br />
+.97 promoter XbaI/PstI. <br />
+.98 promoter XbaI/PstI. <br />
+.99 promoter XbaI/PstI. <br />
+.P4CI EcoRI/SpeI. <br />
+.P4CI EcoRI/SpeI. <br />
+.P4CI SpeI. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/5/5d/UnamgenomicsoANDcadmio08_20_2012_2.jpg'><img src='https://static.igem.org/mediawiki/2012/5/5d/UnamgenomicsoANDcadmio08_20_2012_2.jpg'  height="300" /></a>
+<div class='captionverde'>
+<p class='captionInside'>
+.	1 kb ladder. <br />
+-8.	LasRCI * lysis. <br />
+.	CI lysis. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/d/d7/UnamgenomicsoANDcadmio08_20_2012_3.jpg'><img src='https://static.igem.org/mediawiki/2012/d/d7/UnamgenomicsoANDcadmio08_20_2012_3.jpg'  height="300" /></a>
+<div class='captionrosa'>
+<p class='captionInside'>
+-8.	LasR E/S lysis. <br />
+.	1 kb Ladder. <br />
+.	 -----<br />
+.	P4CI EcoR<br />I.
+.	P4CI PstI. <br />
+.	P4CI EcoRI/PstI. <br />
+.	P4CI EcoRI/PstI. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/20/12</h2><br /> METAL
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<a href='https://static.igem.org/mediawiki/2012/0/09/UnamgenomicsoANDcadmio08_21_2012_1.jpg'><img src='https://static.igem.org/mediawiki/2012/0/09/UnamgenomicsoANDcadmio08_21_2012_1.jpg'  height="300" /></a>
+<div class='captionaqua'>
+<p class='captionInside'>
+. P4CI BcuI/EcoRI<br />
+. 1 kb ladder. <br />
+. LasRCI * lysis 2. <br />
+. LasRCI * lysis 3. <br />
+. LasRCI * lysis 4. <br />
+. LasRCI lysis 4. <br />
+. LasRCI lysis 6. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/7/71/UnamgenomicsoANDcadmio08_21_2012_2.jpg'  height="300" />
+<div class='captionmoradoclaro'>
+<p class='captionInside'>
+. 1 kb ladder. <br />
+. LasRCI * lysis 2. <br />
+. LasRCI * lysis 3. <br />
+. LasRCI * lysis 4. <br />
+. LasRCI lysis 4. <br />
+. LasRCI lysis 6. <br />
+. CI lysis. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<br />
+<h2>08/20/12</h2><br /> SUGAR
+ïLigated B0079 S,P dephosphorylated + GusA PCR X,P and pVeg S,P dephosphorylated + XylR X,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+<h2>08/21/12</h2><br /> SUGAR
+ïJoined both .6 ml tubes of B0014 EX and B0014 XE in one and dephosphorylated [DEPHOSPHORYLATION PROTOCOL]. <br />
+ïExtracted plasmid from the 24 tubes of of ligation K143001+pBad/pXylR [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. <br />
+ïDigested  O+AmyE 3í  with E,X and + O+AmyE 3í  II with E,X (obtained these two from glycerols stored at -80∫C [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/2/29/UnamgenomicsandsugarBitacora_22.1.jpg' height="300"/>
+<div class='captionmoradoclaro'>
+<p class='captionInside'>Digested K143001+PBad, pXyl with E,S <br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/1/1c/UnamgenomicsandsugarBitacora_23.jpg' height="300"/>
+<div class='captionmorado'>
+<p class='captionInside'>1.K143001+PBad, pXyl  E,S 10<br />
+.K143001+PBad, pXyl  E,S 11<br />
+.K143001+PBad, pXyl  E,S 12<br />
+.A3 PCR<br />
+.A3 PCR<br />
+.E0040 PCR E,S<br />
+.B0014 E,X dephosphorylated<br />
+. O+AmyE 3í  E,X <br />
+. O+AmyE 3í  E,X II<br />
+.Ladder
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>08/21/12</h2><br /> METAL
+>We decided to use BcuI instead of SpeI because SpeI is not working properly. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/b/b8/UnamgenomicsoANDcadmio08_22_2012.jpg'  height="300" />
+<div class='captionmoradoclaro'>
+<p class='captionInside'>
+.1 kb ladder. <br />
+.B0014/E1010 * ExoRI/XbaI. <br />
+.B0014/E1010  ExoRI/XbaI. <br />
+.P4CI EcoRI/BcuI. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/22/12</h2><br /> METAL
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/8/8f/UnamgenomicsoANDcadmio08_23_2012.jpg'  height="300" />
+<div class='captionmoradoclaro'>
+<p class='captionInside'>
+.LasR PCR. <br />
+.1 kb ladder. <br />
+.LasR PCR. <br />
+.LasR PCR. <br />
+.LasR * PCR. <br />
+.LasR control PCR. <br />
+.97 promoter XbaI/PstI. <br />
+.97 promoter XbaI/PstI. <br />
+.1 kb ladder. <br />
+.99 promoter X/P. <br />
+-18.LasRCI 1 lysis. <br />
+.1 kb ladder.
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/22/12</h2><br /> SUGAR
+ïWe did 2 PCRís for A3  [PCR PROTOCOL]. <br />
+ïDigested K143001+PBad, pXyl with E,S <br /> [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. (22.1) <br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] . <br />
+ïDid band extraction of: <br />
+. K143001+PBad, pXyl  E,S 10<br />
+.K143001+PBad, pXyl  E,S 11<br />
+.K143001+PBad, pXyl  E,S 12<br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | LIQUID CULTURE]]. <br />
+ïMade liquid cultures from E1010+Boo14 that the other lab gave us and did 2 plates for glycerol Km+ [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]] <br /> [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#GLYCEROL_PROTOCOL | GLYCEROL PROTOCOL]] . <br />
+ïDid 2 plates for glycerol of both K143001+pBad/pXyl 10y11 Km+ and AraC+ O+AmyE 3í  6,8,11,12 Km+ and Spectinomycin+ [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#GLYCEROL_PROTOCOL | GLYCEROL PROTOCOL]] . <br />
+ïTransformed ligations: <br />
+B0079+GusA Amp+<br />
+Pveg+XylR Chloramphenicol+
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]].. <br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/7/78/UnamgenomicsandsugarBitacora_23.01.jpg' height="300"/>
+<div class='captionazul'>
+<p class='captionInside'>1. O+AmyE 3í  E,X 6.2<br />
+.O+AmyE 3í  II E,X<br />
+.97 ArsR-CzrA<br />
+.98 ArsR-CzrA<br />
+.99 ArsR-CzrA
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>08/23/12</h2><br /> SUGAR
+ïThe negative controls were contaminated. We didnít manipulate the ones that had grown because of this. <br />
+ïRan gel with [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] : (23.01) <br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | Digestion Protocol]]. <br />
+<h2>08/23/12</h2><br /> METAL
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/e/ed/UnamgenomicsoANDcadmio08_24_2012_1.jpg'  height="300" />
+<div class='captionmorado'>
+<p class='captionInside'>
+.	 -<br />
+-9.	LasRCI digestions EcoRI/PstI. <br />
+.	1 kb ladder. <br />
+.	LasR 1 purification<br />.
+.	LasR 1 putification. <br />
+.	LasR 1 purification. <br />
+.	LasR purification from PCR which was done twice in the same batch. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/3/33/UnamgenomicsoANDcadmio08_24_2012_2.jpg'  height="300" />
+<div class='captionazul'>
+<p class='captionInside'>
+.LasRCI 1. <br />
+.1 kb Ladder. <br />
+.LasRCI 2. <br />
+.LasRCI 3. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/24/12</h2><br /> METAL
+>We repeated LasR PCR but it didnít work. <br />
+>We ligated RFP terminatr (E1010+B0014)+P4+CI(97/98/99) amyE 5í.[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]] <br />
+> We transformed this ligation. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]]
+<h2>08/24/12</h2><br /> SUGAR
+From plate with ligation E0040+B0014, ligation K143001+pBad,pXyl 10 and 11, and ligation AraC+ O+AmyE 3í  6 and 8  we streaked 2 plates for glycerol of each ligation. <br />Repeated ligation B0079+GusA. <br />
+Ligated E0040 PCR E,S+B0014 E,X dephospohylated [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+Made 2 new plates from Pveg+XylR ligation and liquid cultures [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+<h2>08/25/12</h2><br /> SUGAR
+Extracted pellet from 16 tubes of pVeg+XylR that were left overnight [PLASMID  EXTRACTION (ìsoftî lysis) PROTOCOL]. <br />
+Ligated B0079+GusA and B0040+B0014 [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+<h2>08/25/12</h2><br /> METAL
+We removed the plates from 37∫C. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>08/26/12</h2><br /> METAL
+We plated the colonies from the ligation P4CI+E1010+B0014 in Km30. We put liquid cultures of LB Km30 so we can do the lysis. <br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/d/d3/UnamgenomicsoANDcadmio08_27_2012.jpg'  height="300" />
+<div class='captiongray'>
+<p class='captionInside'>
+.	1 kb ladder. <br />
+-19.	P4CI+E1010B0014 lysis. <br />
+.	E1010B0014 lysis. <br />
+.	1 kb ladder. <br />
+-39.	P4CI+E1010B0014 lysis. <br />
+.	E1010B0014 lysis. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/27/12</h2><br /> METAL
+We did alkaline lysis [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Lysis_protocol | LYSIS PROTOCOL]] of P4CI+E1010B0014. <br />
+>We did digestions of the lysis with EcoRI and PstI [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/0/0b/UnamgenomicsoANDcadmio08_28_2012_1.jpg'  height="300" />
+<div class='captiongray'>
+<p class='captionInside'>
+.1 kb ladder. <br />
+- 19.AmyE 5í 97 E1010 B0014 lysis E/P digestion. <br />
+.AmyE 5í lysis<br />
+.1 kb ladder. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/1/1d/UnamgenomicsoANDcadmio08_28_2012_2.jpg'  height="300" />
+<div class='captionnaranja'>
+<p class='captionInside'>
+.1 kb ladder. <br />
+.LasR digested with E/S. <br />
+.CI digested with E/X. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/7/7e/UnamgenomicsoANDcadmio08_28_2012_3.jpg'  height="300" />
+<div class='captionrojo'>
+<p class='captionInside'>
+.	1 kb ladder. <br />
+-7.	AmyE 5í 99 E/P . <br />
+-13.	AmyE 5í 97 E/P . <br />
+-19.	AmyE 5í 98 E/P . <br />
+.	AmyE 5í  E/P . <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/9/97/UnamgenomicsoANDcadmio08_28_2012_4.jpg'  height="300" />
+<div class='captionverde'>
+<p class='captionInside'>
+.1 kb ladder. <br />
+-19.P4+CI+RFPterm E/P digestion I. <br />
+.RFPterm E/P digestion. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>08/28/12</h2><br /> METAL
+We ligated LasRCI at 20 µl. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/2/27/UnamgenomicsoANDcadmio08_29_2012.jpg'  height="300" />
+<div class='captionrosa'>
+<p class='captionInside'>
+.1 kb ladder. <br />
+-3.AmyE 5í 99 lysis from kit. <br />
+-5.AmyE 5í 98 lysis from kit. <br />
+-7.AmyE 5í 97 lysis from kit. <br />
+-11.P4 CI + E1010 B0014 Lysis from kit. <br />
+.CI 02 lysis from kit. <br />
+.AmyE 5í lysis from kit. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/28/12</h2><br /> SUGAR
+Made liquid cultures from transformations tht were left overnight
+-R0079+GusA<br />
+-R0079+GusA (-)<br />
+-E0040+B0014<br />
+-E0040+B0014 (-)<br />
+[[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Liquid_culture | LIQUID CULTURE]]. <br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/2/25/UnamgenomicsandsugarBitacora_23.1.jpg' height="300"/>
+<div class='captiongray'>
+<p class='captionInside'>1. A3 PCR 1. <br />
+. A3 PCR 2. <br />
+. O+AmyE 3í   S,P *.<br />
+. O+AmyE 3í   S,P . <br />
+. Pveg+XylR E,S 2. <br />
+. Pveg+XylR E,S 3. <br />
+. Pveg+XylR E,S 4. <br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>08/29/12</h2><br /> SUGAR
+Digested Pveg+XylR 2,3,4 with E,S. <br />
+Digested  O+AmyE 3í   with S,P [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION]]. <br />
+Ran a PCR with A3 PCR (2 .6 ml tubes) [PCR PROTOCOL]. <br />
+Ran a gel with <br /> [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] : (23.01) <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/2/2e/UnamgenomicsandsugarBitacoraBitacora_24.jpg' height="300"/>
+<div class='captiongray'>
+<p class='captionInside'>1-23.	E0040 + B0014 colonies<br />
+-29.	B0079+GusA 1<br />
+.	B0079<br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>08/29/12</h2><br /> METAL
+We transformed the LasRCI ligation previously plated on Cm25. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Transformation | TRANSFORMATION PROTOCOL]] <br />
+<br />
+We digested in  20µl with EcoRI/PstI AmyEí5 promoter lysis. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br />
+We counted and took LasRCI colonies and re-plated them. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/1/1b/UnamgenomicsoANDcadmio08_31_2012_1.jpg'  height="300" />
+<div class='captionrosa'>
+<p class='captionInside'>
+-2.	AmyE 5í 97 digestion E/P. <br />
+-4.	AmyE 5í 98 digestion E/P. <br />
+-6.	AmyE 5í 99 digestion E/P. <br />
+.	AmyE 5í  digestion E . <br />
+.	1 kb ladder. <br />
+-12.	P4CI E1010 B0014 E/P digestion I. <br />
+.	02 CI E/P. <br />
+.	1 kb ladder. <br />
+.	BcuI 99 digestion. <br />
+.	SpeI/PstI 99 digestion. <br />
+.	S/P 98 digestion. <br />
+.	S/P 97 digestion. <br /></p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/f/f0/UnamgenomicsoANDcadmio08_31_2012_2.jpg'  height="300" />
+<div class='captionaqua'>
+<p class='captionInside'>
+.	1 kb ladder. <br />
+.	Arsr-CzrA 97 promoter S/P. <br />
+.	Arsr-CzrA 98 promoter S/P. <br />
+.	Arsr-CzrA 99 promoter S/P. <br />
+</p>
+</div>
+</li>
+</ul>
+</div>
+</html>
+<h2>08/30/12</h2><br /> SUGAR
+ïRan a gel [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] : (24) <br />
+ïDigested PVeg+XylR 1,5,7,10,13,16 with E,S; E0040+B0014 3,4,5,10,11,19,21,22 with X,P; B0079+GusA 3,4,5 E,S [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | LIQUID CULTURE]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/3/3d/UnamgenomicsandsugarBitacora_25.jpg' height="300"/>
+<div class='captionnaranja'>
+<p class='captionInside'>1-3B0079+GusA E,S 3. <br />
+-9. PVeg+XylR  E,S 1. <br />
+-17. E0040+B0014 X,P 3. <br />
+. 1 kb ladder. <br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/d/d2/UnamgenomicsandsugarBitacora_26.jpg' height="300"/>
+<div class='captionrojo'>
+<p class='captionInside'>1.A3 PCR. <br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<html>
+<div class='thumbnailWrapper'>
+<ul>
+<li>
+<img src='https://static.igem.org/mediawiki/2012/7/7b/UnamgenomicsandsugarBitacora_27.jpg' height="300"/>
+<div class='captionverde'>
+<p class='captionInside'>E0040+B0014 X,P 4 to extract<br />
+</p>
+</li>
+</ul>
+</div>
+<br /><br />
+</html>
+<h2>08/31/12</h2><br /> SUGAR
+ïRan a gel [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] : (25) <br />
+ïDephosphorylated [DEPHOSPHORYLATION PROTOCOL]: <br />
+O+AmyE 3í  S,P <br />
+O+AmyE 3í  II S,P <br />
+AraC+ O+AmyE 3í  E,X<br />
+AraC+ O+AmyE 3í  E,X<br />
+AraC+ O+AmyE 3í  E,X<br />
+AraC+ O+AmyE 3í  E,X<br /><br />ïRan a gel with A3 PCR [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_electrophoresis | GEL ELECTROPHORESIS PROTOCOL]] : (26) <br />
+ïIt was the second time we didnít obtain a band from A3ís PCR.
+ïProbably because it had been missing the buffer 2ís ethanol (ìblue lidî) from the PCR purification. <br />
+ïRan a gel woth E0040+B0014 X,P 4 to extract [GEL (27) ELECTROPHORESIS PROTOCOL] <br /> [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | Gen extraction protocol]]. <br />
+ïDid an A3 PCR [PCR PROTOCOL]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<h2>08/31/12</h2><br /> METAL
+We digested the promoters with S/P to ligate it with GFP+terminator so we could characterize them.  [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Digestion_protocol_.2820_.C2.B5l.29 | DIGESTION PROTOCOL]] <br />
+We left cultures with LasRCI to make lyses. <br />
+>We ran a gel with the promoterís digestions with S/P to extract and ligate to E0040B0014. [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Ligation | LIGATION PROTOCOL]]  [[Team:UNAM_Genomics_Mexico/Notebook/Protocols#Gel_extraction_protocol | GEL EXTRACTION PROTOCOL]]. <br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />
+<br />

Team:UNAM Genomics Mexico/Notebook/CompleteNotebook

From 2012.igem.org

Revision as of 03:32, 27 September 2012

Complete Notebook

MAY

05/29/2012

05/31/2012

JUNE

06/06/2012

06/07/12

06/08/12

06/11/12

06/12/12

06/13/12

06/14/12

06/14/2012

06/15/12

06/15/12

06/18/12

06/18/12

06/19/12

06/22/12

06/25/12

06/26/12

06/27/12

06/29/12

JULY

07/02/12

07/03/12

07/04/12

07/04/2012

07/05/12

07/06/12

07/06/12

07/07/12

07/08/12

07/09/12

07/09/12

07/10/12

07/10/12

07/11/12

07/11/12

07/12/12

07/12/12

07/13/12

07/13/12

07/14/12

07/16/12

07/16/12

07/17/12

07/17/12

07/18/12

07/18/12

07/19/12

07/19/12

07/20/12

07/20/12

07/23/12

07/23/12

07/24/12

07/24/12

07/25/12

07/25/12

07/26/12

07/26/12

07/27/12

07/27/12

07/30/12

07/30/12

07/31/12

07/31/12

AUGUST

08/01/12

08/01/12

08/02/12

08/02/12

08/03/12

08/03/12

08/06/12

08/07/12