Team:University College London/LabBook/Week12

From 2012.igem.org

(Difference between revisions)

Revision as of 00:30, 27 September 2012

11.4

Monday 27.8.12

Aim: To find the right concentration of W3110 E. coli cells in LB that would be later used to streak out on the agar plates to obtain an optimal amount of colonies.

Methods: 1. The colony was inoculated the night before in 10ml of LB plus 10 ul CMP 2. The day after 5 dilutions were made from the sample 3. First solution - 1ml of the original solution & 4ml of the LB Second – 1ml of the first solution & 4ml of the LB Third – 1 ml of the second solution & 4ml of the LB Fourth – 1 ml of the third solution & 4ml of the LB Fifth – 1ml of the fourth solution & 4ml of the LB

Tuesday 28/08

Aim: (on Monday grew WNu o/n in prep for miniprep. This miniprep will be used as a template for pcr of a 2nd nuclease.

Not the synthesised staph aureus nuclease (Plan A). The Wnu Nuclease is considered our plan B.

Methods: (10ul cells, 10ul, amp, 10ml (LB). Wnu cells were obtained from a glycerol stock.

Optimal number of colonies was achieved using the fourth solution/dilution (24 colonies). Using the dilution number 4 we plated out 12 plates.

12.2

Aim - Amplify irrE from Deinococcus radiodurans.

Method

PCR Protocol

Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below

PCR Components	Volume (ul)
5x Reaction Buffer	10
25mM MgCl2	4
10mM dNTPs	1
10uM Forward primer	5
10uM Reverse primer	5
DNA Polymerase	0.25
Nuclease Free Water	24.25
Template DNA	0.5
Total Volume	0.5

Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.

PCR conditions	Temp (^oC)	Time (s)
Initial Denaturation (1 cycle)	95	30
Denaturation/Annealing/Extension (30 cycles)	95/55/72	10/25/120
Final Extension (1 cycle)	72	600
Hold	4	∞

Step 1 - Setting up PCR tubes: The table below gives the identity of the primers used for each reaction.

DNA Template	Function	Module	Primer Pair	Primer	Primer Sequence
Deinococcus radioduran colony	irrE	Salt Tolerance	STF1/ST2R	STF1	atggggccaaaagctaaagctgaagcc
			STF1/ST2R	ST2R	tcactgtgcagcgtcctgcg
			STF3/ST4R	STF3	gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc
			STF3/ST4R	ST4R	gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg
No Template (Negative Control)	N/A	Salt Tolerance	STF1/STF2	STF1	atggggccaaaagctaaagctgaagcc
No Template (Negative Control)	N/A	Salt Tolerance	STF1/STF2	ST2R	tcactgtgcagcgtcctgcg

Results:

Conclusion: We will revise the protocol to see if we can detect any bands.

@@ Line 42: / Line 42: @@
 == 12.2 ==
-when we used  diluted dinoccocus 1 10 times, second 100
+'''Aim ''' - Amplify irrE from Deinococcus radiodurans.
+'''Method'''
+<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html>
-PCR did not work. PCR was preformed using NEB high fidelity polymerase. The following reaction was set up in 50uL:
+'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction.
-All primers were prepared to a concentration of 1pmol.uL, from 100pmol.uL stocks. Primers ordered from MWG operon.
+{| class="wikitable"
+|-
+! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence
+|-
+| rowspan="4" |Deinococcus radioduran colony || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc
+|-
+|   ST2R ||tcactgtgcagcgtcctgcg
+|-
+|  rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc
+|-
+| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg
+|-
+| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc
+|-
+|   ST2R|| tcactgtgcagcgtcctgcg
+|-
+|}
-Forward primer:
-STF1: 5'-atggggccaaaagctaaagctgaagcc-3'
-Reverse primer:
+'''Results:'''
-ST2R: 5'-tcactgtgcagcgtcctgcg-3'
+{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}
-With Biobrick prefix/Suffix:
+'''Conclusion:''' We will revise the protocol to see if we can detect any bands.
-Forward primer:
-STF3  5'-gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc-3'
-Reverse primer:
-ST4R 5'-gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg-3'
-Component	20 µl Reaction	50 µl Reaction	Final Concentration
-Nuclease-free water	to 20 µl	to 50 µl
-X Phusion HF Buffer	4 µl	10 µl	1X
-mM dNTPs	0.4 µl	1 µl	200 µM
-µM Forward Primer	1 µl	2.5 µl	0.5 µM
-µM Reverse Primer	1 µl	2.5 µl	0.5 µM
-Template DNA	variable	variable	< 250 ng
-DMSO (optional)	(0.6 µl)	(1.5 µl)	3%
-Phusion DNA
-Polymerase	0.2 µl	0.5 µl	1.0 units/50 µl PCR
-.	EXP 11.4 (Repeat inocculation of nuclease + curli ligation transformations)
-Monday 27/08
-Aim: To inoculate colonies from ligation transformation plates, prepared on the 23rd and 24th of August.
-Inoculation was repeated due to no growth the first time round.
-.	EXP 12.2 (PCR for irrE)
-Monday 27/08
-Colony PCR was preformed on Deinococcus radiodurans. 5uL of colony matter was resuspended in 10uL dH2O and added to boiling water in a screw top vial,and  left to return to ambient room temperature.
-uL was used as PCR template.
-PCR was preformed using NEB high fidelity polymerase. The following reaction was set up in 50uL:
-All primers were prepared to a concentration of 1pmol.uL, from 100pmol.uL stocks. Primers ordered from MWG operon.
-Forward primer:
-STF1: 5'-atggggccaaaagctaaagctgaagcc-3'
-Reverse primer:
-ST2R: 5'-tcactgtgcagcgtcctgcg-3'
-With Biobrick prefix/Suffix:
-Forward primer:
-STF3  5'-gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc-3'
-Reverse primer:
-ST4R 5'-gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg-3'
-Component	20 µl Reaction	50 µl Reaction	Final Concentration
-Nuclease-free water	to 20 µl	to 50 µl
-X Phusion HF Buffer	4 µl	10 µl	1X
-mM dNTPs	0.4 µl	1 µl	200 µM
-µM Forward Primer	1 µl	2.5 µl	0.5 µM
-µM Reverse Primer	1 µl	2.5 µl	0.5 µM
-Template DNA	variable	variable	< 250 ng
-DMSO (optional)	(0.6 µl)	(1.5 µl)	3%
-Phusion DNA
-Polymerase	0.2 µl	0.5 µl	1.0 units/50 µl PCR
-PCR successful, band corresponding to 930bp length.
-PCR cleanup of Irre followed with Anachem PCR cleanup kit.
-Concentration determined by nanodrop: 9ng.uL-1
-<html></div>
-<div class="experiment"></div>
-<img id="12.3" src="https://static.igem.org/mediawiki/2012/5/54/Ucl2012-labbook-graph12-3.png" /><div class="experimentContent">
-</html>
 == 12.3 ==