"

From 2012.igem.org

• Home
• Team
• Wetlab
  • Overview
  • Receptor
  • Reporter
  • Snifferomyces
  • Protocols
  • Sniffer-o-meter
  • Biobricks
  • DIY Receptor Design
• Modeling
  • Overview
  • Structural Model
  • Single Cell Pathway Model
  • Pathway Model Analysis
  • Diffusion Model
  • Sensitivity-Specificity Analysis
  • Information Processing Model
• Notebook
  • Week Diary
  • Brainstorming
• Human Practice
  • Human Outreach
  • Human Practice
  • Publicity
  • Games
  • Ethics
  • Safety
• More
  • Crowdfunding
  • Acknowledgments
  • Collaboration
  • Achievements
• Contact

Knock out GPA1

Setup

• Yeast Transformation
  
• PCR
  
• DNA gel

Outcome

For making a functional knockout, yeast strains BY4741; Mat a; his3D1; leu2D0; met15D0; ura3D0; YJL157c::kanMX4 and BY4741; Mat a; his3D1; leu2D0; met15D0; ura3D0; YHR005c::kanMX4 were used (Euroscarf). Also knockout cassette pUG72 is used (Euroscarf). The LoxP-Ura-LoxP is elongated using the pFx polymerase protocol. The PCR program and primer sequences in table 1 yielded a product which is put on a gel shown in figure 1. Here a band can be recognized between 2000 and 1500 nucleotides, which corresponds to the 1669 nucleotide PCR product.

Table 1 PCR program for elongation of knockout cassette for knocking GPA1 and primers used for elongation.

Repeats	Temperature		Duration
5x	95	Melting	2:00
	51	Annealing	1:00
	68	Elongation	2:00
25x	95	Melting	2:00
	61	Annealing	1:00
	68	Elongation	2:00

GPA ko fw TTAGCATCACATCAATAATCCAGAGGTGTATAAATTGATATATTAAGGTAGGAAATAATGCAGCTGAAGCTTCGTACGC

GPA ko rv TGCATCTTCGGAAACAGAATTTACGTATCTAAACACTACTTTAATTATACAGTTCCTTCAGCATAGGCCACTAGTGGATCTG

GPA ko fw short TAATCCAGAGGTGTATAAATTGATATATTAAGGTAGGAAATAATGCAGCTGAAGCTTCGTACGC

GPA ko rv short AGAATTTACGTATCTAAACACTACTTTAATTATACAGTTCCTTCAGCATAGGCCACTAGTGGATCTG

Figure 1: 1% agarose in TAE ~45 run on 80 Volts. In the picture can be seen: 1 SmartLadder, 2 FAR1 short PCR product, 3 FAR1 long PCR product, 4 GPA1 short PCR product, 5 GPA1 long PCR product.

Yeast strain BY4741; Mat a; his3D1; leu2D0; met15D0; ura3D0; YJL157c::kanMX4 is transformed with the GPA1 ko PCR product, according to the yeast transformation protocol. 100 ng of DNA is used for transformation. After 3 days 3 colonies could be seen on the plate. There where zero colonies on the control plate.
To check whether the knock-out reaction is successful primers A and D bind to 5’ upstream and 3’ downstream regions of the GPA1 gene, the B and C primers anneal in the URA gene which is knocked in.
Cultures of colony 2 and wildtype yeast where grown in YPG (YP+2% glucose) overnight for chromosomal extraction using the MO BIO chromosomal extraction kit (protocol). A PCR reaction was performed on extracted genomic DNA of the grown strains, using an annealing gradient of 45, 55 and 65 C and 15 ng or 30 ng template DNA. Reactions AD, AB and CD where performed according to the conditions summarized in table 11. PCR product is put on gel and shown in figure 5. Here can be seen that colony 2 (B) shows both expected band length in the AB and CD reactions, but no bands in the AD reaction.

Table 11 Taq PCR conditions for KO check.

Repeats	Temperature		Duration
	94	Melting	4:00
35x	94	Melting	0:30
	45/55/65	Annealing	0:40
	72	Elongation	2:15
	72	Elongation	10:00

GPA1 A conf CGTCCTTCTGCGTATTCTTCC

GPA1 D conf CCGAGTATTTACCAGGGAGAAG

KO B CGCCAAGGGTAGAGATCCTAAG

KO C CTTCACGCAGGATGACAGTTC

Figure 5: 1% agarose gel in TAE, 40 min run on 100 V. PCR products of Genomic extracted DNA. Colony 1 (A), Colony 2 (B), and Colony 3 (C) are shown. In the picture can be seen: 1 DNA Smarladder, 2 AD reaction with 15 ng template and 45 C, 3 AD reaction with 15 ng template and 55 C, 4 AD reaction with 15 ng template and 65 C, 5 AD reaction with 30 ng template and 45 C, 6 AD reaction with 30 ng template and 55 C, 7 AD reaction with 30 ng template and 65 C, 8 AB reaction with 15 ng template and 45 C, 9 AB reaction with 15 ng template and 55 C, 10 AB reaction with 15 ng template and 65 C, 11 AB reaction with 30 ng template and 45 C, 12 AB reaction with 30 ng template and 55 C, 13 AB reaction with 30 ng template and 65 C, 14 CD reaction with 15 ng template and 45 C, 15 CD reaction with 15 ng template and 55 C, 16 CD reaction with 15 ng template and 65 C, 17 CD reaction with 30 ng template and 45 C, 18 CD reaction with 30 ng template and 55 C, 19 CD reaction with 30 ng template and 65 C, 20 smartladder.

We concluded that in colony 2 GPA1 has successfully been knocked out. The following test is to transform FUS1-GFP into this double knockout deltafar1 deltagpa1 yeast and to see difference in fluorescence output when compared to deltafar1 yeast strain when induced by pheromone alpha. Expected is that due to lack of alpha subunit of the pheromone receptor, no or less light signal is detected. A full description of the process can be seen here.