Team:TU Darmstadt/Materials/tctB197
From 2012.igem.org
tctB197
Primers for the construction of a BioBrick containing the small subunit B2 of the tripartite tricarboxylate transporter family.
tctB197 BioBrick
5' BioBrick Annealing 3' fwd: gtttcttcgaattcgcggccgcttctagatgtctgattccttccaagatctggc rev: gtttcttcctgcagcggccgctactagtattacagccaccccgtttcagtcag
tctB197 RBS
Primers for the insertion of the arabinose promotor RBS site based on the sequence of BBa_J61100 and BBa_J61101.
5' 3' fwd: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGAA AGAGGGGAC AAtactagatgtctgattccttccaagatctggc rev: gtttcttcctgcagcggccgctactagtaGGGTCCTGTCTTTCttacagccaccccgtttcagtcag