Team:TU Darmstadt/Materials/tctB197
From 2012.igem.org
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K808005 tctB197]
Primers for the construction of a BioBrick containing the small subunit B2 of the tripartite tricarboxylate transporter family.
tctB197 BioBrick
5' BioBrick Annealing 3' fwd: gtttcttcgaattcgcggccgcttctagatgtctgattccttccaagatctggc rev: gtttcttcctgcagcggccgctactagtattacagccaccccgtttcagtcag
tctB197 RBS
Primers for the insertion of the arabinose promotor RBS site based on the sequence of [http://partsregistry.org/wiki/index.php/Part:BBa_J61100 BBa_J61100] and [http://partsregistry.org/wiki/index.php/Part:BBa_J61101 BBa_J61101].
5' 3' fwd: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGAA AGAGGGGAC AAtactagatgtctgattccttccaagatctggc rev: gtttcttcctgcagcggccgctactagtaGGGTCCTGTCTTTCttacagccaccccgtttcagtcag