Team:Bielefeld-Germany/Protocols

From 2012.igem.org

(Difference between revisions)
(→Primers)
 
(26 intermediate revisions not shown)
Line 1: Line 1:
{{Team:Bielefeld/Head}}
{{Team:Bielefeld/Head}}
-
<center>
+
<html>
-
=Protocols - Overview=
+
-
</center>
+
-
In this section we are going to note all protocols that the teams have used for their work.
+
        <div id=page-title>
-
<center>
+
            <span id=page-title-text>
-
{|
+
                Protocols
-
|-
+
            </span>
-
| [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Genetics General Protocols]    || Team Cloning        || Team Cultivation
+
        </div>
-
|-
+
<style type="text/css">
-
| [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/TeamActivity Team Activity Test]  || Team Immobilization || Team Substrate
+
-
|-
+
-
| Team Yeast          || Team Sequencing    || Team Modelling
+
-
|-
+
-
|}
+
-
</center>
+
 +
ul {list-style-image:none;}
 +
#bodyContent{
 +
    background-color: white;
 +
}
-
<center>
+
</style>
-
= Materials =
+
-
</center>
+
-
This is where we are going to list all our materials, devices and equipment that we have used.
+
-
==Media, buffer and other solutions==
+
<!-- navigator -->
-
===Ampicillin stock solution===
+
<div id="tab">
-
* Solubilize 100 mg mL<sup>-1</sup> Ampicillin
+
<ul style="list-style-type:none">
-
* Store at -20 °C
+
<li><a href="#1"><strong>Molecular</strong></a></li>
 +
<li><a href="#2"><strong>Production</strong></a></li>
 +
<li><a href="#3"><strong>Analytics</strong></a></li>
 +
<li><a href="#4"><strong>Immobilization</strong></a></li>
 +
<li><a href="#5"><strong>Material</strong></a></li>
 +
</ul>
 +
</div>
 +
<!-- tab panes -->
 +
<div id="panes">
-
===Chloramphenicol stock solution===
+
<div>
-
* Solubilize 20 mg mL<sup>-1</sup> Chloramphenicol in 100 % Ethanol
+
<img src="https://static.igem.org/mediawiki/2011/thumb/1/1a/Bielefeld_Silver_1.png/300px-Bielefeld_Silver_1.png"  />
-
* Store at -20 °C
+
 +
<h1>Molecular</h1>
 +
<p class="more">
 +
In this section of our protocol pages you can read more about our methods for cloning and BioBrick assembly.
 +
</p>
 +
<p>
 +
Genetic engineering is a basic tool of synthetic biology. With the help of standardized DNA building blocks (BioBricks) it is fairly easy to create new and modify existing natural systems. The methods we have used in our project to create BioBricks and to modify, mutate, transform and analyse DNA are presented in this section. Methods used: Electroporation; chemical transformation; Standard, Freiburg, Gibson and 3A BioBrick assembly; restriction analysis; colony PCR; site directed mutagenesis.
 +
</p>
 +
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Protocols/molecular_genetics">read more</a></p>
 +
</div>
 +
 +
<div>
-
===TAE buffer===
+
<img src="https://static.igem.org/mediawiki/2012/c/c1/Bielefeld2012_Production_300.jpg"  />
-
For 1 L of 50 x TAE buffer you need:
+
 +
<h1>Production</h1>
 +
 +
<p class="more">
 +
These are the protocols for the cultivations and the downstream processing.
 +
</p>
 +
 +
<p>
 +
Before one is able to work with a cell-free system based on biological material, the needed proteins have to be produced and purified first. These methods and the ones we used to characterize our generated BioBricks in vivo are presented in this section. Used methods: Cultivations in shaking flasks and in differnt bioreactor systems with a working volume up to 6L; mechanical lysis of cells, protein clean-up from lysed cells, Ni-NTA- and TALON-columns and chromatography.</p>
 +
<p> <a href="https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production">read more</a>
 +
</p>
 +
 +
</div>
-
* 242.48 g Tris
+
<div>
-
* 41.02 g Sodiumacetate
+
-
* 18.612 g EDTA
+
-
* Adjust pH to 7.8 with acetic acid
+
-
* Solve in dH<sub>2</sub>O
+
-
10 mL of the stock is diluted in 1 L dH<sub>2</sub>O for the gel electrophoresis (0.5 x TAE buffer).
+
<img src="https://static.igem.org/mediawiki/2012/6/6d/Bielefeld2012_GFP.jpg"  />
 +
 +
<h1>Analytics</h1>
 +
 +
<p class="more">
 +
Protocols for the analytical methods we used.  
 +
</p>
 +
 +
<p>
 +
DNA and proteins are very small and cannot be seen by the naked eye. To control the success and the results of your upstream and downstream processes, analytical methods are necessary that give reliable results to make DNA or proteins in any way visible for you. The analytical methods we used in our project can be found in this section. Used methods: Fluorescence measurement; SDS-PAGE; MALDI-TOF; HPLC; LC-ESI-qTOF-MS/MS; molecular beacons; extraction. </p>
 +
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics">read more</a>
 +
</p>
 +
 +
</div>
 +
<div>
-
===DNA loading buffer===
+
<img src="https://static.igem.org/mediawiki/2012/2/25/Bielefeld2012_Immo.jpeg"  />
-
* 50 % (v/v) glycerol
+
-
* 1 mM EDTA
+
<h1>Immobilization</h1>
-
* 0.1 % (w/v) bromphenol blue
+
-
* Solve in ddH<sub>2</sub>O
+
<p class="more">
 +
Protocols for the immobilization
 +
</p>
 +
<p>
 +
Immobilization offers the opportunity to develop a degradation system. Therefor we tried to find a method to immobilize the produced lacasses.
 +
For the immobilization we tried tow different methods. First silica beads, which were already available in our lab, because they were used the year before. And later CPC-(controlled pore carrier)-beads.
 +
</p>
 +
<p> <a href="https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Immobilization">read more</a>
 +
</p>
 +
 +
</div>
 +
        <div>
 +
<img src="https://static.igem.org/mediawiki/2011/2/26/Bielefeld-Germany2011-MaterialMethods300px.JPG"  />
 +
 +
<h1>Material</h1>
 +
 +
<p class="more">
 +
Chemicals, enzymes and kits we used in our lab work.
 +
</p>
 +
 +
<p>
 +
Chemical and biological reactions need defined conditions to work as expected. The chemicals, enzymes, kits, buffers and media we used in our project are listed in this section. </p>
 +
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials">read more</a>
 +
</p>
 +
 +
</div>
-
===LB media===
 
-
For 1 L of LB media:
 
-
* 10 g Trypton
+
</div>
-
* 5 g Yeast extract
+
-
* 10 g NaCl
+
-
* 12 g Agar-Agar (for plates)
+
-
* Adjust pH to 7.4
+
-
===YPD media===
 
-
For 1 L of YPD media:
 
-
* 20 g Peptone
+
<script>
-
* 10 g Yeast extract
+
$(function() {
-
* 20 g Dextrose (add 50 mL sterile stock solution (40% dextrose))
+
-
* Adjust pH to 6.5
+
 +
$("#tab ul").tabs("#panes > div", {effect: 'fade', fadeOutSpeed: 400});
 +
});
 +
</script>
 +
</html>
-
 
+
{{Team:Bielefeld/Sponsoren}}
-
==Primers==
+
-
This is a list of primers we have used.
+
-
 
+
-
{| class="wikitable"
+
-
|-
+
-
! primer name !! length !! sequence !!
+
-
|-
+
-
| pSB1C3-5aox1-f || 60 || CGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGAGATCTAACATCCAAAGACG
+
-
|-
+
-
| pSB1C3-5aox1-r || 30 || GGTGGCGGCGGGCGTTTCGAATAATTAGTT
+
-
|-
+
-
| 5aox1-mfalpha1-f || 68 || AGAAGATCAAAAAACAACTAATTATTCGAAACGCCCGCCGCCACCATGAGATTTCCTTCAATTTTTAC
+
-
|-
+
-
| 5aox1-mfalpha1-r || 20 || AGCTTCAGCCTCTCTTTTCT
+
-
|-
+
-
| mfalpha1-aarI-taox1-f || 80 || GTATCTCTCGAGAAAAGAGAGGCTGAAGCTACACGCAGGTGGTATGTATCACCTGCGTGTCTTGCTAGATTCTAATCAAG
+
-
|-
+
-
| mfalpha1-aarI-taox1-r || 20 || TAAGCTTGCACAAACGAACT
+
-
|-
+
-
| taox1-phis4-f || 60 || GTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTTATCATGCCATGGACAAGATTC
+
-
|-
+
-
| taox1-phis4-r || 20 || GGCCGCTCGAGTATTCAGAA
+
-
|-
+
-
| phis4-kozak-his4-f || 72 || AATAGTTTACAAAATTTTTTTTCTGAATACTCGAGCGGCCCCCGCCGCCACCATGACATTTCCCTTGCTACC
+
-
|-
+
-
| phis4-kozak-his4-r || 30 || TTATTATTTCTCCATACGAACCTTAACAGC
+
-
|-
+
-
| his4-3aox1-f || 60 || TCACCGCAATGCTGTTAAGGTTCGTATGGAGAAATAATAACGAGTATCTATGATTGGAAG
+
-
|-
+
-
| his4-3aox1-r || 20 || AAAACAAGATAGTGCCCCTC
+
-
|-
+
-
| 3aox1-pSB1C3-f || 60 || AGTCTGATCCTCATCAACTTGAGGGGCACTATCTTGTTTTTACTAGTAGCGGCCGCTGCA
+
-
|-
+
-
| 3aox1-pSB1C3-r || 20 || CTCTAGAAGCGGCCGCGAAT
+
-
|-
+
-
| taox-his4-f || 61 || GTACAGAAGATTAAGTGAGAAGTTCGTTTGTGCAAGCTTAAGATCTCCTGATGACTGACTC
+
-
|-
+
-
| taox-his4-r || 27 || CTCGGATCTATCGAATCTAAATGTAAG
+
-
|-
+
-
| his4-3aox1-f02 || 60 || TTATTTAGAGATTTTAACTTACATTTAGATTCGATAGATCCGAGTATCTATGATTGGAAG
+
-
|-
+
-
| his4_gi537483_f || 46 || ACGTgaattcgcggccgcttctagagAGATCTCCTGATGACTGACT
+
-
|-
+
-
| his4_gi537483_r || 41 || ctgcagcggccgctactagtaGATCTATCGAATCTAAATGT
+
-
|-
+
-
| Xcc_LAC_FW_T7 || || ACGTGAATTCGCGGCCGCTTCTAGAGtaatacgactcactatagggagagaggagaaaaATGTCATTCGATCCCTTGTC
+
-
|-
+
-
|Xcc_LAC_RV_HIS || || CTGCAGCGGCCGCTACTAGTATTATTAGTGATGGTGATGGTGATGTGCCTCCACCCGCACTT
+
-
|-
+
-
|}
+
-
 
+
-
 
+
-
 
+
-
<center>
+
-
 
+
-
=This page lists all molecular genetics protocols we use in our project=
+
-
</center>
+
-
 
+
-
 
+
-
==Yeat: Complete genome isolation==
+
-
The complete genome isolation was done with the [http://www.promega.com/resources/protocols/technical-manuals/0/wizard-genomic-dna-purification-kit-protocol/ Promega Wizard genomic DNA purification system kit].
+
-
<div style="text-align:justify;">
+
-
 
+
-
*Pellet 10 mL of over-night liquid culture grown in YPD broth in a 1.5 mL tube by centrifugation at 14,000 x g for 2 minutes.
+
-
*Remove the supernatant.
+
-
*Resuspend the cells in 90 μL of 50 mM EDTA.
+
-
*Add 10 μL of 1000u lyticase and pipet 4 times to mix.
+
-
*Incubate the sample at 37°C for 60 minutes to digest the cell wall.
+
-
*Centrifuge the sample at 14,000 × g for 2 minutes and then remove the supernatant.
+
-
*Add 300 μl of Nuclei Lysis Solution to the cell pellet and pipet to mix.
+
-
*Add 100 μl of Protein Precipitation Solution and vortex at high speed for 20 seconds.
+
-
*Let the sample sit on ice for 5 minutes.
+
-
*Centrifuge at 14,000 × g for 3 minutes.
+
-
*Transfer the supernatant containing the DNA to a clean 1.5 ml tube containing 300 μl of room temperature isopropanol.
+
-
*Gently mix by inversion until the DNA is visible.
+
-
*Centrifuge at 14,000 × g for 2 minutes.
+
-
*Carefully decant the supernatant and drain the tube on clean absorbent paper.
+
-
*Add 300 μl of room temperature 70% ethanol and invert the tube several times to wash the DNA pellet.
+
-
*Centrifuge at 14,000 × g for 2 minutes.
+
-
*Drain the tube on clean absorbent paper and allow the pellet to air-dry for 15 minutes.
+
-
*Add 50 μl of DNA Rehydration Solution.
+
-
*Add 1.5μl of RNase Solution to the purified DNA sample. Vortex the sample for 1 second and incubate at 37°C for 15 minutes.
+
-
*Rehydrate the DNA by incubating at 65°C for 1 hour. Periodically mix the solution by gently tapping the tube.
+
-
*Store the DNA at 2–8°C.
+
-
 
+
-
 
+
-
==''Arabidopsis thaliana'': Growth Conditions and Plant Material==
+
-
 
+
-
Six weeks old ''A. thaliana'' plants, ecotype Columbia 0 (wildtype), have been gratefully offered by Patrick Treffon and Thorsten Seidel. They have been cultivated under normal day conditions (14 hours light &#91;100 &micro;mol &frasl; quanta m<sup>-2</sup>s<sup>-1</sup>&#93; at 21°C, 10 hours darkness at 18°C). For induction of the formation of siliques the plants were shifted into long day conditions (16 hours light &#91;100 &micro;mol &frasl; quanta m<sup>-2</sup>s<sup>-1</sup>&#93; at 21°C, 18 hours darkness at 18°C). After two weeks in long day conditions the plants have developed 2 cm long siliques. The siliques were harvested and frozen in liquid nitrogen for further use.
+
-
 
+
-
 
+
-
==''Arabidopsis thaliana'': Total RNA Isolation==
+
-
 
+
-
The frozen plant material has to be grinded in a precooled mortar in liquid nitrogen. About 120 mg of pulverized plant material are transfered into a precooled 2 ml Eppendorf tube and kept frozen until the following steps:
+
-
*Add 0.5 ml lysis buffer and immediately homogenize through rough shaking.
+
-
*Add 0.5 ml of saturated phenol and mix strongly.
+
-
*Add 0.5 ml of chloroform isoamyl alcohol (24:1) and vortex again at high speed for at least 30 seconds.
+
-
*Centrifugate for 5 min at 13,000 rpm.
+
-
*The lower phase contains now lipids and lipophilic compounds. The upper phase contains nucleic acids (~ 550 µl) and has to be carefully transferred into a new 2 ml Eppendorf tube. This tube has to be filled with 0.5 ml saturated phenol and 0.5 ml chloroform isoamyl alcohol (24:1). Mix immediately.
+
-
*Centrifugate at 13,000 rpm for 3 minutes.
+
-
*Prepare a new 2 ml Eppendorf tube with 1 ml of chloroform isoamyl alcohol (24:1). Transfer the upper aqueous phase (~ 540 µl) containing the protein purified nucelic acids into the new tube and vortex strongly.
+
-
*Centrifugate at 13,000 rpm for 3 minutes.
+
-
*Prepare a new 1.5 ml Eppendorf tube with 0.5 ml of pure isopropanol. For the last time transfer the upper phase (~ 400 µl) into the new tube and mix gently.
+
-
*Incubate the mixture over night at -20°C. The nucleic acids will precipitate.
+
-
*Centrifugate the samples at 13,000 rpm for 15 minutes at 4°C.
+
-
*Discard the supernatant and resuspend the pellet in 375 µl sterile H<sub>2</sub>O.
+
-
*Add 125 µl 8 M lithium chloride and incubate for 2 hours on ice at 4°C. At this point most of the RNA is going to be precipitated.
+
-
*Centrifugate at 13,000 rpm at 4°C and discard the supernatant.
+
-
*Wash the pellet with 100 µl 70% (v/v) ethanol and discard it after centrifugation.
+
-
*Dry the pellet at room temperature.
+
-
*Dissolve the pellet in sterile H<sub>2</sub>O (~ 25 µl, depending on the size of the pellet).
+
-
*Check the quantity and quality of the RNA with a Nanodrop spectrophotometer before starting with a cDNA synthesis.
+
-
 
+
-
 
+
-
==''Arabidopsis thaliana'': cDNA Synthesis==
+
-
 
+
-
After a successful total RNA isolation the RNA has to be translated in cDNA through RT-PCR:
+
-
*Take 3 µg/µl of total RNA and add sterile H<sub>2</sub> to 8 µl.
+
-
Additionally add
+
-
<table border="0" rules="cols" align="center">
+
-
  <tr>
+
-
  <td align=center> 1,1 mM </td>
+
-
  <td align=center> Oligo-d(T)-Primer </td>
+
-
  </tr>
+
-
  <tr>
+
-
  <td align=center> 0,83 mM </td>
+
-
  <td align=center> dNTPs </td>
+
-
  </tr>
+
-
  <tr>
+
-
  <td align=center> 3,5 µl </td>
+
-
  <td align=center> H<sub>2</sub>O </td>
+
-
  </tr>
+
-
  </table>
+
-
*Vortex and centrifugate shortly.
+
-
*Incubate the samples for 10 minutes at 70°C.
+
-
*Immediately transfer the samples into ice water for 5 minutes.
+
-
*After cooling the samples centrifugate shortly.
+
-
*To start the synthesis add
+
-
<table border="0" rules="cols" align="center">
+
-
  <tr>
+
-
  <td align=center> 6 µl </td>
+
-
  <td align=center> 5xMMLV-Puffer </td>
+
-
  </tr>
+
-
  <tr>
+
-
  <td align=center> 4,5 µl </td>
+
-
  <td align=center> H<sub>2</sub>O </td>
+
-
  </tr>
+
-
  <tr>
+
-
  <td align=center> 1 µl </td>
+
-
  <td align=center> MMLV-reverse Transkriptase [200 U/µl] </td>
+
-
  </tr>
+
-
  <tr>
+
-
  <td align=center> 0,5 µl </td>
+
-
  <td align=center> RNasin RNase-Inhibitor [40 U/µl] </td>
+
-
  </tr>
+
-
  </table>
+
-
*Mix the samples and centrifugate shortly.
+
-
*Incubate for 1 hour at 42°C to translate the RNA into cDNA.
+
-
*Transfer the samples to 70°C for 15 minutes to stop the reaction.
+
-
*The new synthesized cDNA can be used for PCR after diluting 1:10 with water. Store the cDNA at -20°C.
+
-
 
+
-
 
+
-
==Ethanol precipitation to clean DNA==
+
-
 
+
-
To get rid of distracting salts the DNA has to be cleaned. For this we used the following protocol:
+
-
*If the volume of the sample containing the DNA is less than 200 µl bring the volume up to 200 µl.
+
-
*Add 1/10th volume of 3M sodium acetate and mix.
+
-
*Now add 2 volumes of -20°C cold 100% ethanol and vortex for 10 seconds.
+
-
*The sample can now be placed in a -20°C freezer overnight or incubated for 30 minutes at -80°C.
+
-
*Centrifugate for 10 minutes at 4°C.
+
-
*Discard the supernatant containing the ethanol.
+
-
*Wash the pellet with 500 µl 4°C cold 70% ethanol by rolling the sample gently.
+
-
*Discard the supernatant.
+
-
*Let the pellet dry at room temperature or speedvac the pellet.
+
-
*Resuspend the Pellet in water (amount is depending on the size of the pellet).
+

Latest revision as of 11:39, 26 September 2012

Protocols

Molecular

In this section of our protocol pages you can read more about our methods for cloning and BioBrick assembly.

Genetic engineering is a basic tool of synthetic biology. With the help of standardized DNA building blocks (BioBricks) it is fairly easy to create new and modify existing natural systems. The methods we have used in our project to create BioBricks and to modify, mutate, transform and analyse DNA are presented in this section. Methods used: Electroporation; chemical transformation; Standard, Freiburg, Gibson and 3A BioBrick assembly; restriction analysis; colony PCR; site directed mutagenesis.

read more

Production

These are the protocols for the cultivations and the downstream processing.

Before one is able to work with a cell-free system based on biological material, the needed proteins have to be produced and purified first. These methods and the ones we used to characterize our generated BioBricks in vivo are presented in this section. Used methods: Cultivations in shaking flasks and in differnt bioreactor systems with a working volume up to 6L; mechanical lysis of cells, protein clean-up from lysed cells, Ni-NTA- and TALON-columns and chromatography.

read more

Analytics

Protocols for the analytical methods we used.

DNA and proteins are very small and cannot be seen by the naked eye. To control the success and the results of your upstream and downstream processes, analytical methods are necessary that give reliable results to make DNA or proteins in any way visible for you. The analytical methods we used in our project can be found in this section. Used methods: Fluorescence measurement; SDS-PAGE; MALDI-TOF; HPLC; LC-ESI-qTOF-MS/MS; molecular beacons; extraction.

read more

Immobilization

Protocols for the immobilization

Immobilization offers the opportunity to develop a degradation system. Therefor we tried to find a method to immobilize the produced lacasses. For the immobilization we tried tow different methods. First silica beads, which were already available in our lab, because they were used the year before. And later CPC-(controlled pore carrier)-beads.

read more

Material

Chemicals, enzymes and kits we used in our lab work.

Chemical and biological reactions need defined conditions to work as expected. The chemicals, enzymes, kits, buffers and media we used in our project are listed in this section.

read more

55px Logo merck.jpg BioCircle.JPG Bielefeld2012 Evonik.jpg Bielefeld2012 Baxter.png Logo knauer.jpg Logo iit.jpg Bielefeld2012 BIEKUBA.jpg Logo biometra.jpg Logo bio-nrw.png Bielefeld2012 Logo ERASynbio.jpg

About our Wiki

Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach.

Contact Us

Universität Bielefeld
Universitätsstraße 25
D-33615 Bielefeld

info(at)igem-bielefeld.de

Navigate our Wiki

Start

Team

Project

Results

Since Regionals

Human Practice

Safety

Judging

Partner

Retrieved from "http://2012.igem.org/Team:Bielefeld-Germany/Protocols"