Team:Bielefeld-Germany/Results/Summary

From 2012.igem.org

(Difference between revisions)
(→Shuttle vector in P. pastoris)
 
(342 intermediate revisions not shown)
Line 25: Line 25:
<li><a href="#1"><strong>Summary</strong></a></li>
<li><a href="#1"><strong>Summary</strong></a></li>
<li><a href="#2"><strong>Datapage</strong></a></li>
<li><a href="#2"><strong>Datapage</strong></a></li>
-
<li><a href="#3"><strong>BPUL</strong></a></li>
+
<li><a href="#3"><strong>Laccases</strong></a></li>
-
<li><a href="#4"><strong>ECOL</strong></a></li>
+
<li><a href="#4"><strong>Immobilization</strong></a></li>
-
<li><a href="#5"><strong>TTHL</strong></a></li>
+
<li><a href="#5"><strong>Substrate Analysis</strong></a></li>
-
                <li><a href="#6"><strong>BHAL</strong></a></li>
+
<li><a href="#6"><strong>CBD</strong></a></li>
-
<li><a href="#7"><strong>TVE??</strong></a></li>
+
<li><a href="#7"><strong>Shuttle vector</strong></a></li>
-
<li><a href="#8"><strong>Immobilization</strong></a></li>
+
                 <li><a href="#8"><strong>Collaboration with UCL</strong></a></li>
-
<li><a href="#9"><strong>Substrate Analytics</strong></a></li>
+
-
<li><a href="#10"><strong>CBD</strong></a></li>
+
-
<li><a href="#11"><strong>Shuttle vector</strong></a></li>
+
-
                 <li><a href="#12"><strong>Collaboration with UCL</strong></a></li>
+
</ul>
</ul>
   </div>
   </div>
Line 46: Line 42:
  </html>
  </html>
-
==Cultivation and Purification of the different laccases==
+
<div style="text-align:justify;">
-
During our research we cultivated the following BioBricks and produced several laccase. To simplify the presentation of our results we named the produced laccase like the following system
+
 
 +
All BioBricks of the iGEM Team Bielefeld were screened to identify the best conditions for protein expression. The first trials were made by shaking flask cultivations with different parameters. These parameters were various shaking flask designs, different temperatures, different concentrations of chloramphenicol, various induction strategies, several cultivation times and some cultivations in absence or presence of CuCl<sub>2</sub>. To detect the produced laccases, different analysis methods were performed like SDS-PAGE analysis as well as MALDI-TOF. The iGEM Team successfully produced four active bacterial laccases and succeeded to purify four of them. Besides the successfully scale-up fermentation, these laccases could be purified in a high amount to characterize the optimal activity conditions regarding pH, temperature, buffer solutions and organic solvent resistance. Furthermore, the iGEM Team Bielefeld demonstrated that the produced laccases can be immobilized maintaining their activity and the degradation capacity was screened for several micro-contaminants. These tests indicate that all of our produced laccases are able to degrade estradiol and the two laccases TTHL and BPUL are able to degrade ethinyl-estradiol in combination with a mediator. At this moment, the self-designed shuttle-vector for the production of eukaryotic laccases in yeast is ready to go. This vector was tested to integrate by courtesy of homologous recombination genes of eukaryotic laccases into Pichia Pastoris and produce them in an active form. First experiments show a successful production of one laccase of ''Trametes versicolor''. A cheap alternative purification and immobilization method via a cellulose binding tag is also close at hand. During our research, we cultivated the following BioBricks and produced several laccase. To simplify the presentation of our results we named the produced laccase like the corresponding system.
 +
 
 +
</div>
{| class="wikitable"
{| class="wikitable"
!colspan="5"|Produced and generated BioBricks with the source strain of the DNA-sequence, promoter, protein name and the names given by the iGEM Team Bielefeld
!colspan="5"|Produced and generated BioBricks with the source strain of the DNA-sequence, promoter, protein name and the names given by the iGEM Team Bielefeld
Line 76: Line 75:
|-
|-
| <partinfo>K863012</partinfo>
| <partinfo>K863012</partinfo>
-
|''Thermus thermophilus''
+
|''Thermus thermophilus'' HB27
| constitutive promoter  (<partinfo>BBa_J23100</partinfo>)
| constitutive promoter  (<partinfo>BBa_J23100</partinfo>)
|align="center"|tthL
|align="center"|tthL
Line 82: Line 81:
|-
|-
| <partinfo>K863015</partinfo>
| <partinfo>K863015</partinfo>
-
| ''Xanthomonas campestris pv. campestris B100'
+
| ''Xanthomonas campestris pv. campestris'' B100
|T7  
|T7  
|align="center"|CopA
|align="center"|CopA
Line 98: Line 97:
|align="center"|Lbh1
|align="center"|Lbh1
|align="center"|'''BHAL'''
|align="center"|'''BHAL'''
 +
|-
 +
| <partinfo>K863030</partinfo>
 +
|''Trametes versicolor ''
 +
| AOX1 promoter
 +
|align="center"|TVL5
 +
|align="center"|'''TVEL5'''
|-
|-
|}
|}
-
 
-
 
-
All BioBricks of the iGEM Team Bielefeld were screened to identify the best conditions for protein expression. The first trials were made by shaking flask cultivations with different parameters. These parameters  were  various shaking flask designs , different temperatures, different concentrations of chloramphenicol, various induction strategies , several cultivation times and some cultivations in absence or presence of  CuCl<sub>2</sub>.  To detect the produced laccases different analysis methods were performed like SDS-PAGE analysis as well as MALDI-TOF.
 
-
 
-
==Purification==
 
-
 
-
To prove the activity of the produced laccases we used a Immobilized Metallion affinity chromatography to purify our laccases. The purification of the laccases were made by a syringe system or a column system including a Ni-NTA resin. The following picture illustrate a typical chromatogram of the purification procedure.
 
-
[[File:Bielefeld2012_Chromatogram_examplegrafik.jpg|500px|thumb|center| Illustration of a typical chromatogram of the produced laccases:
 
-
1. equilibration,
 
-
2. sample loading,
 
-
3. wash step,
 
-
4. elution (linear elution gradient),
 
-
5. column regeneration ]]
 
-
 
-
Due to the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak only the UV-detection signal of the wash step and the elution are shown. 
 
-
 
-
 
-
After measuring activity  a scale up to 3 L as well as up to 6 L.
 
-
 
-
 
-
__NOTOC__
 
-
 
-
 
<html>
<html>
Line 131: Line 113:
<div id="anzeige">
<div id="anzeige">
-
+
<img src="https://static.igem.org/mediawiki/2012/3/3e/Bielefeld2012_Overview.jpg" />
<h1>Datapage</h1>
<h1>Datapage</h1>
-
 
+
<p class="more">
-
<p class="more">
+
</html>
</html>
-
__NOTOC__
+
iGEM Team Bielefeld is developing a biological filter using immobilized laccases, enzymes able to radicalize and break down a broad range of aromatic substances. For the production of laccases from different bacteria, fungi and plants, two expression systems are used: ''Escherichia coli'' and the yeast ''Pichia pastoris''. Immobilization is carried out either by using CPC-silica beads or by fusing the enzymes to cellulose binding domains. The concept could be extended to other toxic pollutants in drinking and wastewater, as well as to industrial applications in paper and textile industries or even for bioremediation of contaminated soil.
-
 
+
<p class="more">
-
==How our system works==
+
[https://2012.igem.org/Team:Bielefeld-Germany/Results/Datapage Read more.]
-
 
+
</p>
-
==Data for our favorite new parts==
+
-
# <partinfo>K863000</partinfo> - '''bpul (laccase from ''Bacillus pumilus'') with T7 promoter, RBS and HIS tag''':
+
-
# <partinfo>K863005</partinfo> - '''ecol (laccase from ''E. coli'') with T7 promoter, RBS and HIS tag''':
+
-
 
+
-
==Data for pre-existing parts==
+
-
 
+
-
==We have also characterized the following parts==
+
-
# <partinfo>BBa_K863012</partinfo> - '''tthl laccase ( from T. thermophilus) with constitutive promoter J23100, RBS and HIS tag''':
+
-
# <partinfo>BBa_K863022</partinfo> - '''bhal laccase (from Bacillus halodurans) with constitutive promoter J23100, RBS and HIS tag''':
+
-
 
+
<html>
<html>
 +
</p>
   
   
-
</p>
+
 
-
+
</div>
</div>
 +
<div id="anzeige">
<div id="anzeige">
-
</html>
+
-
<h1>Laccase from ''Bacillus pumilus'' DSM 27 ([http://www.dsmz.de/catalogues/details/culture/DSM-27.html ATCC7061])</h1>
+
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg" />
 +
 +
<h1>Laccases</h1>
 +
<p class="more">
 +
</html>
 +
The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):
 +
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli ''Escherichia coli'' laccase ECOL]
 +
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi''Bacillus pumilus'' laccase BPUL]
 +
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo''Bacillus halodurans'' laccase BHAL]
 +
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo ''Thermus thermophilus'' laccase TTHL]
 +
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 ''Trametes versicolor'' laccase TVEL5]
 +
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison Comparison of the different laccases]
 +
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/trametis Purchased positive control ''Trametes versicolor'' laccase TVEL0]
<html>
<html>
-
<p class="more">
+
<p class="more">
</html>
</html>
-
First some trials of shaking flask cultivations were made with different parameters to define the best conditions for the production of the His-tagged CotA aus ''Bacillus pumilus'' DSM 27 ([http://www.dsmz.de/catalogues/details/culture/DSM-27.html ATCC7061]) named BPUL. Because of no activity in the cell lysate a purification method was established (using Ni-NTA-Histag resin). The purified BPUL could be detected by SDS-PAGE (molecular weight of 58.6&nbsp;kDa) as well as MALDI-TOF. To improve the purification strategies the length of the elution gradient was increased. The fractionated samples were also tested concerning their activity. A maximal activity of X was reached. After measuring activity of BPUL a scale up was made up to 3&nbsp;L and also up to 6&nbsp;L.
+
All bacterial laccases (ECOL, BHAL, TTHL and BPUL) we accomplished to purify. Besides the successfully scale-up fermentation these laccases could be purified in a high amount to characterize the optimal activity conditions regarding  pH, temperature, buffer solutions  and  organic solvent resistance. Furthermore the iGEM Team Bielefeld demonstrated that the produced laccases can be immobilized maintaining their activity and the degradation capacity was screened for several micro-contaminants. These tests indicate that they are able to degrade estradiol and ethinyl-estradiol.
<html>
<html>
-
</html>
 
-
 
-
__NOTOC__
 
-
 
-
==Shaking Flask Cultivation==
 
-
 
-
The first trials to produce the CotA-laccase from ''Bacillus pumilus DSM 27'' ([http://www.dsmz.de/catalogues/details/culture/DSM-27.html ATCC7061], named BPUL) were performed in shaking flasks with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters we have changed during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), different concentrations of chloramphenicol (20 to 170&nbsp;µg&nbsp;mL<sup>-1</sup>), induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction with 0,1&nbsp;% rhamnose) and cultivation time (6 - 24&nbsp;h). Further we cultivated with and without 0,25&nbsp;mM Cu<sub>2</sub>Cl, to provide a sufficient amount of copper, which is needed for the active center of the laccase.  Due to the screening experiments we identified the best conditions for expression of BPUL (see below). The addition of Cu<sub>2</sub>Cl did not lead to better results, so it was omitted.
 
-
 
-
* flask design: shaking flask without baffles
 
-
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]
 
-
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol
 
-
* temperature: 37&nbsp;°C
 
-
* cultivation time: 12&nbsp;h
 
-
 
-
The reproducibility and repeatability of the measured data and results were investigated for the shaking flask and bioreactor cultivation.
 
-
 
-
==3&nbsp;L Fermentation ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> ==
 
-
 
-
[[File:Bielefeld2012_BPUL3LFermentation.jpg|450px|thumb|left|'''Figure 1:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (BPUL) in Braun Biostat B, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold a pO<sub>2</sub> of 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]
 
-
<p align="justify">
 
-
 
-
After the measurement of BPUL activity we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> in Braun Biostat&nbsp;B with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. We got a long lag phase of 2&nbsp;hours due to a relatively old preculture. The cell growth caused a decrease in pO<sub>2</sub> and after 3&nbsp;hours the value fell below 50&nbsp;%, so that the agitation speed increased automatically. After 8.5&nbsp;hours the deceleration phase started and therefore the agitation speed was decreased. The maximal OD<sub>600</sub> of 3.53 was reached after 10&nbsp;hours, which means a decrease in comparison to the fermentation of ''E.&nbsp;coli'' KRX under the same conditions (OD<sub>600,max</sub> =4.86 after 8.5&nbsp;hours, time shift due to long lag phase). The cells were harvested after 11&nbsp;hours.
 
</p>
</p>
-
<br style="clear: both" />
 
-
 
-
== Purification of BPUL ==
 
-
 
-
 
-
<p align="justify">
 
-
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and centrifuged. The supernatant of the lysed cell paste was loaded on the Ni-NTA-column (15&nbsp;mL Ni-NTA resin) with a flowrate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer] gradient from 0&nbsp;% to 100&nbsp;% with a total volume of 100&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. Due to the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak only the UV-detection signal of the wash step and the elution are shown. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the BPUL-elution is shown in figure 2:
 
</p>
</p>
-
 
-
<br style="clear: both" />
 
-
[[File:Bielefeld2012_BPUL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution from FLPC Ni-NTA-Histag purification of BPUL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>. BPUL was eluted between a process volume of 460&nbsp;mL to 480&nbsp;mL with a maximal UV-detection signal of 69 mAU]]
 
-
 
-
<p align="justify">
 
-
The chromatogram shows a remarkable widespread peak between the process volume of 460&nbsp;mL to 480&nbsp;mL with the highest UV-detection signal of 69 mAU, which can be explained by the elution of bound proteins. The corresponding fractions were analyzed by SDS-PAGE analysis. Afterwards the UV-signal increased caused by the changing imidazol concentration during the elution gradient. Between the process volume of 550 and 580&nbsp;mL there are several peaks (up to a UV-detection-signal of 980&nbsp;mAU) detectable. These results are caused by an accidental detachment in front of the UV-detector. Just to be on the safe side, the corresponding fractions were analyzed by SDS-PAGE analysis. The results of the SDS-PAGE are shown in the following pictures.
 
-
</p>
 
-
 
-
<br style="clear: both" />
 
-
 
-
==SDS-PAGES of purified BPUL==
 
-
[[File:Bielefeld2012_0906.jpg|height={50px}|weight={400px}|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E. coli'' KRX containing <partinfo>BBa_K863000</partinfo> lysate (fermented in 3 L Biostat Braun B). The flow-through, wash and the elution fractions 7 and 8 are shown. The arrow marks the BPUL band with a molecular weight of 58.6 kDa.]]
 
-
 
-
Figure 3 shows the purified ''E. coli'' KRX with <partinfo>BBa_K863000</partinfo> lysates (fermented in 3&nbsp;L Braun Biostat B) including flow-through, wash and the elution fractions 7 and 8. These two fractions were chosen due to a remarkable peak in the chromatogram. BPUL has a molecular weight of 58.6 kDA and was marked with a red arrow. The band appears in both fractions. There are also some other non-specific bands, which could not be identified. To improve the purification the elution gradient length should be longer and slower the next time.
 
-
 
-
The appearing bands were analysed by MALDI-TOF and could be identified as CotA (BPUL).
 
-
<br style="clear: both" />
 
-
 
-
==6&nbsp;L Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>==
 
-
 
-
[[File:Bielefeld2012_BPUL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (BPUL) in Bioengineering NFL22, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> measured every hour. ]]
 
-
 
-
<p align="justify">
 
-
Another scale-up for ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL22. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 3. There was no noticeable lag phase. Agitation speed was increased up to 425&nbsp;rpm after one hour due to problems caused by the control panel. The pO<sub>2</sub> decreased until a cultivation time of 4.75&nbsp;hours. The increasing pO<sub>2</sub>-Level indicates the beginning of the deceleration phase. There is no visible break in cell growth caused by an induction of protein expression. A maximal OD<sub>600</sub> of 3.68 was reached after 8&nbsp;hours of cultivation, which is similar to the 3&nbsp;L fermentation (OD<sub>600</sub> = 3.58 after 10 hours, time shift due to long lag phase). The cells were harvested after 12&nbsp;hours.
 
-
 
-
</p>
 
-
 
-
<br style="clear: both" />
 
-
 
-
==Purification of BPUL==
 
-
 
-
<p align="justify">
 
-
The harvested cells were prepared in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and centrifuged. The supernatant of the lysed cell paste was loaded on the Ni-NTA-column (15&nbsp;mL Ni-NTA resin) with a flowrate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed with 5&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer]. The bound proteins were eluted by an increasing elutionbuffer gradient from 0&nbsp;% (equates to 20&nbsp;mM imidazol) to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 200&nbsp;mL. This strategy was chosen to improve the purification by a slower increase of [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer] concentration. The elution was collected in 10&nbsp;mL fractions.Due to the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak only the UV-detection signal of the wash step and the elution are shown. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the BPUL-elution is shown in figure 5.
 
-
</p>
 
-
 
-
<br style="clear: both" />
 
-
[[File:Bielefeld2012_BPUL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA-Histag Purification of BPUL produced by 6&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>. BPUL was eluted between a process volume of 832&nbsp;mL and 900&nbsp;mL with a maximal UV-detection signal of 115&nbsp;mAU.]]
 
-
 
-
<p align="justify">
 
-
The chromatogram shows a peak at the beginning of the elution. This can be explained by pressure fluctuations upon starting the elution procedure. Between a process volume of 832&nbsp;mL and 900&nbsp;mL there is remarkable widespread peak with a UV-detection signal of 115&nbsp;mAU. This peak corresponds to an elution of bound proteins at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer] concentration between 10&nbsp;% and 20&nbsp;% (equates to 50-100&nbsp;mM imidazol) . The corresponding fractions were analyzed by SDS-PAGE. The ensuing upwards trend of the UV-signal is caused by the increasing imidazol concentration during the elution gradient. Towards the end of the elution procedure there is a constant UV-detection signal, which shows, that most of the bound proteins was already eluted. Just to be on the safe side, all fractions were analyzed by SDS-PAGE to detect BPUL. The results of the SDS-PAGE are shown in the following pictures.
 
-
 
-
</p>
 
-
<br style="clear: both" />
 
-
 
-
==SDS-PAGES of purified BPUL==
 
-
 
-
<p align="justify">
 
-
[[File:Bielefeld2012 0914.jpg|450px|thumb|left|'''Figure 7:''' SDS-PAGE of purified ''E.&nbsp;coli'' with <partinfo>BBa_K863000</partinfo> lysate (fermented in Bioengineering, 6 L). The flow-through, wash and elution fraction 1 to 9 are shown. The arrow marks the BPUL band with a molecular weight of 58.6 kDa. ]]
 
-
 
-
In figure 7 the SDS-PAGE of the Ni-NTA-Histag purification of the lysed culture of ''E. coli'' KRX containing <partinfo>BBa_K863000</partinfo> is illustrated. It shows the flow-through, wash and elution fractions 1 to 9. BPUL has a molecular weight of 58.6 kDA and was marked with a red arrow. The band appears in all fractions from 2 to 9 with varying strength, the strongest ones in fractions 7 to 9. There are also some other non-specific bands, which could not be identified. Therefore the purification method could moreover be improved.
 
-
 
-
Furthermore the bands were analysed by MALDI-TOF and identified as CotA (BPUL).
 
-
 
-
</p>
 
-
<html>
 
-
</p>
 
-
 
</div>
</div>
-
<div id="anzeige">
 
-
<h1>Laccase from Escherichia coli BL21 (DE3)</h1>
+
-
+
-
<p class="more"> First some trails of shaking flask cultivations were made with changing parameters to identify the best conditions for the production of the laccase ECOL fused to a Histag. Because of no activity in the cell lysate a purification method was established (using Ni-NTA-Histag resin). The purified ECOL could be identified by SDS-PAGE (molecular weight of 53,4 kDa) as well as MALDI-TOF. The fractionated samples were also tested concerning their activity. A maximal activity of X was reached. After measuring activity of ECOL a scale up was made up to 3 L and then also up to 6 L.
+
-
</html>
+
<div id="anzeige">
-
__NOTOC__
+
-
==Shaking Flask Cultivations==
+
<img src="https://static.igem.org/mediawiki/2012/2/25/Bielefeld2012_Immo.jpeg" />
-
 
+
-
The first trails to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters we have changed during our screening experiments were the temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), different concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([[https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction autoinduction] and manual induction), several cultivation times (6 - 24&nbsp;h) and in absence or presence of 0.25&nbsp;mM Cu<sub>2</sub>Cl. Due to the screening experiments we identified the best conditions under which ECOL was expressed:
+
-
 
+
-
* flask design: shaking flask without baffles
+
-
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]
+
-
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol
+
-
* temperature: 37&nbsp;°C
+
-
* cultivation time: 12&nbsp;h
+
-
 
+
-
The reproducibility and repeatability of the measured data and results were investigated for the shaking flask and bioreactor cultivation with n ≤ 3.
+
-
 
+
-
==3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>==
+
-
 
+
-
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold a pO<sub>2</sub> of 50&nbsp;%, OD<sub>600</sub> taken every 30&nbsp;minutes.]]
+
-
 
+
-
<p align="justify">
+
-
After the measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in Infors Labfors with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600,max</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the celltoxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf  DBU final report]). Therefore they were harvested after 12&nbsp;hours.
+
-
</p>
+
-
 
+
-
 
+
-
<br style="clear: both" />
+
-
 
+
-
==Purification of ECOL==
+
-
 
+
-
<p align="justify">
+
-
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and centrifuged. The supernatant of the lysed cell paste was loaded on the Ni-NTA-column (15&nbsp;mL Ni-NTA resin) with a flowrate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed by 10&nbsp;column&nbsp;volumes (CV) with [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM Imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of  40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategies was chosen to improve the purification caused by a step by step increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer] concentration. The elution was collected in 10&nbsp;mL fractions. Due to the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak only the UV-detection signal of the wash step and the elution are shown. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here].The chromatogram of the ECOL-elution is shown in figure 2:
+
-
</p>
+
-
 
+
-
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution from FLPC Ni-NTA-Histag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]
+
-
 
+
-
<p align="justify">
+
-
The chromatogram shows two remarkable peaks. The first peak was detected by a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer] concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol) a peak up to a UV-detection signal of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analysed by SDS-PAGE analysis to detect ECOL. There were no further peaks detectable. The following increasing UV-dectection-signals equates to the imidazol concentration of the [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer]. The corresponding SDS-PAGES are shown in figure 3.
+
-
</p>
+
-
 
+
-
<br style="clear: both" />
+
-
 
+
-
==SDS-PAGE of ECOL purification==
+
-
 
+
-
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified  ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L Infors Labfors). The flow-through, wash and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]
+
-
 
+
-
In figure 3 the SDS-PAGE of the Ni-NTA-Histag purification of the lysed culture ( ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is illustrated including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. Another small band with a lower molecular weight appears, but was not identified.
+
-
 
+
-
Furthermore the bands were analysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).
+
-
<br style="clear: both" />
+
-
 
+
-
==6&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>==
+
-
 
+
-
 
+
-
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in Bioengineering NFL22, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]
+
-
 
+
-
<p align="justify">
+
-
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in Bioengineering NFL 22. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;3. There was no noticeable lag phase and the cells immediatly began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxity of the laccases for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.
+
-
</p>
+
-
 
+
-
<br style="clear: both" />
+
-
 
+
-
==Purification of ECOL==
+
-
 
+
-
<p align="justify">
+
-
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and centrifuged. The supernatant of the lysed cell paste was loaded on the Ni-NTA-column (15&nbsp;mL Ni-NTA resin) with a flowrate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) with [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions.Due to the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak only the UV-detection signal of the wash step and the elution are shown. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL-elution is shown in figure&nbsp;4:
+
-
</p>
+
-
 
+
-
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA-Histag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]
+
-
 
+
-
 
+
-
<p align="justify">
+
-
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analysed by SDS-PAGE analysis.
+
-
</p>
+
-
<br style="clear: both" />
+
-
 
+
-
==SDS-PAGES of ECOL purification==
+
-
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed culture of ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and elution fraction 1-15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]
+
-
 
+
-
+
-
In figure 6 the result of the Ni-NTA-Histag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands.
+
-
 
+
-
Furthermore the bands were analysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).
+
-
<br style="clear: both" />
+
-
<html>
+
-
</p>
+
-
 
+
<h1>Immobilization</h1>
-
</div>
+
<p class="more">
-
 
+
-
 
+
-
 
+
-
<div id="anzeige">
+
-
+
-
<h1>Laccase from Thermus thermophilus HB27</h1>
+
-
+
-
<p class="more">
+
-
First some trails of shaking flask cultivations were made with different parameters to define the best conditions for the production of the His-tagged TTHL. Because of no activity in the cell lysate a purification method was established (using Ni-NTA-Histag resin). The purified TTHL could not be detected by SDS-PAGE (theoretical molecular weight of 53&nbsp;kDa) by using the '' E. coli'' KRX as expression system. Due to this results we decided to change the expression to ''E. coli'' Rossetta-Gami&nbsp;2. With this expression system the TTHL could be detected by SDS-PAGE as well as MALDI-TOF analysis. To prove the activity of the produced laccase we used a small scale Ni-NTA-column to purify our laccase. The fractionated samples were also tested concerning their activity. A maximal activity of X was reached. After measuring activity of TTHL a scale up was made up to 6&nbsp;L
+
</html>
</html>
-
__NOTOC__
+
'''Using commercially acquired laccases from ''Trametes versicolor'' (named TVEL0) as a standard, it was possible to optimize an immobilization method of the purified laccases from
-
 
+
<html>
-
==Shaking Flask Cultivation==
+
-
 
+
-
The first trials to produce the ''Thermo thermophilus''-laccase (Ltth) called TTHL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters we have changed during our screening experiments were the temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), different concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies (autoinduction and manual induction), several cultivation times (6 - 24&nbsp;h) and in absence or presence of 0,25&nbsp;mM CuCl<sub>2</sub>. Due to the screening experiments we wasn't able to detect the best conditions for the production with the  ''E. coli'' KRX chassi.
+
-
Due to the failed screening results we decided to produce the TTHL in an other ''E. coli'' strain called ''E. coli '' Rosetta-Gami 2 containing <partinfo>BBa_K863012</partinfo>. We decided to use ''E. coli '' Rosetta-Gami 2 becaus of his skill to translate rare codons. We produced our TTHL with the following conditions:
+
-
 
+
-
* flask design: shaking flask without baffles
+
-
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials LB-Medium]
+
-
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol and 300&nbsp;µg&nbsp;mL<sup>-1</sup> ampicillin
+
-
* temperature: 37&nbsp;°C
+
-
* cultivation time: 24&nbsp;h
+
-
 
+
-
The reproducibility and repeatability of the measured data and results were investigated for the shaking flask and bioreactor cultivation with n&le;3.
+
-
 
+
-
The Results of the SDS-PAGE analysis are shown in the following images:
+
-
 
+
-
SDS PAGES!!!!!
+
-
 
+
-
 
+
-
ACTIVITÄTSMESSUNGEN VOM ERSTEN AKTIVEN B PUMI!!!!!!
+
-
 
+
-
==Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863012</partinfo>==
+
-
 
+
-
After measuring activity of TTHL we made a scale-up and fermented ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863000</partinfo> in Bioengineering NFL22 with a total volume of 6&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The cells immediatly began to grow and therefore the pO<sub>2</sub> decreased up to a value of 0&nbsp;%, because the breakdown of the control unit. After a cultivation time of 9&nbsp;hours the agitation speed was increased up to a 500&nbsp;rpm, which resulted in a pO<sub>2</sub> value of more than 100&nbsp;% for the rest of the cultivation. During the whole process the OD<sub>600</sub> increased slowly in comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> or <partinfo>BBa_K863005</partinfo>. The maximal OD<sub>600</sub> was reached after 19 hours of cultivation, when the cells were harvested.
+
-
 
+
-
<p align="justify">
+
-
[[File:Bielefeld2012_TTHL6LFermentation.jpg|600px|thumb|center|'''Figure 1:''' Fermentation of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863012</partinfo> (TTHL) in Bioengineering NFL22, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]
+
-
<br style="clear: both" />
+
</p>
</p>
-
 
+
</html>
-
 
+
:* [http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29 ''E. coli'' BL21 (DE3)] (named ECOL)
-
 
+
:* [http://www.dsmz.de/catalogues/details/culture/DSM-27.html ''Bacillus pumilus'' DSM 27 (ATCC7061)] (named BPUL)
-
==Purification of TTHL==
+
:* [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from
-
 
+
:* [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL)
-
 
+
-
<p align="justify">
+
-
The cells were harvested and resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and centrifuged. After preparing the cell paste we did not have the possibility to purificate the TTHL with the 15&nbsp;mL. To detect and to analyse our produced TTHL we implement a small scale purification of  6&nbsp;mL of the supernatant with a 1&nbsp;mL Ni-NTA-column. The results of the SDS-PAGE analysis are shown the following images:
+
-
</p>
+
-
 
+
-
==SDS-PAGE of purification TTHL==
+
-
[[File:Bielefeld2012_0923.jpg|450px|thumb|'''Figure 3:''']]
+
<html>
<html>
 +
<p class="more">
 +
</html>
 +
on CPC-silica beads. All four purified laccases were successfully immobilized, with ECOL and BPUL showing the highest binding ability to beads. Moreover, all four immobilized laccases showed activity. Whereas immobilized BPUL showed a relatively high activity, the results couldn't be compared to BHAL und TTHL due to the low concentration of the latters. ''' For immobilization results see [https://2012.igem.org/Team:Bielefeld-Germany/Results/immo here]
 +
<html>
 +
</p>
 +
</div>
-
</p>
 
-
 
-
 
-
 
-
</div>
 
<div id="anzeige">
<div id="anzeige">
-
 
-
<h1>Laccase from Bacillus halodurans C-125</h1>
 
-
 
-
<p class="more">
 
-
First some trails of shaking flask cultivations were made with various parameters to identify the best conditions for the production of the His-tagged BHAL. Because of no activity in the cell lysate a purification method was established (using Ni-NTA-Histag resin). The BHAL could not be detected by SDS-PAGE (theoretical molecular weight of 56&nbsp;kDa) by using the '' E. coli'' KRX as expression system. Due to this results we decided to change the expression to ''E. coli'' Rossetta-Gami&nbsp;2. With this expression system the BHAL could be found by SDS-PAGE as well as MALDI-TOF analysis. To prove the activity of the produced laccase we used a small scale Ni-NTA-column to purify our laccase. The fractionated samples were also tested concerning their activity. A maximal activity of X was reached. A scale up could not be implemented yet.
 
-
</p>
 
-
 
 +
<img src="https://static.igem.org/mediawiki/2012/a/a7/Bielefeld2012-estradiol-control-spectroflurophotometer.JPG" />
-
</div>
+
<h1>Substrate Analysis</h1>
-
<div id="anzeige">
 
-
 
-
<h1>Laccase from Trametes versicolor </h1>
 
-
 
-
<p class="more">
 
</html>
</html>
-
__NOTOC__
+
<p class="more">
 +
To establish the methods for degradation analysis of different substrates TVEL0 was used as positive control.
 +
After that the four produced bacterial laccases were analyzed. The HPLC results showed that estradiol and ethinyl estradiol ( with addition of ABTS) are degradable with our laccases.To determine degradation products of estradiol and ethinyl estradiol after laccase treatment LCMS-MS analysis were done. For more informations [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate click here].
 +
</p>
 +
<html>
-
==TVEL0 Activity Tests==
+
</p>
-
 
+
-
[http://www.sigmaaldrich.com/catalog/product/sigma/51639?lang=de&region=DE TVEL0] was characterized in terms of its activity to establish activity test protocols and to create a standard which can be used as a reference.
+
-
 
+
-
<html>
+
-
</p>
+
-
+
Line 443: Line 202:
<div id="anzeige">
<div id="anzeige">
-
 
-
<h1>Immobilization</h1>
 
-
 
-
<p class="more">
 
-
</p>
+
<img src="https://static.igem.org/mediawiki/2012/6/6d/Bielefeld2012_GFP.jpg" />
 +
<h1>Cellulose binding domain</h1>
-
+
<p class="more">
-
</div>
+
-
 
+
-
 
+
-
<div id="anzeige">
+
-
+
-
<h1>Subtrate Analytics</h1>
+
-
 
+
-
               
+
-
+
-
<p class="more">
+
</html>
</html>
-
__NOTOC__
+
A cheap alternative purification method combined with a powerful immobilization tool could be the solution to prevail over other more expensive water cleaning methods like oxidization with ozone or using tons of activated carbon which just capture microcontaminates, but does not dismantle them. A promising solution to this could be cellulose binding domains (CBDs). Cellulose is ubiquitous and sustainable. Following this idea fusion-protein-constructs with cellulose binding domains have been made. To characterize a GFP has been introduced as a C or N-terminal domain of the cellulose binding protein. After delays in cloning the constructs for two fusion proteins with a T7-promoter could be finished, but did not express the protein in ''E. coli'' KRX and BL21. An alternative construct with a constitutive promoter could also be finished, but gave the same results. Changing the order of CBD and GFP was carried out, but was hampered by a base deletion in the GFP gene causing a frame shift and could not be redone in time.
-
 
+
<p class="more">
-
==Dilutioin series==
+
-
[[File:Bielefeld2012_detectionlimit.JPG|200px|thumb|right|'''Figure 1.1:'''The detection range of ethinyl estradiol. Concentrations between 0.1 µg ml <sup>-1</sup> and 3 µg ml <sup>-1</sup> are detecable.]]
+
-
 
+
-
At first we mesured dilution series of all different substrates. While estradiol and ethinyl estradiol where easy to mesure, we didnt succed often with the estrone calibration curves. This was caused by its bad solubility. The retention time for estradiol is 5.8 minutes, for estrone 4.7 minutes and for ethinyl estradiol 5.2 minutes. For all estrogens we could use the same extinction and emmission values: Ex 230, Em 310.
+
-
 
+
-
The next substrate class where the analgesics. These three substrates have different optimal extinction and emission values. Additional difficulties occured with naproxene and ibuprofen. Instead of one single peak we found two for each substrate, and none of them correlated with the used concentration. With diclofenac we are still not sure which extinction and emmission values are to use. We found different values and aditionaly we analysed it with a spectrofluorometer but this has also shown no clear peak for diclofenac.
+
-
 
+
-
Three of the four PAH´s have the same extinction and emmission values. Simular to the estrogens, the PAH calibration curves are easy to generate. Naphthalene has a retention time of 9.6 minutes and its detection range ist also 0.1 till 2.5 µg*mL<sup>-1</sup>. Acenaphthene with a retention time of 15.1 minutes and phenantrene with a retention time of 17 minutes have maximal detectable concentration of 1.5 µg*mL<sup>-1</sup>.
+
-
 
+
-
Anthracene will be mesured later.
+
-
 
+
-
<br style="clear: both" />
+
-
 
+
-
==Negative controls==
+
-
The results of our negative controls of the first Polycyclic aromatic hydrocarbon, PAH, degradations showed, that PAH´s decay without laccase with a high speed. So we take a closer look at the three PAH´s in Britton Robinson (BR)-buffer. The result can be seen in figure 2.1. After one hour most of the used substrates decayed.
+
-
 
+
-
[[File:Bielefeld2012_neg_pahs.png|500px|thumb|left|'''Figure 2.1:'''The PAH´s naphthalene,
+
-
acenaphthene and phenantrene in BR-buffer at 30 °C. The startconcentration was 1 µg mL <sup>-1</sup> for all PAH´s. After 1 houre nearly all PAH´s decayed completely.]]
+
-
 
+
-
The next step was to check if and which substance cause the decay. In this test we dissolved naphthalene in acetonitrile and in methanol and compared the pure solvents with the influence of the BR-buffer and BR-buffer with ABTS. With pure methanol or acetonitrile naphthalene decays slow in comparison to BR-buffer. In BR-buffer with or without ABTS the decay happens faster and under nearly the same velocity. So BR-buffer seems to be a bad choice to test if our laccases degrade PAH´s.
+
-
 
+
-
[[File:Bielefeld2012_naphneg.png|500px|thumb|right|'''Figure 2.2:'''Naphthalene decay in four different conditions. Dissolved in methanol, dissolved in acetonitrile, with BR-buffer and with BR-buffer together with ABTS ]]
+
-
 
+
-
<br style="clear: both" />
+
-
 
+
-
==Degradation==
+
-
Degradation reactions with ABTS showed the expected results. Team Activity test already showed, that the laccases have the ability to oxidise ABTS. The fact that oxidised ABTS react chemical with the substrates explains, that all of our active laccases have the ability to degrade ethinly estradiol and other substrates.
+
-
 
+
-
[[File:Bielefeld2012_EBT_ABTS.png|500px|thumb|left|'''Figure 3.1:'''Comparison between two of our Laccases BPUL and ECOL with the purchased Laccase TVEL0 under ABTS influence.]]
+
-
 
+
-
The potential of the purchased laccase TVEL0 is much higher. TVEL0 degrades ethinyl estradiol without ABTS.
+
-
 
+
-
[[File:Bielefeld2012_TVEL0_EE.png|500px|thumb|right|'''Figure 3.2:'''Purchased laccase TVEL0 degrades ethinyl estradiol. Estradiol in BR-buffer without laccase as negative control.]]
+
-
 
+
-
BPUL has not the same potential as the purchased laccase. But BPUL degrades estradiol without the influence of ABTS.
+
-
 
+
-
[[File:Bielefeld2012_BPUL_Estradiol.png|500px|thumb|left|'''Figure 3.3:'''Our Laccases BPUL in unknown concentration degrades estradiol. Estradiol in BR-buffer without laccase as negative control.]]
+
-
 
+
-
<br style="clear: both" />
+
-
 
+
-
==Outlook==
+
-
Anthracene, lindane and diclofenac are to be detected with the HPLC. Ibuprofen and naproxen need a good calibration curve.
+
-
For naphthalene, acenaphthene and phenantrene we have to test different buffers or lower the temperature too keep ist more stable.
+
-
We have only tested BPUL and ECOL, and there will be not only TTHL to test, bot also the trametis versicolor laccases
+
-
TVEL5, TVEL10, TVEL13 and TVEL20.
+
-
Additional we want to determine kcat/km for the degradable substances.
+
-
 
+
<html>
<html>
-
</p>
+
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc">Read more</a>
-
+
<html>
-
 
+
</p>
 +
 +
</p>
 +
</div>
</div>
-
 
<div id="anzeige">
<div id="anzeige">
-
 
-
<h1>Cellulose binding domain</h1>
 
-
<p class="more">
 
-
 
-
</p>
 
-
</html>
 
-
__NOTOC__
 
-
 
-
==Introduction==
 
-
<div style="text-align:justify;">
 
-
In the field of cheap protein-extraction cellulose binding domains (CBD) have made themselfes a name. A lot of publications have been made, concerning a cheap strategy to capture a protein from the cell-lysate with a CBD-tag. Also enhanced segregation with CBD-tagged proteins have been observed. At this project the idea is different, the binding of our self-produced proteins to cellulose via a protein-domain-tag is taking advantage of the binding capacity of binding domains not only for purification reasons (it is still a great benefit), but also as an immobilizing-protocol for our laccases.
 
-
 
-
[[Image:Bielefeld2012 Osaka3.jpg|500px|thumb|right|Figure 1:Graphical sequence-alignment of <partinfo>K392014</partinfo> and the [http://www.ncbi.nlm.nih.gov/nuccore/AB041993 Xyn10A gene of C.josui]]]
 
-
To make a purification and immobilization-tag out of a protein domain, there are a lot of decisions and characterizations to get through.
 
-
 
-
Starting with the choice of the binding domain, the first limitation is accessibility. The first place to look at is, of course the [http://partsregistry.org Partsregistry]. A promising Cellulose binding motif of the ''C. josui'' Xyn10A gene (<partinfo>BBa_K392014</partinfo>) was found and ordered for the project right from the spot. After some research later concerning the sequence of that BioBrick it turned out that the part is not the CBD of the Xylanase as it should be, but the glycosyl hydrolase domain of the protein (Figure 1). This result made the part useless for the project ([http://partsregistry.org/Part:BBa_K392014:Experience complete review]) and it was the only binding domain in the [http://partsregistry.org Partsregistry] that fitted to the project.
 
-
 
-
Accessible organisms were searched via NCBI for binding-domains, -proteins and -motifs and work-groups were asked if they could help out. The results of the database research were only two chitin/carbohydate binding modules within the ''Bacillus halodurans'' genome (That stain was ordered for it's laccase <partinfo>BBa_K863020</partinfo>). One is in the [http://www.ncbi.nlm.nih.gov/nucleotide/289656506?report=genbank&log$=nuclalign&blast_rank=1&RID=0JPT9WMS01N Cochin chitinase gene] and the other in a [http://www.ncbi.nlm.nih.gov/protein/BAB05022.1 chitin binding protein].
 
-
 
-
[[Image:Bielefeld2012_p714.jpg|200px|thumb|left|Figure 2: Plasmid-map of p714 with CBDcex; Origin: Fermentation group of Bielefeld University]][[Image:Bielefeld2012_p570.jpg|220px|thumb|left|Figure 3: Plasmid-map of p570 with CBDclos; Origin: Fermentation group of Bielefeld University]]
 
-
 
-
Meanwhile the Fermentation group of our university group offered the use of two plasmids (p570 & p671), containing cellulose binding domains. The cellulose binding domain of the [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase gene] (CBDcex) and the cellulose binding domain of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (cbp A)] (CBDclos). The decision was made to use these two domains. Staying within the cellulose binding domain-family and leave other protein domains like carbohydrate binding domains aside would keep the results comparable. Like changing to a different binding material would change the binding capacities of both domains in the same way. Also both are bacterial CBDs and no post-translational modification and glycosylation had to be dealt with.
 
-
 
-
To get to know more about these two domains, their properties and their proteins NCBI wasconsulted and the [http://blast.ncbi.nlm.nih.gov/ BLAST]-tool was used to identify the cellulose binding domains and ExPASy-tools were used for further measurements.
 
-
 
-
[[Image:Bielefeld2012_pfam00553.jpg|130px|thumb|left|Figure 5: Crystal structure of the CBM_2-family]]
 
-
[[Image:Bielefeld2012_cfimiexo.jpg|500px|thumb|right|Figure 6: Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase gene]]]
 
-
 
-
The CBD of the Cellulomonas fimi ATCC 484 exoglucanase gene (Figure 6) is a 100 amino acid long domain, close to the C-terminal ending of the protein with a theoretical pI of 8.07 and a molecular weight of 10.3 kDa. It is classified to be stable and belongs to the Cellulose Binding Modul family 2 (pfam00553/cl02709). This means two tryptophan residues are involved in cellulose binding, this type of CBD is only found in bacteria. Also a CBM49 Carbohydrate binding domain is found within the protein domain, where [http://www.ncbi.nlm.nih.gov/pubmed/17322304?dopt=Abstract binding studies] have shown, that it binds to crystalline cellulose, which could be a possible target for immobilization.
 
-
 
-
[[Image:Bielefeld2012_ccellubp.jpg|450px|thumb|left|Figure 7: Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (cbp A)]]]
 
-
[[Image:Bielefeld2012_pfam00942.jpg|130px|thumb|right|Figure 8: Crystal structure of the CBM_3-family]]
 
-
 
-
The CBD of the [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (cbp A)] on the other hand is a N-terminal domain with 92 amino acids, theoretical pI of 4.56 and ist also classified as stable. It belongs to the Cellulose Binding Modul family 3 (pfam00942/cl03026) and is part of a very large cellulose binding protein with four other carbohydrate binding moduls and a lot of docking interfaces for the proteins in its amino acid sequence (Figure 7).
 
-
 
-
==The Binding Assay==
 
-
 
-
[[image:Bielefeld2012_GFP.jpg|300px|thumb|right|Aequorea victoria green fluorescent protein in action]]
 
-
To measure the capacity and strength of the bonding between the cellulose binding domains and different types of cellulose many different assays have been made. One of the simplest and most often used is the fusion of the CBD to a reporter-protein, especially [http://www.ncbi.nlm.nih.gov/pubmed/22305911a green or red fluorescent protein (GFP/RFP)] is very common. The place of the CBD is measured through the fluorescence of the fused GFP and quantification can easily been done.
 
-
 
-
[http://www.ncbi.nlm.nih.gov/pubmed/18573384 Protocol]:
 
-
* Harvest the ''E coli''-cells producing the fusion-protein of CBD and GFP and centifuge 10 minutes at top speed.
 
-
* Re-suspend the cell-pellet in 50 mM Tris-HCl-Buffer (pH 8.0).
 
-
* Break down cells via sonication.
 
-
* Centrifuge at top speed for 20 minutes to get rid of the cell-debris.
 
-
* Take the supernatant and measure the emission at 511 nm (excitation at 501 nm) (<partinfo>E0040</partinfo>)
 
-
* Mix a definite volume of lysate with a definite volume or mass of e.g. crystalline cellulose (CC) or reactivated amorphous cellulose (RAC)
 
-
* Wait 15 (RAC) to 30 (CC) minutes
 
-
* Take supernatant and measure the emission at 511 nm again.
 
-
* The difference between the first an the second measurement is the relative quantity of what has bound to the cellulose.
 
-
==Cloning of the Cellulose Binding Domains==
 
-
 
-
The cloning of the CBDs should fit to the cloning of our laccases, so the BioBricks were designed with a T7-promoter and the B0034 RBS to have a similar method of cultivation. After investigating the restriction-sites it showed, that at least for the characterization of the CBDs a quick in-frame assembly of the CBDs and a GFP would be possible, because neither the CBDs nor the GFP (<partinfo>I13522</partinfo>) of the Partsregistry inherits a ''Age''I- or ''Ngo''MIV-site, which makes Freiburg-assembly possible. To do so, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] for the constructs <partinfo>BBa_K863101</partinfo> (CBDcex(T7)), carrying the CBDcex domain from the ''C. fimi'' exoglucanase and <partinfo>BBa_K863111</partinfo> (CBDclos(T7)), carrying the CBDclos domain from the ''C.cellulovorans'' binding protein were designed. The protein-BLAST of the two CBDs gave an exact picture of which bases belong to the binding domains and which don't. To be sure not to disturb the folding anyway 6 to 12 bases up and downstream of the domains as conserved sequences were kept. Even if the [http://partsregistry.org/Part:BBa_K863101 CBDcex]is an C-terminal domain both domains were made N-terminal, so the BioBricks can carriy all regulatory parts and the linked protein can easily be exchanged. This also would be nice for other people using this part.
 
-
 
-
<center>
 
-
{|class="wikitable"
 
-
| CBDcex_T7RBS|| 80 || TGAATTCGCGGCCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGGGT<br />CCGGCCGGGTGCCAGGT
 
-
|-
 
-
| CBDcex_2AS-Link_compl || 56 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCGCCGACCGTGCAGGGCGTGC
 
-
|-
 
-
| CBDclos_T7RBS || 73 || CCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGTCAGTTGAATTTTACAACTCTAAC
 
-
|-
 
-
| CBDclos_2ASlink_compl|| 63 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCTGCAAATCCAAATTCAACATATGTATC
 
-
|}
 
-
</center>
 
-
 
-
The listed complementary primers added, besides the Freiburg-suffix, a two amino acid Glycine-Serine-linker to the end of the CBDs. This is a very short linker, but as GFP-experts and [http://www.ncbi.nlm.nih.gov/pubmed/17394253 publications] described GFP and CBDs are very stable proteins and should cope with a very short linker. The benefit of a short linker is that protease activity is kept minimal.
 
-
 
-
The GFP <partinfo>K863121</partinfo> used in the assay was an alternated version of the <partinfo>BBa_I13522</partinfo>. The [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] that were made added a Freiburg-pre- and suffix to the GFP coding sequence and a His-tag to the C-terminus to get it purified for the measurements. This part <partinfo>BBa_K863121</partinfo> (GFP_His) should be easily added to the CBDs and assembled to the fusion-proteins <partinfo>BBa_K863103</partinfo> CBDcex(T7)+GFP_His] and <partinfo>BBa_K863113</partinfo> CBDclos(T7)+GFP_His]).
 
-
 
-
<center>
 
-
{|class="wikitable"
 
-
| GFP_Frei || 54 || TACGGAATTCGCGGCCGCTTCTAGATGGCCGGCATGCGTAAAGGAGAAGAACTT
 
-
|-
 
-
| GFP_His6_compl || 74 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGTGATGGTGATGGTGATGTTTGTATAGTTCATCCATGCCATGTG
 
-
|}
 
-
</center>
 
-
 
-
Since a His-tag was added to the end of the GFP, an alternated version of the <partinfo>BBa_I13522</partinfo> had to be made to compare binding of GFP with and without CBD. Therefore a forward primer was made, to amplify the whole <partinfo>BBa_I13522</partinfo> with the GFP_His_compl-primer to add the His-tag to the C-terminus.
 
-
 
-
<center>
 
-
{|class="wikitable"
 
-
| GFP_FW_SV || 39 || acgtcacctgcgtgtagctCGTAAAGGAGAAGAACTTTT
 
-
|}
 
-
</center>
 
-
Due to bad cleavage efficiency at the ''Pst''I restriction-site in nearly all PCR-products the cloning of the CBDs ([http://partsregistry.org/Part:BBa_K863102 CBDcex(T7)] and [http://partsregistry.org/Part:BBa_K863112 CBDclos(T7)])and especially the insertion of [http://partsregistry.org/Part:BBa_K863121 GFP_His] to the CBDs took a lot more time as expected. This was because, while designing the primers, it was missed to add additional base pairs from the cleavage-site to the termini to increase the efficiency to standard. When the problem was disclosed, cloning got a lot quicker and more successful.
 
-
 
-
As the project went on and the T7-constructs didn't seem to work one suspected reason was that a stop codon (TAA) that accidentally resulted between the RBS and ATG could be the reason for that. To solve the problem a change to a constitutive promoter (<partinfo>BBa_J61101</partinfo>) was made now and then using the Freiburg-assembly. Therefore Freiburg forward primers for the CBDs were made.
 
-
<center>
 
-
{|class="wikitable"
 
-
| CBDcex_Freiburg-Prefix|| 54 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCGGTCCGGCCGGGTGCCAGGTG
 
-
|-
 
-
| CBDclos_Freiburg-Prefix || 57 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCTCATCAATGTCAGTTGAATTTTAC
 
-
|}
 
-
</center>
 
-
The second advantage of these primers were, that the order of the fusion proteins could easily been changed, when a Freiburg suffix-primer for the GFP would be available, so it was ordered.
 
-
<center>
 
-
{|class="wikitable"
 
-
| GFP_Freiburg_compl || 61 || ACGTCTGCAGCGGCCGCTACTAGTATTAACCGGTTTTGTATAGTTCATCCATGCCATGTGT
 
-
|}
 
-
</center>
 
-
[[File:Bielefeld2012_S3N10linker.jpg|500px|thumb|right|PCR-product of BBa_K863104 with S3N10-primers]]
 
-
Sadly the primers arrived just a few days before wiki freeze and we had no time to test that. The switching to the constitutive promoter had no obvious effect (no green colonies or culture). Changing the expression strain from ''E. coli'' KRX to ''E. coli'' BL21 didn't do a positive effect ether. Which led to the conclusion, that besides further information the problem has to be the space in between the two proteins and the CBD and GFP must hamper each other from folding correctly. To test and solve this a very long linker with three serines followed by ten asparagines should be assembled in the already existing parts via a blunt end cloning. This also is right at hand, just wasn't successful in the time which was left.
 
-
<center>
 
-
{|class="wikitable"
 
-
| S3N10_Cex_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCCGACCGTGCAGGGCGTGC
 
-
|-
 
-
| S3N10_Clos_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCTGCCGCCGACCGTGCAGG
 
-
|-
 
-
| S3N10_GFP || 40 || CAATAACAATAACAACAACCGTAAAGGAGAAGAACTTTTC
 
-
|}
 
-
</center>
 
-
 
-
== Literature ==
 
-
Kavoosi ''et al.'' (2007) Strategy for selecting and characterizing linker peptides for CBM9-tagged fusion proteins expressed in Escherichia coli. ''Biotechnol Bioeng.'' Oct 15;98(3):599-610.
 
-
Urbanowicz ''et al.'' (2007) A tomato endo-beta-1,4-glucanase, SlCel9C1, represents a distinct subclass with a new family of carbohydrate binding modules (CBM49). ''J Biol Chem.'' Apr 20;282(16):12066-74. Epub 2007 Feb 23.
 
-
Sugimoto ''et al.'' (2012) Cellulose affinity purification of fusion proteins tagged with fungal family 1 cellulose-binding domain. ''Protein Expr Purif.'' Apr;82(2):290-6. Epub 2012 Jan 28.
 
-
Hong ''et al.'' (2008) Bioseparation of recombinant cellulose-binding module-proteins by affinity adsorption on an ultra-high-capacity cellulosic adsorbent. ''Anal Chim Acta.'' Jul 28;621(2):193-9. Epub 2008 May 27.
 
-
</div>
 
-
 
-
 
-
 
-
<html>
 
-
+
<img src="https://static.igem.org/mediawiki/2012/1/17/Bielefeld2012_PECPP11JS.JPG" />
-
 
+
-
+
-
</div>
+
-
<div id="anzeige">
+
<h1>Shuttle vector</h1>
<h1>Shuttle vector</h1>
-
 
+
<p class="more">
-
<p class="more">
+
</html>
</html>
-
__NOTOC__
+
A shuttle vector for site-directed recombination into the yeast ''P. pastoris'' does not exist in the parts registry and could be developed by our team. With this system it is possible to recombine a protein of interest with a N-terminal mating factor alpha 1 for secretion the protein into the media. This protein of interest could be cloned in frame with one restriction ligate cloning step. The selection depends not on an antibiotic resistance like zeocine, but on a complementation of histidine auxotrophy. This system is for us important because some of our laccases can not be expressed in the prokaryotic expression system ''E. coli'', because the protein needs glycosylation.
-
here is space for the summary
+
[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Read more.]
 +
</p>
<html>
<html>
-
 
+
</p>
-
</p>
+
-
</html>
+
-
 
+
-
== Description of the shuttle vector system ==
+
-
 
+
-
The design of a minimal shuttle vector system with defined regions (or better DNA fragments) for expression and secretion of proteins of interest (POI) like laccase which needed glycolisation is the basic concept. The shuttle vector needs a bacterial part for cloning in bacteria (like E. coli) and an eucaryotic part for genomic integration and selection in yeast (like ''P. pastoris''). For other teams it is able to clone in frame their POI via the AarI restriction site. With only one restriction-ligation-cloning step the shuttle vector will be ready to use and integrate in the eucaryote ''P. pastoris''.
+
-
 
+
-
The shuttle vector consists of the plasmid pSB1C3, 5' UTR of alcohol oxidase 1 gene (''aox1'') containing the ''aox1'' promoter region, Kozak sequence, mating factor alpha 1 (MFalpha1), AarI restriction site, ''aox1'' terminater, ''his4'' gene and 3' UTR of ''aox1'' gene. Cloning and plasmid replication in ''E. coli'' is able via the pSB1C3 part.  The protein of interest (like laccase) can be included in frame with MFalpha1 via AarI restriction site. With the N-terminal MFalpha1 the POI could be secreted in the media. Genomic intregation of MFalpha1-taged POI is able via the 5' UTR and 3' UTR of the ''aox1'' gene. This allows a double cross over and the genomic integration without any bacterial proportion of DNA which could be a decisive point for industrial application. The complementation of histidine auxotrophie via ''his4'' gene is choosen instead of a zeocine resistance. This selection strategy is choosen because we want to avoid the application of antibiotics as many as possible.
+
-
 
+
-
Gibson assembly is used for building the shuttle vector (see the figure below) and the fragments with 5' overlap were amplified via PCR. In addition, die fragments were designed as basic BioBrick parts for use. The origin of the DNA sequence for design of the shuttle vector and the source of DNA for PCR is listed in the table below.
+
-
 
+
-
'''Elements of the shuttle vector and their origin'''
+
-
 
+
-
{|class="wikitable" style="text-align: center; width: 300px: height: 300px;" border=0}
+
-
 
+
-
! Element
+
-
! Origin of DNA sequence of design
+
-
! Origin of DNA sequence of PCR
+
-
 
+
-
|-
+
-
|[http://partsregistry.org/Part:pSB1C3 pSB1C3]
+
-
|[http://partsregistry.org/Part:pSB1C3 pSB1C3]
+
-
|[http://partsregistry.org/Part:pSB1C3 pSB1C3]
+
-
|-
+
-
|[http://partsregistry.org/Part:BBa_K863200 5'UTR of ''aox1'']
+
-
|[http://products.invitrogen.com/ivgn/product/V19520 plasmid pPICZalphaA (Invitrogen)]
+
-
|''P. pastoris'' wild type X-33
+
-
|-
+
-
|Kozak sequence
+
-
|[http://partsregistry.org/Part:BBa_J63003:Design BBa_J63003]
+
-
|integrated in primer sequence
+
-
|-
+
-
|[http://partsregistry.org/Part:BBa_K863203 MFalpha1]
+
-
|[http://products.invitrogen.com/ivgn/product/V19520 plasmid pPICZalphaA (Invitrogen)]
+
-
|[http://products.invitrogen.com/ivgn/product/V19520 plasmid pPICZalphaA (Invitrogen)]
+
-
|-
+
-
|[http://partsregistry.org/Part:BBa_K863203 ''aox1'' terminater]
+
-
|[https://products.invitrogen.com/ivgn/product/V17520 plasmid pPIC9K]
+
-
|''P. pastoris'' wild type X-33
+
-
|-
+
-
|[http://partsregistry.org/Part:BBa_K863202 ''his4'']
+
-
|[https://products.invitrogen.com/ivgn/product/V17520 plasmid pPIC9K]
+
-
|''P. pastoris'' wild type X-33
+
-
|-
+
-
|[http://partsregistry.org/Part:BBa_K863201 3'UTR of ''aox1'']
+
-
|[https://products.invitrogen.com/ivgn/product/V17520 plasmid pPIC9K]
+
-
|''P. pastoris'' wild type X-33
+
-
|-
+
-
|}
+
-
 
+
-
 
+
-
 
+
-
[[File:Bielefeld2012_PECPP11JS.JPG|thumb|400px|right|Plasmid map from shuttle vector pSB1C3::BBa_K863204.]]
+
-
 
+
-
== Shuttle vector in ''E. coli'' ==
+
-
The developed shuttle vector could transformed in ''E. coli'' and analyzed by restriction with the enzymes [[Team:Bielefeld-Germany/Protocols/Materials#Used_enzymes | ''Pvu''II]] and [[Team:Bielefeld-Germany/Protocols/Materials#Used_enzymes | ''Hind''III]]. The restriction pattern is positiv. A [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa%20K863204 sequencing] was also done.
+
-
 
+
-
== Shuttle vector in ''P. pastoris'' ==
+
-
After linearization by restriction with [[Team:Bielefeld-Germany/Protocols/Materials#Used_enzymes | ''EcoR''I]] and [[Team:Bielefeld-Germany/Protocols/Materials#Used_enzymes | ''Spe''I]] the shuttle vector could be transformed in competent ''P. pastoris'' cells. On
+
-
*Bild von Platte
+
-
*Testpcr: Untersuchung des Genotyps
+
-
 
+
-
== GFP integrated in shuttle vector ==
+
-
*Produkt fertig
+
-
* nächste Schritte: Transformation in P. pastoris, Genotyp-characterisierung, Kultivierung, Fluoreszensmessung
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<html>
+
-
+
</div>
</div>
<div id="anzeige">
<div id="anzeige">
 +
 +
<img src="https://static.igem.org/mediawiki/2012/5/56/Bielefeld2012_UCL.jpg" />
<h1>Collaboration with UCL</h1>
<h1>Collaboration with UCL</h1>
 +
<p class="more">
-
<p class="more">
 
</html>
</html>
-
The BioBrick [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729002 BBa_K729002] from the [https://2012.igem.org/Team:University_College_London University&nbsp;College&nbsp;London] was characterized by us. Therefore ''E. coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729002 BBa_K729002] and ''E. coli'' KRX as negative were cultivated shaking flasks and a growth kinetics determined. The harvested cells were lysed via [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Sonification sonification] and the supernatant was purified from substances with a low molecular weight. After purification it was analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#Sodium_dodecyl_sulfate_polyacrylamide_gel_electrophoresis_.28SDS-PAGE.29 SDS-PAGE], [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#Activity_measurements activity assay] as well as [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF]. A maximal activity of X was reached.
+
The BioBrick [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] from the [https://2012.igem.org/Team:University_College_London University&nbsp;College&nbsp;London] was characterized by us. Therefore ''E. coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] and ''E. coli'' KRX as a negative control were cultivated in shaking flasks and a growth kinetic was determined. The harvested cells were lysed via sonication and substances with a low molecular weight were seperated out of the supernatant. After purification the sample was analyzed by SDS-PAGE and MALDI-TOF.
-
For a comparison ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K7863005] was cultivated and also analysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#Sodium_dodecyl_sulfate_polyacrylamide_gel_electrophoresis_.28SDS-PAGE.29 SDS-PAGE] and [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#Activity_measurements activity assay].
+
For a comparison ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K7863005] was cultivated and analysed by SDS-PAGE as well as tested with a laccase activity assay. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K7863005] showed a similar behaviour in oxidizing ABTS.
-
<html>
+
[https://2012.igem.org/Team:Bielefeld-Germany/Results/london Read more.]
-
</html>
+
-
 
+
-
__NOTOC__
+
-
 
+
-
==Introduction==
+
-
 
+
-
==Sequencing analysis==
+
-
For the improvement of the data collection, the BioBrick of the University College London iGEM team was sequenced. The sequence analysis shows, that the sequence of the analyzed BioBrick is equal with the sequence published in the partsregistry.
+
-
[[File:Bielefeld2012_Sequencher.png|700px|thumb|center|A short part of the sequencing analysis results of the BioBrick<partsinfo>K729002</partsinfo> ]]
+
-
 
+
-
 
+
-
The next step was to prove, if the BioBrick is coding for a E.coli. In order to prove the coding sequence the analyzed BioBrick was blasted with [http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome NRNT]. The result of the Blast is shown in the picture.
+
-
[[File:Bielefeld2012_Blast_%C3%9Cbereinstimmender_UCL.png|1000px|center|thumb| Results of the DNA-Blast of the analyzed BioBrick <partsinfo>K729002</partsinfo> containing a coding sequnce of the ''E. coli'' lacccase]]
+
-
 
+
-
As might be expected the Biobricks codes for the multicopper oxidase of ''E. coli'' laccase. The query courage of 65% can be explained by the blasted DNA-sequence which represents the sequence of the VF2-Primer.
+
-
 
+
-
==Cultivation==
+
-
 
+
-
We transformed ''E. coli'' KRX with  the  BioBrick <partinfo>K729002</partinfo>  of the iGEM team of University College of London (including the DNA sequence of a laccase). The transformed cells were used to characterize the BioBrick by using our methods for cultivation,  cell disruption and activity determent .  The ''E. coli'' KRX containing <partinfo>K729002</partinfo> was cultivated 50&nbsp;mL for 12 h at 37°C (120 rpm) in 250&nbsp;mL shaking flasks without baffles. To generate a higher amount of the protein, we cultivated 200&nbsp;mL in a 1&nbsp;L shaking flask  without baffles. The OD<html><sub>600</sub></html> values were determined every hour.  To measure the influence of the transfered BioBrick on the growth of the cells, a negative control (E. coli KRX chassi)was cultivated identically . The Measured OD<html><sub>600</sub></html> are shown in the following picture:
+
-
 
+
-
[[File:Bielefeld2012_Wachstumskinetik_pLondon.jpg|450px|thumb|left| '''Figure 1:'''Comparison of the cultivated ''E. coli'' KRX  and ''E. coli'' KRX containing <partinfo>K729002</partinfo> cultivations. The OD<html><sub>600</sub></html> was determined every hour for 12&nbsp; h]]
+
-
 
+
-
Like expected the ''E. coli'' KRX containing <partinfo>K729002</partinfo> showed a lower growth rates compared to the negative controll. This can be explained by the protein expression of the transformed ''E. coli'' KRX during the cultivation.
+
-
 
+
-
The cells were harvested after 12&nbsp;h  by centrifuging. The harvested cells were resuspended in 100mM Na-Acetat-buffer, lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis sonification] and centrifuged at 10,000xg for 10 minutes. The supernatant was taken for SDS-PAGE and Activitytests.
+
-
 
+
-
<br style="clear: both" />
+
-
 
+
-
[[File:Bielefeld2012_0924.jpg|300px|thumb|left|'''Figure 2: SDS-PAGE of the lysis supernatants from cultivation ([https://2012.igem.org/Team:Bielefeld-Germany/Labjournal/week21#Sunday_September_23rd 09/23]).''' We cultivated ''E. coli'' KRX with <partinfo>BBa_K729006</partinfo> , ''E. coli'' KRX without plasmid (negative control) and with <partinfo>BBa_K863005</partinfo> (positive control), 60&nbsp;mL in 250&nbsp;mL flasks without baffles, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#LB_medium LB-medium] or [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] for <partinfo>BBa_K863005</partinfo>, 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C for 12&nbsp;hours.]]
+
-
 
+
-
<br style="clear: both" />
+
-
 
+
-
==Activity Tests==
+
-
Expecting the laccase in the supernatant of the lysed cell samples, we did activity tests using 198 µL of the sample and 2 µL ABTS. Since laccases are capable of oxidzing ABTS we are able to detect active laccases through measuring the absorption of oxidized ABTS at 420 nm. As a positive control we took the samples containing <partinfo>K863005</partinfo> which we already characterized. Using this approach we could not detect any activity over a period of 40 minutes (see Figure 1). To gain some activity we incubated the samples with 0.4 mM CuCl for at least 2 hours. After incubation time we started another setting using 198 µL of the samples containing <partinfo>K729002</partinfo> and <partinfo>K863005</partinfo> and applied 0.01 mM ABTS. The measurements lasted for 5 hours but the results did not show a decrease in oxidized ABTS again (see Figure 2). We figured out that contaminants in the samples, e.g. salts, could affect the activity of the tested laccases. The samples were rebuffered into deionized H<sub>2</sub>O using HiTrap Desalting Columns and then again incubated with 0.4 mM CuCl for 2 hours. This time the measurement setup differed because no buffer remained in the samples. The new measurements were done with 100 mM sodium acetate buffer (pH 5), 158 µL sample and 0.01 mM ABTS for 5 hours at a temperature of 25°C. This preparation of the samples led to oxidizing activity of the laccases and therefore to an increase in oxidized ABTS (see Figure 3). After 5 hours both laccases, <partinfo>K729002</partinfo> and <partinfo>K863005</partinfo>, showed great activity and had oxidized ~8 µM ABTS. Since both laccases derive from the same organism they both show a similar reaction behavior.
+
-
<center>
+
-
[[File:Bielefeld2012_London_ohnecu_mitsalz.jpg|240px|left|thumbnail|Figure 1: Activity measurement of <partinfo>K729002</partinfo> and <partinfo>K863005</partinfo> using ABTS over a time period of 40 minutes. No increase in oxidized ABTS is distinguishable.]]
+
-
[[File:Bielefeld2012_London_cu.jpg|240px|left|thumbnail|Figure 2: Activity measurement of <partinfo>K729002</partinfo> and <partinfo>K863005</partinfo> after a 2 hour incubation with 0.4 mM CuCl using ABTS over a time period of 5 hours. No activity of both laccases can be detected since there is no increase in oxidized ABTS.]]
+
-
[[File:Bielefeld2012_London_umgepuffert_cu.jpg|240px|left|thumbnail|Figure 3: Activity measurement of <partinfo>K729002</partinfo> and <partinfo>K863005</partinfo> after desalting and a 2 hour incubation with 0.4 mM CuCl using ABTS over a time period of 5 hours. A considerable increase in oxidized ABTS is noticeable. After 5 hours both laccases were capable of oxidizing 8 µM ABTS.]]
+
-
</center>
+
-
 
+
<html>
<html>
 +
</p>
</div>
</div>
-
</div>
 
-
<div id="navresultunten" class="tabs">
 
-
<div class="scroller">
 
-
<ul style="list-style-type:none">
 
-
<li><a href="#1"><strong>Summary</strong></a></li>
 
-
<li><a href="#2"><strong>Datapage</strong></a></li>
 
-
<li><a href="#3"><strong>BPUL</strong></a></li>
 
-
<li><a href="#4"><strong>ECOL</strong></a></li>
 
-
<li><a href="#5"><strong>TTHL</strong></a></li>
 
-
                <li><a href="#6"><strong>BHAL</strong></a></li>
 
-
<li><a href="#7"><strong>TVE??</strong></a></li>
 
-
<li><a href="#8"><strong>Immobilization</strong></a></li>
 
-
<li><a href="#9"><strong>Substrate Analytics</strong></a></li>
 
-
<li><a href="#10"><strong>CBD</strong></a></li>
 
-
<li><a href="#11"><strong>Shuttle vector</strong></a></li>
 
-
                <li><a href="#12"><strong>Collaboration with UCL</strong></a></li>
 
-
</ul>
 
-
  </div>
 
</div>
</div>
-
<script>
+
 
-
$(function() {
+
-
+
-
+
-
$("#navresultunten ul").tabs("#panesresult > div", {effect: 'fade', fadeOutSpeed: 400});
+
-
});
+
-
</script>
+
Line 822: Line 263:
</html>
</html>
-
html>
 
-
 
-
== PCIL - Laccase from ''Pycnoporus cinnabarinus'' ==
 
-
 
-
== TVEL5 - Laccase from ''Trametes versicolor '' ==
 
-
 
-
== TVEL10 - Laccase from ''Trametes versicolor '' ==
 
-
 
-
== TVEL13 - Laccase from ''Trametes versicolor'' ==
 
-
== TVEL20 - Laccase from ''Trametes versicolor'' ==
 
{{Team:Bielefeld/Sponsoren}}
{{Team:Bielefeld/Sponsoren}}

Latest revision as of 00:15, 3 December 2012

Results

Summary

All BioBricks of the iGEM Team Bielefeld were screened to identify the best conditions for protein expression. The first trials were made by shaking flask cultivations with different parameters. These parameters were various shaking flask designs, different temperatures, different concentrations of chloramphenicol, various induction strategies, several cultivation times and some cultivations in absence or presence of CuCl2. To detect the produced laccases, different analysis methods were performed like SDS-PAGE analysis as well as MALDI-TOF. The iGEM Team successfully produced four active bacterial laccases and succeeded to purify four of them. Besides the successfully scale-up fermentation, these laccases could be purified in a high amount to characterize the optimal activity conditions regarding pH, temperature, buffer solutions and organic solvent resistance. Furthermore, the iGEM Team Bielefeld demonstrated that the produced laccases can be immobilized maintaining their activity and the degradation capacity was screened for several micro-contaminants. These tests indicate that all of our produced laccases are able to degrade estradiol and the two laccases TTHL and BPUL are able to degrade ethinyl-estradiol in combination with a mediator. At this moment, the self-designed shuttle-vector for the production of eukaryotic laccases in yeast is ready to go. This vector was tested to integrate by courtesy of homologous recombination genes of eukaryotic laccases into Pichia Pastoris and produce them in an active form. First experiments show a successful production of one laccase of Trametes versicolor. A cheap alternative purification and immobilization method via a cellulose binding tag is also close at hand. During our research, we cultivated the following BioBricks and produced several laccase. To simplify the presentation of our results we named the produced laccase like the corresponding system.

Produced and generated BioBricks with the source strain of the DNA-sequence, promoter, protein name and the names given by the iGEM Team Bielefeld
BioBrick code strain promoter name of protein name given by the iGEM Team
<partinfo>K863000</partinfo> Bacillus pumilus DSM 27 T7 promoter CotA BPUL
<partinfo>K863005</partinfo> E. coli BL21(DE3) T7 promoter CueO ECOL
<partinfo>K863010</partinfo> Thermus thermophilus HB27 T7 promoter tthL TTHL
<partinfo>K863012</partinfo> Thermus thermophilus HB27 constitutive promoter (<partinfo>BBa_J23100</partinfo>) tthL TTHL
<partinfo>K863015</partinfo> Xanthomonas campestris pv. campestris B100 T7 CopA XCCL
<partinfo>K863020</partinfo> Bacillus halodurans C-125 T7 Lbh1 BHAL
<partinfo>K863022</partinfo> Bacillus halodurans C-125 constitutive promoter (<partinfo>BBa_J23100</partinfo>) Lbh1 BHAL
<partinfo>K863030</partinfo> Trametes versicolor AOX1 promoter TVL5 TVEL5

Datapage

iGEM Team Bielefeld is developing a biological filter using immobilized laccases, enzymes able to radicalize and break down a broad range of aromatic substances. For the production of laccases from different bacteria, fungi and plants, two expression systems are used: Escherichia coli and the yeast Pichia pastoris. Immobilization is carried out either by using CPC-silica beads or by fusing the enzymes to cellulose binding domains. The concept could be extended to other toxic pollutants in drinking and wastewater, as well as to industrial applications in paper and textile industries or even for bioremediation of contaminated soil.

Read more.

Laccases

The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):

All bacterial laccases (ECOL, BHAL, TTHL and BPUL) we accomplished to purify. Besides the successfully scale-up fermentation these laccases could be purified in a high amount to characterize the optimal activity conditions regarding pH, temperature, buffer solutions and organic solvent resistance. Furthermore the iGEM Team Bielefeld demonstrated that the produced laccases can be immobilized maintaining their activity and the degradation capacity was screened for several micro-contaminants. These tests indicate that they are able to degrade estradiol and ethinyl-estradiol.

Immobilization

Using commercially acquired laccases from Trametes versicolor (named TVEL0) as a standard, it was possible to optimize an immobilization method of the purified laccases from

  • [http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29 E. coli BL21 (DE3)] (named ECOL)
  • [http://www.dsmz.de/catalogues/details/culture/DSM-27.html Bacillus pumilus DSM 27 (ATCC7061)] (named BPUL)
  • [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 Bacillus halodurans C-125 ] (named BHAL) and from
  • [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso Thermus thermophilus HB27] (named TTHL)

on CPC-silica beads. All four purified laccases were successfully immobilized, with ECOL and BPUL showing the highest binding ability to beads. Moreover, all four immobilized laccases showed activity. Whereas immobilized BPUL showed a relatively high activity, the results couldn't be compared to BHAL und TTHL due to the low concentration of the latters. For immobilization results see here

Substrate Analysis

To establish the methods for degradation analysis of different substrates TVEL0 was used as positive control. After that the four produced bacterial laccases were analyzed. The HPLC results showed that estradiol and ethinyl estradiol ( with addition of ABTS) are degradable with our laccases.To determine degradation products of estradiol and ethinyl estradiol after laccase treatment LCMS-MS analysis were done. For more informations click here.

Cellulose binding domain

A cheap alternative purification method combined with a powerful immobilization tool could be the solution to prevail over other more expensive water cleaning methods like oxidization with ozone or using tons of activated carbon which just capture microcontaminates, but does not dismantle them. A promising solution to this could be cellulose binding domains (CBDs). Cellulose is ubiquitous and sustainable. Following this idea fusion-protein-constructs with cellulose binding domains have been made. To characterize a GFP has been introduced as a C or N-terminal domain of the cellulose binding protein. After delays in cloning the constructs for two fusion proteins with a T7-promoter could be finished, but did not express the protein in E. coli KRX and BL21. An alternative construct with a constitutive promoter could also be finished, but gave the same results. Changing the order of CBD and GFP was carried out, but was hampered by a base deletion in the GFP gene causing a frame shift and could not be redone in time.

Read more

Shuttle vector

A shuttle vector for site-directed recombination into the yeast P. pastoris does not exist in the parts registry and could be developed by our team. With this system it is possible to recombine a protein of interest with a N-terminal mating factor alpha 1 for secretion the protein into the media. This protein of interest could be cloned in frame with one restriction ligate cloning step. The selection depends not on an antibiotic resistance like zeocine, but on a complementation of histidine auxotrophy. This system is for us important because some of our laccases can not be expressed in the prokaryotic expression system E. coli, because the protein needs glycosylation. Read more.

Collaboration with UCL

The BioBrick [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] from the University College London was characterized by us. Therefore E. coli KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] and E. coli KRX as a negative control were cultivated in shaking flasks and a growth kinetic was determined. The harvested cells were lysed via sonication and substances with a low molecular weight were seperated out of the supernatant. After purification the sample was analyzed by SDS-PAGE and MALDI-TOF. For a comparison E. coli KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K7863005] was cultivated and analysed by SDS-PAGE as well as tested with a laccase activity assay. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K7863005] showed a similar behaviour in oxidizing ABTS. Read more.


55px Logo merck.jpg BioCircle.JPG Bielefeld2012 Evonik.jpg Bielefeld2012 Baxter.png Logo knauer.jpg Logo iit.jpg Bielefeld2012 BIEKUBA.jpg Logo biometra.jpg Logo bio-nrw.png Bielefeld2012 Logo ERASynbio.jpg

About our Wiki

Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach.

Contact Us

Universität Bielefeld
Universitätsstraße 25
D-33615 Bielefeld

info(at)igem-bielefeld.de

Navigate our Wiki

Start

Team

Project

Results

Since Regionals

Human Practice

Safety

Judging

Partner

Retrieved from "http://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"