Team:TU-Delft/results

From 2012.igem.org

(Difference between revisions)
Line 96: Line 96:
<img src="https://static.igem.org/mediawiki/igem.org/d/d6/AgaroseinTAE_1.png"  align="center" width="250" height="300" />
<img src="https://static.igem.org/mediawiki/igem.org/d/d6/AgaroseinTAE_1.png"  align="center" width="250" height="300" />
<h6>Figure 1 1% agarose in TAE ~45 run on 80 Volts. In the picture can be seen: 1 SmartLadder, 2 Far1 short PCR product, 3 Far1 long PCR product, 4 Gpa1 short PCR product, 5 Gpa1 long PCR product, 6 Atf1 short PCR product, 7 Atf1 long PCR product.</h6>
<h6>Figure 1 1% agarose in TAE ~45 run on 80 Volts. In the picture can be seen: 1 SmartLadder, 2 Far1 short PCR product, 3 Far1 long PCR product, 4 Gpa1 short PCR product, 5 Gpa1 long PCR product, 6 Atf1 short PCR product, 7 Atf1 long PCR product.</h6>
 +
<br/>
 +
 +
<p>Gel extraction of the GPA1 PCR product is performed using the Qiagen gel extraction kit. The end concentration of this step is measured to be 167.2 ng/µl using the nanodrop nucleotide program.</p>
 +
<br/>
 +
<p>The PCR reactions using FAR1 and ATF1 primers with the same conditions as table 1 but with the PCR program according to table 2 is performed yielding no result.</p>
 +
<br/><br/>
 +
<h6>Table 2 PCR program for elongation of knockout cassette for knocking out Far1 and Gpa1 and primers used for elongation.</h6>
 +
<table id="tbtext">
 +
 +
</table>
 +
<tr>
 +
<td><h3>Repeats</h3>
 +
<td><h3>Temperature</h3>
 +
<td></td>
 +
<td><h3>Duration</h3></td>
 +
</tr>
 +
</div>
</div>
<img src="https://static.igem.org/mediawiki/igem.org/3/37/Footer_2.jpg" align="middle" width="690">
<img src="https://static.igem.org/mediawiki/igem.org/3/37/Footer_2.jpg" align="middle" width="690">
</body></html>
</body></html>

Revision as of 17:13, 12 August 2012

Menu

Making knockout strain (far1::kanmx, gpa1::URA) and preparation of knocking out atf1

Week of 05-07-12

For making a functional knockout, yeast strains BY4741; Mat a; his3D1; leu2D0; met15D0; ura3D0; YJL157c::kanMX4 and BY4741; Mat a; his3D1; leu2D0; met15D0; ura3D0; YHR005c::kanMX4 were used (Euroscarf). Also knockout cassette pUG72 is used (Euroscarf). The LoxP-Ura-LoxP is elongated using the pFx polymerase protocol. The PCR program and primer sequences in table 1 yielded a product which is put on a gel shown in figure 1. Here a band can be recognized between 2000 and 1500 nucleotides, which corresponds to the 1669 nucleotide PCR product.


Table 1 PCR program for elongation of knockout cassette for knocking out Far1 and Gpa1 and primers used for elongation.

Repeats

Temperature

Duration

5x 95 Melting 2:00
51 Annealing 1:00
68 Elongation 2:00
25x 95 Melting 2:00
61 Annealing 1:00
68 Elongation 2:00

GPA ko fw
TTAGCATCACATCAATAATCCAGAGGTGTATAAATTGATATATTAAGGTAGGAAATAATGCAGCTGAAGCTTCGTACGC
GPA ko rv
TGCATCTTCGGAAACAGAATTTACGTATCTAAACACTACTTTAATTATACAGTTCCTTCAGCATAGGCCACTAGTGGATCTG
FAR1 ko fw
ACACAAAGTCTATAGATCCACTGGAAAGCTTCGTGGGCGTAAGAAGGCAATCTATTAATGCAGCTGAAGCTTCGTACGC
FAR1 ko rv
GAAAAAAAAAAAAGGAAAAGCAAAAGCCTCGAAATACGGGCCTCGATTCCCGAACTACTAGCATAGGCCACTAGTGGATCTG
GPA ko fw short
TAATCCAGAGGTGTATAAATTGATATATTAAGGTAGGAAATAATGCAGCTGAAGCTTCGTACGC
GPA ko rv short
AGAATTTACGTATCTAAACACTACTTTAATTATACAGTTCCTTCAGCATAGGCCACTAGTGGATCTG
FAR1 ko fw short
ATCCACTGGAAAGCTTCGTGGGCGTAAGAAGGCAATCTATTAATGCAGCTGAAGCTTCGTACGC
FAR1 ko rv short
AAAAGCAAAAGCCTCGAAATACGGGCCTCGATTCCCGAACTACTAGCATAGGCCACTAGTGGATCTG
ATF1 ko fw
gaaaataaaaaacggCACTTCATCAGTATCACAAATACCATCAATTTATCAGCTCTCATGCAGCTGAAGCTTCGTACGC
ATF1 ko rv
ggttatttacacgacatAATCATATTGTCGAATAATATCAGTCAAGCATCATGTGAGATCTAGCATAGGCCACTAGTGGATCTG
ATF1 ko fw short
CACTTCATCAGTATCACAAATACCATCAATTTATCAGCTCTCATGCAGCTGAAGCTTCGTACGC
ATF1 ko rv short
AATCATATTGTCGAATAATATCAGTCAAGCATCATGTGAGATCTAGCATAGGCCACTAGTGGATCTG

Figure 1 1% agarose in TAE ~45 run on 80 Volts. In the picture can be seen: 1 SmartLadder, 2 Far1 short PCR product, 3 Far1 long PCR product, 4 Gpa1 short PCR product, 5 Gpa1 long PCR product, 6 Atf1 short PCR product, 7 Atf1 long PCR product.

Gel extraction of the GPA1 PCR product is performed using the Qiagen gel extraction kit. The end concentration of this step is measured to be 167.2 ng/µl using the nanodrop nucleotide program.


The PCR reactions using FAR1 and ATF1 primers with the same conditions as table 1 but with the PCR program according to table 2 is performed yielding no result.



Table 2 PCR program for elongation of knockout cassette for knocking out Far1 and Gpa1 and primers used for elongation.

Repeats

Temperature

Duration