|
|
(34 intermediate revisions not shown) |
Line 1: |
Line 1: |
- | <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" dir="ltr" lang="en"><head>
| + | {{GoettingenHeader|deu=Team:Goettingen/week10-3|eng=Team:Goettingen/week10-3}} |
- | <meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
| + | |
- | <meta name="keywords" content="Team:Goettingen,Team:Goettingen,Team:Goettingen/Homing coli,Team:Goettingen/Human Practice/Flash coli,Team:Goettingen/Press,Team:Goettingen/Project/General information">
| + | |
- | <link rel="shortcut icon" href="https://2012.igem.org/favicon.ico">
| + | |
- | <link rel="search" type="application/opensearchdescription+xml" href="https://2012.igem.org/wiki/opensearch_desc.php" title="2012.igem.org (English)">
| + | |
- | <link title="Creative Commons" type="application/rdf+xml" href="https://2012.igem.org/wiki/index.php?title=Team:Goettingen&action=creativecommons" rel="meta">
| + | |
- | <link rel="alternate" type="application/rss+xml" title="2012.igem.org RSS Feed" href="https://2012.igem.org/wiki/index.php?title=Special:Recentchanges&feed=rss">
| + | |
- | <link rel="alternate" type="application/atom+xml" title="2012.igem.org Atom Feed" href="https://2012.igem.org/wiki/index.php?title=Special:Recentchanges&feed=atom">
| + | |
- | | + | |
- | | + | |
- | <body class="mediawiki ns-0 ltr page-Team_Goettingen">
| + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | <!-- start content -->
| + | |
- | | + | |
- | | + | |
- | | + | |
- | <style>
| + | |
- | h1.firstHeading { display: none; }
| + | |
- | | + | |
- | p {text-align: justify;}
| + | |
- | | + | |
- | a:link { color: #004080; text-decoration: none}
| + | |
- | a:visited { color:##003090; text-decoration: none}
| + | |
- | a:hover { color:#f29400; text-decoration: none}
| + | |
- | a:active { color:#f29400; text-decoration: none}
| + | |
- | | + | |
- | #bodyContent { padding: 10px auto; width: 910px; margin: auto; clear: none; }
| + | |
- | | + | |
- | table#team_members { text-align: justify; border: 0; }
| + | |
- | table#team_members h2, table#team_members h3 { clear: both; }
| + | |
- | | + | |
- | | + | |
- | /*-----------------------------------------------------------------------------------------------*/
| + | |
- | div.MenuBar ul li ul.DropDownMenu {
| + | |
- | display: none; /* Hides all drop-down menus. */
| + | |
- | | + | |
- | }
| + | |
- | /*
| + | |
- | li:hover works in IE7 and FF2.
| + | |
- | a:hover works in IE6 and FF2.
| + | |
- | a:hover breaks li:hover in FF2.
| + | |
- | */
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li ul.SideMenu,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a ul.SideMenu {
| + | |
- | display: none; /* Hides all side menus. */
| + | |
- | }
| + | |
- | /*------------------------------------------------------------------------------------- Menu Bar */
| + | |
- | div.MenuBar {
| + | |
- | font: Verdana;
| + | |
- | height: 30px;
| + | |
- | width: 910px;
| + | |
- | /*width: 100%*/
| + | |
- | margin: 0;
| + | |
- | border-top: 0;
| + | |
- | border-right: 0;
| + | |
- | border-left: 0;
| + | |
- | padding: 0;
| + | |
- | background: #00446b;
| + | |
- | | + | |
- | }
| + | |
- | div.MenuBar ul {
| + | |
- | font: Verdana;
| + | |
- | text-align: center;
| + | |
- | list-style-type: none;
| + | |
- | margin: 0 auto;
| + | |
- | border: 0;
| + | |
- | padding: 0;
| + | |
- | background: #00446b;
| + | |
- | }
| + | |
- | div.MenuBar ul li {
| + | |
- | font: Verdana;
| + | |
- | display: block;
| + | |
- | padding: 0;
| + | |
- | margin: 0;
| + | |
- | font-size: 1.3em;
| + | |
- | float: left;
| + | |
- | background: #00446b;
| + | |
- | text-align: center;
| + | |
- | width: 107px;
| + | |
- | position: relative; /* Sets the positioning context for each drop-down menu. */
| + | |
- | }
| + | |
- | | + | |
- | div.MenuBar ul li a {
| + | |
- | font: Verdana;
| + | |
- | display: block;
| + | |
- | background: #00446b;
| + | |
- | height: 22px; /* Keep height + padding-top + padding-bottom sync with the menu bar height. */
| + | |
- | color: white;
| + | |
- | padding-top: 4px;
| + | |
- | padding-bottom: 4px;
| + | |
- | padding-left: 1em; /* Sets the left space between top-level items. */
| + | |
- | padding-right: 1em; /* Sets the right space between top-level items. */
| + | |
- | text-decoration: none;
| + | |
- | }
| + | |
- | | + | |
- | /*------------------------------------------------------------------------------ Drop-Down Menus */
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu {
| + | |
- | display: block;
| + | |
- | width: 10em; /* Drop-down menu width.
| + | |
- | Use MenuTailor.css to customize. */
| + | |
- | height: 1em;
| + | |
- | padding: 1px; /* Sets the drop-down menu "effective border" width. */
| + | |
- | position: absolute;
| + | |
- | top: 28px; /* Places the drop-down menu under the menu bar.
| + | |
- | Keep it sync with the menu bar height. */
| + | |
- | left: 0; /* Aligns the drop-down menu to its top-level item. */
| + | |
- | background-color: #A3C0E0; /* Selected item. */
| + | |
- | color: #FFFFFF;
| + | |
- | | + | |
- | }
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li a,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a {
| + | |
- | width: 10em; /* Keep it sync with the drop-down menu width.
| + | |
- | Use MenuTailor.css to customize. */
| + | |
- | height: 1em;
| + | |
- | padding-left: 0;
| + | |
- | padding-right: 0;
| + | |
- | background-color: #A3C0E0; /* Selected item. */
| + | |
- | color: #FFFFFF;
| + | |
- | }
| + | |
- | ul.DropDownMenu li a span {
| + | |
- | display: block;
| + | |
- | padding-left: 0.75em; /* Sets the left space of each drop-down menu item. */
| + | |
- | padding-right: 0.25em; /* Sets the right space of each drop-down menu item. */
| + | |
- | text-align: right; /* Aligns the >> symbol to the right. */
| + | |
- | }
| + | |
- | ul.DropDownMenu li a span span {
| + | |
- | float: left; /* Aligns the text (back) to the left. */
| + | |
- | font: 12px Verdana; /* Required for IE55. */
| + | |
- | height: 20px;
| + | |
- | color: #FFFFFF;
| + | |
- | }
| + | |
- | /*----------------------------------------------------------------------------------- Side Menus */
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
| + | |
- | display: block;
| + | |
- | width: 11em; /* Side menu width.
| + | |
- | Use MenuTailor.css to customize. */
| + | |
- | padding: 1px; /* Sets the side menu "effective border" width. */
| + | |
- | position: absolute;
| + | |
- | top: -1px; /* Aligns the side menu to its drop-down menu item.
| + | |
- | Keep it sync with the side menu "effective border" width. */
| + | |
- | left: 13em; /* Places the side menu to the right of the drop-down menu.
| + | |
- | Keep it sync with the drop-down menu width.
| + | |
- | Use MenuTailor.css to customize. */
| + | |
- | }
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
| + | |
- | width: 11em; /* Keep it sync with the side menu width.
| + | |
- | Use MenuTailor.css to customize. */
| + | |
- | font: 12px Verdana; /* Required for IE55. */
| + | |
- | left: 13em; /* Places the side menu to the right of the drop-down menu.
| + | |
- | Keep it sync with the drop-down menu width.
| + | |
- | Use MenuTailor.css to customize. */
| + | |
- | }
| + | |
- | div.MenuBar ul li ul.DropDownMenu li ul.SideMenu li a span {
| + | |
- | padding-left: 1.5em; /* Sets the left space of each side menu item. */
| + | |
- | padding-right: 0.5em; /* Sets the right space of each side menu item. */
| + | |
- | text-align: left;
| + | |
- | font: 12px Verdana; /* Required for IE55. */
| + | |
- | left: 13em; /* Places the side menu to the right of the drop-down menu.
| + | |
- | Keep it sync with the drop-down menu width.
| + | |
- | Use MenuTailor.css to customize. */
| + | |
- | }
| + | |
- | /*----------------------------------------------------------------------------- Browser Specific */
| + | |
- | * html div.MenuBar ul li a {
| + | |
- | float: left; /* Required for IE55 and IE6.
| + | |
- | Breaks O9.
| + | |
- | Hidden (* html) from non-IE browsers. */
| + | |
- | }
| + | |
- | * html ul.DropDownMenu li a:hover {
| + | |
- | cursor: hand; /* Required for IE55.
| + | |
- | Hidden (* html) from non-IE browsers. */
| + | |
- | }
| + | |
- | ul.DropDownMenu li a:hover {
| + | |
- | cursor: pointer; /* Required for IE6 and IE7.
| + | |
- | Hidding it (* html) from non-IE browsers breaks IE7!
| + | |
- | }
| + | |
- | * html div.MenuBar a:hover {
| + | |
- | text-decoration: none; /* Required for IE55 and IE6.
| + | |
- | Hidden (* html) from non-IE browsers. */
| + | |
- | }
| + | |
- | * html div.MenuBar ul li table,
| + | |
- | * html div.MenuBar ul li table td {
| + | |
- | border: 0; /* Required for IE55 and IE6.
| + | |
- | Hidden (* html) from non-IE browsers. */
| + | |
- | }
| + | |
- | /*------------------------------------------------------------------------------- Default Colors */
| + | |
- | div.MenuBar {
| + | |
- | background-color: Menu;
| + | |
- | border-bottom: 1px solid ButtonShadow;
| + | |
- | }
| + | |
- | div.MenuBar a {
| + | |
- | background-color: Menu; /* Top-level unselected items. */
| + | |
- | color: MenuText;
| + | |
- | }
| + | |
- | div.MenuBar ul li:hover a,
| + | |
- | div.MenuBar ul li a:hover {
| + | |
- | color: #A3C0E0;
| + | |
- | background-color: Highlight; /* Top-level selected item. */
| + | |
- | color: HighlightText;
| + | |
- | }
| + | |
- | /*...............................................................................................*/
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu {
| + | |
- | background-color: ButtonShadow; /* Sets the drop-down menu "effective border" color. */
| + | |
- | }
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li a,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a {
| + | |
- | background-color: Menu; Drop-down menu unselected items.
| + | |
- | Sets the drop-down menu "effective background" color. */
| + | |
- | color: MenuText;
| + | |
- | }
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li:hover a,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover {
| + | |
- | background-color: Highlight; /* Drop-down menu selected item. */
| + | |
- | color: HighlightText;
| + | |
- | }
| + | |
- | /*...............................................................................................*/
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
| + | |
- | background-color: ButtonShadow; /* Sets the side menu "effective border" color. */
| + | |
- | }
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
| + | |
- | background-color: Menu; /* Side menu unselected items.
| + | |
- | Sets the side menu "effective background" color. */
| + | |
- | color: MenuText;
| + | |
- | }
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {
| + | |
- | background-color: Highlight; /* Side menu selected item. */
| + | |
- | color: HighlightText;
| + | |
- | }
| + | |
- | /*-----------------------------------------------------------------------------------------------*/
| + | |
- | | + | |
- | /*-------------------------------------------------------------------------------------- General */
| + | |
- | body {
| + | |
- | background: white;
| + | |
- | color: black;
| + | |
- | margin: 0;
| + | |
- | border: 0;
| + | |
- | padding: 0;
| + | |
- | }
| + | |
- | | + | |
- | | + | |
- | div.MenuBar {
| + | |
- | font: 13px arial, helvetica, sans-serif;
| + | |
- | }
| + | |
- | div.MenuBar ul {
| + | |
- | font: 13px arial, helvetica, sans-serif; /* Required for IE55. */
| + | |
- | }
| + | |
- | /*--------------------------------------------------------------------------------------- Colors */
| + | |
- | div.MenuBar {
| + | |
- | background-color: #0064C8; /* Selected item. */
| + | |
- | color: #FFFFFF;
| + | |
- | border-bottom: 1px solid ButtonShadow;
| + | |
- | }
| + | |
- | div.MenuBar a,
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li a,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a,
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
| + | |
- | background-color: #00446b; /* Selected item. */
| + | |
- | color: #FFFFFF;
| + | |
- | }
| + | |
- | div.MenuBar ul li:hover a,
| + | |
- | div.MenuBar ul li a:hover,
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li:hover a,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover,
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {
| + | |
- | background-color: #A3C0E0; /* Selected item. */
| + | |
- | color: #FFFFFF;
| + | |
- | }
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu,
| + | |
- | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
| + | |
- | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
| + | |
- | background-color: ButtonShadow; /* Sets the drop-down and side menus "effective border" color. */
| + | |
- | }
| + | |
- | /*--------------------------------------------------------------------------------------- Widths */
| + | |
- | /*
| + | |
- | | + | |
- | /*
| + | |
- | Menu Bar 1
| + | |
- | Drop-Down Menu #2
| + | |
- | */
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4,
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4 li a,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4 li a {
| + | |
- | width: 15.5em; /* Drop-down menu width. */
| + | |
- | }
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5,
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5 li a,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5 li a {
| + | |
- | width: 14em; /* Drop-down menu width. */
| + | |
- | }
| + | |
- | | + | |
- | /*...............................................................................................*/
| + | |
- | /*
| + | |
- | Menu Bar 1
| + | |
- | Drop-Down Menu #2
| + | |
- | Side Menu #1
| + | |
- | */
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 {
| + | |
- | left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.
| + | |
- | Keep it sync with the drop-down menu width. */
| + | |
- | }
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1,
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1 li a,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 li a {
| + | |
- | width: 15em; /* Side menu width. */
| + | |
- | }
| + | |
- | /*...............................................................................................*/
| + | |
- | /*
| + | |
- | Menu Bar 1
| + | |
- | Drop-Down Menu #2
| + | |
- | Side Menu #2
| + | |
- | */
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 {
| + | |
- | left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.
| + | |
- | Keep it sync with the drop-down menu width. */
| + | |
- | }
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2,
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2 li a,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 li a {
| + | |
- | width: 7em; /* Side menu width. */
| + | |
- | }
| + | |
- | /*...............................................................................................*/
| + | |
- | /*
| + | |
- | Menu Bar 1
| + | |
- | Drop-Down Menu #2
| + | |
- | Side Menu #3
| + | |
- | */
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 {
| + | |
- | left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.
| + | |
- | Keep it sync with the drop-down menu width. */
| + | |
- | }
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3,
| + | |
- | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3 li a,
| + | |
- | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 li a {
| + | |
- | width: 17em; /* Side menu width. */
| + | |
- | }
| + | |
- | /*...............................................................................................*/
| + | |
- | | + | |
- | </style>
| + | |
- | | + | |
- | | + | |
- | | + | |
- | </p><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" dir="ltr" lang="en"><head>
| + | |
- | <meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
| + | |
- | <meta name="keywords" content="Team:Goettingen,Team:Goettingen,Team:Goettingen/Homing coli,Team:Goettingen/Human Practice/Flash coli,Team:Goettingen/Press,Team:Goettingen/Project/General information">
| + | |
- | <link rel="shortcut icon" href="https://2012.igem.org/favicon.ico">
| + | |
- | <link rel="search" type="application/opensearchdescription+xml" href="https://2012.igem.org/wiki/opensearch_desc.php" title="2012.igem.org (English)">
| + | |
- | <link title="Creative Commons" type="application/rdf+xml" href="https://2012.igem.org/wiki/index.php?title=Team:Goettingen&action=creativecommons" rel="meta">
| + | |
- | <link rel="alternate" type="application/rss+xml" title="2012.igem.org RSS Feed" href="https://2012.igem.org/wiki/index.php?title=Special:Recentchanges&feed=rss">
| + | |
- | <link rel="alternate" type="application/atom+xml" title="2012.igem.org Atom Feed" href="https://2012.igem.org/wiki/index.php?title=Special:Recentchanges&feed=atom">
| + | |
- | | + | |
- | | + | |
- | <body class="mediawiki ns-0 ltr page-Team_Goettingen">
| + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | <!-- start content -->
| + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | <p></p><div id="header"><img src="http://www.patrickreinke.de/igem/headpicture_2.jpg" alt="Team Goettingen">
| + | |
- | <br><br></p><div class="MenuBar" id="navi">
| + | |
- | <ul>
| + | |
- | <li>
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen" style="color: white;">Home<!--[if gt IE 6]><!--></a><!--<![endif]-->
| + | |
- | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| + | |
- | <!--<ul class="DropDownMenu" id="MB1-DDM6">
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Team"><span><span>News</span></span></a></li>
| + | |
- | </ul> -->
| + | |
- | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| + | |
- | </li>
| + | |
- | <li>
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Team" style="color: white;">Team<!--[if gt IE 6]><!--></a><!--<![endif]-->
| + | |
- | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| + | |
- | <ul class="DropDownMenu" id="MB1-DDM5">
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Team"><span><span>Members</span></span></a></li>
| + | |
- | <!--<li><a href="https://2012.igem.org/Team:Goettingen/Team#advisor"><span><span><div style="text-indent:20px;">⋅ Advisors</div></span></span></a></li> -->
| + | |
- | <!--<li><a href="https://2012.igem.org/Team:Goettingen/Team#students"><span><span><div style="text-indent:20px;">⋅ Students</div></span></span></a></li> -->
| + | |
- | <!--<li><li><a href="https://2012.igem.org/Team:Goettingen/Team#responsibitlities"><span><span><div style="text-indent:20px;">⋅ Responsibilities</div></span></span></a></li> -->
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Focus_Groups"><span><span>Focus Groups</span></span></a></li>
| + | |
- | <!--<li><li><a href="https://2012.igem.org/Team:Goettingen/groups#group1"><span><span><div style="text-indent:20px;">⋅ #1 Selection / Swimming</div></span></span></a></li> -->
| + | |
- | <!--<li><li><a href="https://2012.igem.org/Team:Goettingen/groups#group2"><span><span><div style="text-indent:20px;">⋅ #2 Speed Improvement</div></span></span></a></li> -->
| + | |
- | <!--<li><li><a href="https://2012.igem.org/Team:Goettingen/groups#group3"><span><span><div style="text-indent:20px;">⋅ #3 Chemoreceptor</div></span></span></a></li> -->
| + | |
- | <!--<li><li><a href="https://2012.igem.org/Team:Goettingen/groups#library"><span><span><div style="text-indent:20px;">⋅ Library</div></span></span></a></li> -->
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Seminars"><span><span>Seminars</span></span></a></li>
| + | |
- | <!--<li><li><a href="https://2012.igem.org/Team:Goettingen/seminars#announce"><span><span><div style="text-indent:20px;">⋅ Announcements</div></span></span></a></li> -->
| + | |
- | <!--<li><li><a href="https://2012.igem.org/Team:Goettingen/seminars#presentations"><span><span><div style="text-indent:20px;">⋅ Past Presentations</div></span></span></a></li> -->
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Work_Impressions"><span><span>Work Impressions</span></span></a></li>
| + | |
- | </ul>
| + | |
- | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| + | |
- | </li>
| + | |
- | <li>
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Project" style="color: white;">Project<!--[if gt IE 6]><!--></a><!--<![endif]-->
| + | |
- | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| + | |
- | <ul class="DropDownMenu" id="MB1-DDM2-SM3">
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Project"><span><span>Our Project</span></span></a></li>
| + | |
- | <!--<li></li><li><a href="https://2012.igem.org/Team:Goettingen/Chemotaxis"><span><span><div style="text-indent:20px;">⋅ Chemotaxis</div></span></span></a></li> -->
| + | |
- | <!--<li></li><li><a href="https://2012.igem.org/Team:Goettingen/Poster"><span><span><div style="text-indent:20px;">⋅ Poster</div></span></span></a></li> -->
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Project/Materials"><span><span>Materials</span></span></a>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Project/Methods"><span><span>Methods</span></span></a>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Project/Computational_Data"><span><span>Computational Data</span></span></a>
| + | |
- | <!--</li><li><a href="https://2012.igem.org/Team:Goettingen/Maps"><span><span><div style="text-indent:20px;">⋅ Maps</div></span></span></a></li>
| + | |
- | </li><li><a href="https://2012.igem.org/Team:Goettingen/Sequences"><span><span><div style="text-indent:20px;">⋅ Sequences</div></span></span></a></li> -->
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Project/Bioinformatical_Tool"><span><span>Bioinformatical Tools</span></span></a>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Project/Lab_Work_Flow"><span><span>Lab Work Flow</span></span></a>
| + | |
- | <!--</li><li><a href="https://2012.igem.org/Team:Goettingen/Maps"><span><span><div style="text-indent:20px;">⋅ Golden Lab Rules</div></span></span></a></li>
| + | |
- | </li><li><a href="https://2012.igem.org/Team:Goettingen/Sequences"><span><span><div style="text-indent:20px;">⋅ Daily Check List</div></span></span></a></li> -->
| + | |
- | </ul>
| + | |
- | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| + | |
- | </li>
| + | |
- | | + | |
- | <li>
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Notebook" style="color: white;">Notebook<!--[if gt IE 6]><!--></a><!--<![endif]-->
| + | |
- | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| + | |
- | <ul class="DropDownMenu" id="MB1-DDM2">
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Notebook"><span><span>Overview</span></span></a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Notebook/Summary"><span><span>Summary</span></span></a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Notebook/Discussion"><span><span>Discussion</span></span></a></li>
| + | |
- | </ul>
| + | |
- | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| + | |
- | </li>
| + | |
- | <li>
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/iGEM" style="color: white;">iGEM<!--[if gt IE 6]><!--></a><!--<![endif]-->
| + | |
- | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| + | |
- | <ul class="DropDownMenu" id="MB1-DDM6">
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/iGEM"><span><span>What is iGEM?</span></span></a></li>
| + | |
- | <!--<li><a href="https://2012.igem.org/Team:Goettingen/BioBrick_System"><span><span>iGEM BioBrick System</span></span></a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Part_Registry"><span><span>iGEM Part Registry</span></span></a></li> -->
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/iGEM/Parts_Submitted"><span><span>Parts Submitted</span></span></a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/iGEM/Attributions"><span><span>Attributions</span></span></a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/iGEM/Saftey"><span><span>Saftey</span></span></a></li>>
| + | |
- | </ul>
| + | |
- | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| + | |
- | </li>
| + | |
- | <li>
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Goettingen" style="color: white;">Göttingen<!--[if gt IE 6]><!--></a><!--<![endif]-->
| + | |
- | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| + | |
- | <ul class="DropDownMenu" id="MB1-DDM5">
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Goettingen"><span><span>City</span></span></a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Goettingen/University"><span><span>Georg-August-University</span></span></a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Goettingen/MPI"><span><span>Max-Planck-Institute</span></span></a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Goettingen/S1-Demo_Lab"><span><span>S1-Demo Lab</span></span></a></li>
| + | |
- | | + | |
- | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| + | |
- | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| + | |
- | </li>
| + | |
- | | + | |
- | </ul>
| + | |
- | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| + | |
- | </li>
| + | |
- | <li style="width: 160px">
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Human_Practice" style="color: white;">Human Practice<!--[if gt IE 6]><!--></a><!--<![endif]-->
| + | |
- | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| + | |
- | <ul class="DropDownMenu" id="MB1-DDM5">
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Human_Practice"><span><span>Why Human Practice?</span></span></a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Human_Practice/Public_and_Media"><span><span>Public and Media</span></span></a></li>
| + | |
- | <!--</li><li><a href="https://2012.igem.org/Team:Goettingen/Newspaper"><span><span><div style="text-indent:20px;">⋅ Newspaper</div></span></span></a></li>
| + | |
- | </li><li><a href="https://2012.igem.org/Team:Goettingen/Conference"><span><span><div style="text-indent:20px;">⋅ Conference</div></span></span></a></li>
| + | |
- | </li><li><a href="https://2012.igem.org/Team:Goettingen/Synthetic_Biology_Day"><span><span><div style="text-indent:20px;">⋅ Synthetic Biology Day</div></span></span></a></li> -->
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Human_Practice/Survey"><span><span>Survey</span></span></a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Human_Practice/Panel_Discussion"><span><span>Panel Discussion</span></span></a></li>-->
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Human_Practice/Flash_coli"><span><span>Flash Coli</span></span></a></li>
| + | |
- | </ul>
| + | |
- | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| + | |
- | </li>
| + | |
- | | + | |
- | <li>
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Sponsoring" style="color: white;">Sponsoring</a>
| + | |
- | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| + | |
- | <ul class="DropDownMenu" id="MB1-DDM2-SM3">
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Sponsoring"><span><span>Interested in...?</span></span></a></li>
| + | |
- | <!-- <li><a href="https://2012.igem.org/Team:Goettingen/Human_Practice/Sponsors"><span><span>Sponsors</span></span></a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:Goettingen/Human_Practice/Supporters"><span><span>Supporters</span></span></a></li> -->
| + | |
- | </li>
| + | |
- | </ul>
| + | |
- | | + | |
- | </div>
| + | |
- | | + | |
| | | |
| + | <html> |
| <table> | | <table> |
- | <!-- Text body -->
| |
- | <tbody><tr valign="top" align="left">
| |
| | | |
- | <td style="padding: 0pt 20px 0pt 0pt;" width="650px">
| |
- | <font face="Verdana" size="-1">
| |
- | <br>
| |
- | Language: <img height="20", src="http://www.patrickreinke.de/igem/eng.jpg"> English, <img height="20", src="http://www.patrickreinke.de/igem/deu.jpg"> <a href="https://2012.igem.org/Team:Goettingen/main_deu">Deutsch</a> <br>
| |
- | <br>
| |
| | | |
| | | |
Line 536: |
Line 27: |
| <td width="900" bordercolor="black" valign="top"> | | <td width="900" bordercolor="black" valign="top"> |
| <h2><b>V07_02 </b></h2><br> | | <h2><b>V07_02 </b></h2><br> |
- | <b>Startpoint of Saturated mutagenesis experiment!</b><br> | + | <b>V07_02_1 SDS-PAGE of promoter constructs</b><br> |
| <ul> | | <ul> |
- | <li>Experiment: <br>We aim to apply directed evolution to reprogram the bacterial chemoreceptor TAR in order to enable the perception of novel substances. </li> | + | <li>Experiment: <br>An SDS-PAGE was performed to investigate and characterize the promoter strentgh on the protein level. We chose promoters J23105 (18M) and J23106 (18O) and compared it to the overall protein expression of <i>E. coli</i> DH10B and <i>E. coli</i> Δ<i>tar</i>. |
| + | </li> |
| + | </ul> |
| + | <ul> |
| + | <li>Observations & Results: <br>The results were surprising. We could not observe any overexpression of proteins for both <i>E. coli</i> strains transformed with the BioBrick plasmids. |
| + | </li> |
| + | </ul> |
| + | <br> |
| + | <b>V07_02_2 Startpoint of Saturated mutagenesis experiment!</b><br> |
| + | <ul> |
| + | <li>Experiment: <br>We aim to apply directed evolution to reprogram the bacterial chemoreceptor TAR in order to enable the perception of novel substances. A saturated mutagenesis PCR was performed to mutate five individual amino acid residues in the ligand binding site of TAR. The primers that are utilized are the following:<br><br> |
| + | TARR6973Fw: <br>gcgcaGGAAAGGTCTCACTGAGT<b>nnN</b>TCAGCGGTA<b>nnN</b>ATGATGATGGATTCCTCCAATCAACAAAG<br> |
| + | TARR6973Rv: <br>gcgcaGAGTAGGTCTCATCAGGTTAATGCGCGTTTGCAG<br> |
| + | TARY149F150T154Fw: <br>gcgcaGGAAAGGTCTCAGGAGCT<b>nnNnnN</b>GCTCAGCCA<b>nnN</b>CAGGGAATGCAAAATGCAATGGGCGAAG<br> |
| + | TARY149F150T154Rv: <br>gcgcaGAGTAGGTCTCACTCCAGTATTGCCATAATCTAGGTAATC<br><br> |
| + | We firstly did a test PCR with both primer pairs to verify the <a href="https://2012.igem.org/Team:Goettingen/Project/Methods">mutagenesis PCR protocol</a> and conditions. As a template we use the vector pSB1C3_TAR_QC_18C isolated from <i>E. coli</i> DH10B since this promoter is the strongest among the promoter constructs we use. After the amplification we have multiple linear vectors that contain every possible mutation. |
| + | </li> |
| + | </ul> |
| + | <ul> |
| + | <li>Observations & Results: <br>According to the agarose gel the PCR worked well. A band of the expected size of 3769 bp was observed for both reactions. |
| + | </li> |
| </ul> | | </ul> |
| <br></td></tr> | | <br></td></tr> |
| </table> | | </table> |
| <br> | | <br> |
- | <body id="top"> | + | <table cellpadding="20 px" border="1" bordercolor="black" valign="top"> |
- | <a href="#top">↑ Return to top</a> | + | <tr bordercolor="black" valign="top"> |
| + | <td width="900" bordercolor="black" valign="top"> |
| + | <h2><b>V07_03 </b></h2><br> |
| + | <b>1<sup>st</sup> round of mutagenesis PCR (mutation of aa residues 149, 150 and 159)</b><br> |
| + | <ul> |
| + | <li>Experiment: <br>The saturated mutagenesis PCR was set up in a 50 µL batch according to the established <a href ="https://2012.igem.org/Team:Goettingen/Project/Methods">protocol</a> V07_02). The following experiments are performed as "attempt a" 1<sup>st</sup> and 2<sup>nd</sup> round. Beginning <a href="https://2012.igem.org/Team:Goettingen/week17-3">V08_20</a> "attempt b" was carried out to increase mutant diversity! |
| + | </li> |
| + | </ul> |
| + | <ul> |
| + | <li>Observations & Results: <br>The corresponding gel showed bands of the expected size. |
| + | </li> |
| + | </ul> |
| + | <br></td></tr> |
| + | </table> |
| <br> | | <br> |
| + | <table cellpadding="20 px" border="1" bordercolor="black" valign="top"> |
| + | <tr bordercolor="black" valign="top"> |
| + | <td width="900" bordercolor="black" valign="top"> |
| + | <h2><b>V07_04 </b></h2><br> |
| + | <b>V07_04_1 1<sup>st</sup> round: PCR clean-up</b><br> |
| + | <ul> |
| + | <li>Experiment: <br>The clean-up was performed using peqGOLD Cycle-Pure Kit (PeqLab) following the user manual. We modified the protocol by using columns from the peqGOLD Plasmid Miniprep Kit I (PeqLab) because these can bind a higher amount of DNA (30 µg/column). Thus, we lose fewer DNA material in the cleaning steps. 50 µL of elution buffer was used. |
| + | </li> |
| + | </ul> |
| + | <ul> |
| + | <li>Observations & Results: <br>The corresponding gel showed a band of the expected size. |
| + | </li> |
| + | </ul> |
| + | <br> |
| + | <b>V07_04_2 1<sup>st</sup> round: <i>Dpn</i>I/<i>Bsa</i>I digestion</b><br> |
| + | <ul> |
| + | <li>Experiment: <br>The digestion was performed with a total volume of 50 µL according to <a href="https://2012.igem.org/Team:Goettingen/Project/Methods">protocol</a>. |
| + | </li> |
| + | </ul><br> |
| + | <b>V07_04_3 1<sup>st</sup> round: Digestion clean-up</b><br> |
| + | <ul> |
| + | <li>Experiment: <br>The clean-up was performed using peqGOLD Cycle-Pure Kit (PeqLab) modified by using columns from the peqGOLD Plasmid Miniprep Kit I (PeqLab) with an EB volume of 50 µL. |
| + | </li> |
| + | </ul> |
| + | <ul> |
| + | <li>Observations & Results: <br>The corresponding gel showed a band of the expected size. |
| + | </li> |
| + | </ul><br> |
| + | <b>V07_04_4 1<sup>st</sup> round: Ligation</b><br> |
| + | <ul> |
| + | <li>Experiment: <br>The ligation was set up in a 100 µL batch according to <a href="https://2012.igem.org/Team:Goettingen/Project/Methods">protocol</a>. Incubation over night at 16 °C. |
| + | </li> |
| + | </ul> |
| + | |
| + | |
| + | <br></td></tr> |
| + | </table> |
| + | <br> |
| + | <table cellpadding="20 px" border="1" bordercolor="black" valign="top"> |
| + | <tr bordercolor="black" valign="top"> |
| + | <td width="900" bordercolor="black" valign="top"> |
| + | <h2><b>V07_05 </b></h2><br> |
| + | <b>V07_05_1 1<sup>st</sup> round: Ethanol precipitation of mutated plasmids</b><br> |
| + | <ul> |
| + | <li>Experiment: <br>An ethanol precipitation was performed.<br> |
| + | for 2000 µL ligation<br> |
| + | - 3 M Na-Acetate pH 5.2, volume 1/10<br> |
| + | - 5 mL EtOH 100 % (final volume 70 %)<br> |
| + | - incubate at room temperature (RT) for 5 min<br> |
| + | - centrifuge at 13000 rpm for 15 min at RT<br> |
| + | - discard supernatant<br> |
| + | - resuspend pellet in 500 µL 70 % EtOH<br> |
| + | - centrifuge at 13000 rpm for 15 min at RT<br> |
| + | - discard supernatant<br> |
| + | - dry pellet for 5 min at RT<br> |
| + | - resuspend pellet in 10 µL sterile ddH<sub>2</sub>O<br> |
| + | Protocol is adjusted for different ligation volumes. |
| + | </li> |
| + | </ul> |
| + | <ul> |
| + | <li>Observations & Results: <br> Unfortunately we used the wrong amount of ethanol, so that the subsequent transformation did not work successfully! |
| + | </li> |
| + | </ul><br> |
| + | <b>V07_05_2 1<sup>st</sup> round: Transforamtion of electrocompetent cells wir the mutant plasmid mixture</b><br> |
| + | <ul> |
| + | <li>Experiment: <br>Electrocompetent cells were prepared according to <a href="https://2012.igem.org/Team:Goettingen/Project/Methods">protocol</a>. We transformed 200 µL of cells with 10 µL of DNA. A detailed protocol for the electroporation can be found <a href="https://2012.igem.org/Team:Goettingen/Project/Methods">here</a>. The transformed cells were transferred to 100 mL liquid LB medium + CM and incubated over night at 37 °C, 180 rpm. We prepared three dilution plates LB+CM (10<sup>4</sup>, 10<sup>5</sup>, 10<sup>6</sup>) for counting colonies to verify whether the desired library diversity is reached. Plates were incubated over night at 37 °C aswell. |
| + | </li> |
| + | </ul> |
| + | <ul> |
| + | <li>Observations & Results: <br> Continuous bug see V07_05_1! |
| + | </li> |
| + | </ul> |
| + | <br></td></tr> |
| + | </table> |
| + | <br> |
| + | <table cellpadding="20 px" border="1" bordercolor="black" valign="top"> |
| + | <tr bordercolor="black" valign="top"> |
| + | <td width="900" bordercolor="black" valign="top"> |
| + | <h2><b>V07_06 </b></h2><br> |
| + | <b>V07_06_1 1<sup>st</sup> round: Analysis of transformation V07_05</b><br> |
| + | <ul> |
| + | <li>Experiment: <br>Plates and liquid culture were checked for successful transformation. |
| + | </li> |
| + | </ul> |
| + | <ul> |
| + | <li>Observations & Results: <br> No bacterial growth on neither plates nor in liquid culture. Continuous bug see V07_05_1! |
| + | </li> |
| + | </ul><br> |
| + | <b>V07_06_2 1<sup>st</sup> round: Restart of saturated mutagenesis PCR</b><br> |
| + | <ul> |
| + | <li>Experiment: <br>The PCR V07_03 was set up again + 1 backup. The clean-up was performed with the peqGOLD Cycle-Pure Kit (PeqLab). Elution in 50 µL EB. |
| + | </li> |
| + | </ul> |
| + | <ul> |
| + | <li>Observations & Results: <br> The corresponding gel showed bands of the expected size. |
| + | </li> |
| + | </ul> |
| + | <br></td></tr> |
| + | </table> |
| <br> | | <br> |
| <a href="https://2012.igem.org/Team:Goettingen/Notebook">Back to overview</a><br> | | <a href="https://2012.igem.org/Team:Goettingen/Notebook">Back to overview</a><br> |
Line 552: |
Line 175: |
| | | |
| | | |
- | <table bordercolor="black" border="1 px" width="600 px"><tr><td>
| + | |
- | <b>Important pages</b>:<br>
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen">Home</a>;
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Team">Team</a>;
| + | |
- | <a href="https://igem.org/Team.cgi?year=2012">Official Team Profile</a>;
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Project">Project</a>;
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Parts">Parts submitted to the Registry</a>;
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Modeling">Modeling</a>;
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Notebook">Notebook</a>;
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Saftey">Saftey</a>;
| + | |
- | <a href="https://2012.igem.org/Team:Goettingen/Attributions">Attributions</a>
| + | |
- | </td></tr>
| + | |
- | </table>
| + | |
| | | |
| | | |
Line 580: |
Line 191: |
| </body> | | </body> |
| </html> | | </html> |
| + | {{GoettingenFooter}} |