Team:TU Darmstadt/Materials/tctB197
From 2012.igem.org
(Difference between revisions)
(→tctB197 RBS) |
|||
Line 27: | Line 27: | ||
<li><a href="/Team:TU_Darmstadt/Safety" title="Safety">Safety</a></li> | <li><a href="/Team:TU_Darmstadt/Safety" title="Safety">Safety</a></li> | ||
<li><a href="/Team:TU_Darmstadt/Downloads" title="Downloads">Downloads</a></li></ul></li> | <li><a href="/Team:TU_Darmstadt/Downloads" title="Downloads">Downloads</a></li></ul></li> | ||
- | <li><a href="/Team:TU_Darmstadt/Human_Practice" title="Human Practice">Human Practice</a | + | <li><a href="/Team:TU_Darmstadt/Human_Practice" title="Human Practice">Human Practice</a></li> |
- | + | ||
- | + | ||
- | + | ||
<li><a href="/Team:TU_Darmstadt/Sponsors" title="Sponsors">Sponsors</a><ul> | <li><a href="/Team:TU_Darmstadt/Sponsors" title="Sponsors">Sponsors</a><ul> | ||
<li><a href="/Team:TU_Darmstadt/Sponsors" title="Sponsors">Overview</a></li> | <li><a href="/Team:TU_Darmstadt/Sponsors" title="Sponsors">Overview</a></li> |
Latest revision as of 20:50, 26 September 2012
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K808005 tctB197]
Primers for the construction of a BioBrick containing the small subunit B2 of the tripartite tricarboxylate transporter family.
tctB197 BioBrick
5' BioBrick Annealing 3' fwd: gtttcttcgaattcgcggccgcttctagatgtctgattccttccaagatctggc rev: gtttcttcctgcagcggccgctactagtattacagccaccccgtttcagtcag
tctB197 RBS
Primers for the insertion of the arabinose promotor RBS site based on the sequence of [http://partsregistry.org/wiki/index.php/Part:BBa_J61100 BBa_J61100] and [http://partsregistry.org/wiki/index.php/Part:BBa_J61101 BBa_J61101].
5' 3' fwd: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGAA AGAGGGGAC AAtactagatgtctgattccttccaagatctggc rev: gtttcttcctgcagcggccgctactagtaGGGTCCTGTCTTTCttacagccaccccgtttcagtcag