Cadmium/Heavy metals AND Gate

TOC

May

05/29/2012

Our group is in charge of building part of the “and” construction. We started analyzing if the plasmid we have with P4 actually had what we needed. The plasmid PRMn25 contains the protein P4. It has Amp100 resistance and comes in Escherichia coli NFI. Cells were lysed to make sure the plasmid was present in these cells (5000bp). We ran a gel with 3 lysis, a sample from the plasmid PFRC54 (A3 promoter) and a sample of total DNA from the strain from which PFRC54 was obtained.

1. 10 kb ladder 2. Lysis PRMn25 (Rebeca) 3. Lysis PRMn25 (Karen) 4. Lysis PRMn25 (Dulce) 5. Purified PFRC54(A3) 6. Total DNA (PFRC54)

05/31/2012 Plasmid PRMn25 was digested with SpeI and EcoRI. We do not have the sequence of the plasmid, but there seem to be several restriction sites for SpeI and just one site for EcoRI. The digestions were left for 4 hours and they were plused in the microwave 3 times, 10 seconds each time. Only Dulce’s digestion worked, even though it was the “dirtiest” sample.

1. 10 kb ladder 2. SpeI PRMn25 digestion (Dulce) 3. EcoRI PRMn25 digestion (Dulce) 4. PRMn25 lysis (Dulce) 5. SpeI PRMn25 digestion (Karen) 6. EcoRI PRMn25 digestion (Karen) 7. PRMn25 lysis (Karen) 8. SpeI PRMn25 digestion (Rebeca) 9. EcoRI PRMn25 digestion (Rebeca) 10. PRMn25 lysis (Rebeca)

06/06/2012 We repeated the lysis of PRMn25. Digestions (20 l) H2O 12 l Enzime 1 l Buffer 10x 2 l Plasmid 5 l 37ºC PRMn25 was digested with EcoRi and BamHI. Since we don’t have the sequence we used these enzyme to confirm the restriction sites mentioned in Rojo et al. (1990). These sites were corroborated and the vector was linearized. We recycled the gel used for the PRMn25 lysis, which is why the gel seems out of phase.

1.10 kb ladder 2. PRMn25 (P4) lysis 1 3. PRMn25 (P4) lysis 2 4. --------------- 5. 10 kb ladder 6. EcoRI PRMn25 digestion 7. BamHI PRMn25 digestion

06/08/12 The lysis worked so we transformed PRMn25 in DH5. We performed a lysis on these cells to see if they had been transformed correctly with PRMn25.

1. 10kb ladder 2. PRMn25 (P4) lysis 1 3. Cell lysis of cells transformed with lysis 1 4.Cell lysis of cells transformed with lysis 1 5. Cell lysis of cells transformed with lysis 1 6. Cell lysis of cells transformed with lysis 1 7. Cell lysis of cells transformed with lysis 1 8. Cell lysis of cells transformed with lysis 1 9. Cell lysis of cells transformed with lysis 1 10. Cell lysis of cells transformed with lysis 1 11. Cell lysis of cells transformed with lysis 1 12. Cell lysis of cells transformed with lysis 1

We also transformed PFRC54.

Transformation in DH5 Place DH5+5 l DNA in ice at 4ºC. 42ºC 2 minutes. Add 1 ml LB to the same tube. 1 hour at 37ºC x 9000 rpm.

06/11/12 We designed primers for our project. (Note from 07/10/12: we redesigned the primer for LasR, since the sequence was incorrect.) OLIGOS 14/06/12

LASR

UPPER 5'-3'

PREFIJO+RBS+ESPACIADOR+LASR

GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCATTAGTAGAT

LOWER 5'-3'

SUFIJO+LASR

GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA TCATAATGTAATTAA

P4 5'-3'

PREFIJO+RBS+ESPACIADOR+P4

upper

GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGCCTAAAACACAA

SUFIJO+P4

lower 5'-3'

GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CTACACCATACTTTT

A3 (PROMOTOR)

UPPER 5'-3'

PREFIJO+A3

5' GTTTCTTCGAATTCGCGGCCGCTTCTAGAG taactttttgcaaga 3'

LOWER 5'-3'

SUFIJO+A3

5'GTTTCTTCCTGCAGCGGCCGCTACTAGTA ctacttaattatacc 3'

RFP

UPPER 5'-3'

PREFIJO+RBS+ESPACIADOR+RFP

GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCTTCCTCCGAA

LOWER 5'-3'

SUFIJO+RFP

GTTTCTTCCTGCAGCGGCCGCTACTAGTA TTATTAAGCACCGGT

GUSA

UPPER 5'-3'

PREFIJO+RBS+ESPACIADOR+GUSA

GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG atgttacgtcctgta

LOWER 5'-3'

SUFIJO+GUSA

GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA tcattgtttgcctcc

ARAC sin LVA (version 2 registry parte: BBa_C0080)

UPPER 5'-3'

PREFIJO+RBS+ESPACIADOR+ARAC

GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCTGAAGCGCAA

LOWER 5'-3'

SUFIJO+ARAC

GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CAACTTGACGGCTAC

06/14/2012 We obtained the terminator from the 2012 distribution (plate 2 24C) and we transformed the DNA in DH5. The terminator (BBa_B0014) comes in the PSBIAK3 plasmid with resistance to Amp and Km. The RFP (BBa_E1010) comes in the plasmid PSBI2K3 with resistance to Amp and we obtained it from the 2012 distribution plate 2 (17E). We obtained the purified plasmid of the RFP from the AraC AND team. (Diego, Jonathan, and Abiel).

1. 1 kb ladder. 2. BBa_B0014 (1) – terminator 3. BBa_B0014 (4) – terminator 4. BBa_E1010 (RFP) Lysis 5. purified BBa_E1010 PSB12K3 (AraC AND team) 6. 700 bp ladder

06/15/12 Due to the failed digestions, we did the RFP and terminator lysis again.

1. 1 kb ladder 2. Terminator lysis (BBa_B0014) 3. RFP lysis (BBa_E1010) The AraC team has the terminator plasmid purified, we are thinking of using that one.

06/18/12 We used the RFP that we transformed and the RFP that the AraC team did as a positive control. The terminator still looks strange, since we can’t observe supercoling which is normally observed. We are waiting for our primers, and the team will be going to a math modeling course for a week.

1. 700 bp ladder 2. BBa_B0014 lysis (terminator) 3. BBa_E1010 lysis (RFP) 4. BBa_E1010 lysis (RFP AraC team) 5. 1 kb ladder 07/02/12 We did 2 PCRs, since the primers have arrived. We purified by miniprep RFP and P4. With this PCR we will add the prefix (EcoRI and XbaI) and RBS to the beginning of the sequence, and suffix (restiction sites for SpeI asn PstI).

RFP Water 29.5 l Buffer 5 l Up 2.5 l Lw 2.5 l MgCl2 1 l l DNA 0.5 l TaqPol 1 l DNTP’s 8 l

       	P4

Water 29.5 l Buffer 5 l Up 2.5 l Lw 2.5 l MgCl2 1 l l DNA 0.5 l TaqPol 1 l DNTP’s 8 l

TM’s RFP UP 78ºC RFP LW 75.5 ºC P4 UP 73.6 ºC P4 LW 73.9ºC

Taking into account both TM’s, we used the same amplification program for both, thermocycle B progam 16EM. 3 step 95ºC 4 min 95ºC 1 min 55ºC 1 min 70ºC 1 min goto 2:4 30 times 72ºC 5 min We ran a gel and we observed fragments that correspond to the RFP and P4, we can also observe other fragments which means we will have to purify the bands.

1. 1 kb ladder 2. PCR RFP 3. negative control PCR RFP 4. P4 PCR 5. negative control PCR P4

07/03/12 We used Roche kit for band purification.

1. 1 kb ladder 2. PCR product P4 3. PCR product RFP

1. Cut the band of the fragment you wish to purify. 2. 400 l of Binding Buffer, 10 min. at 65ºC with shaker so that the agarose melts. 3. 200 l deisopropanol after 5 min in the shaker. 4. Pass through column and centrifuge. Throw out supernatant. 5. 700 l wash buffer, centrifuge, throw it out, centrifuge. 6. Pass column to clean tube, add 40 l de elution buffer.

1. 1kb Ladder 2. P4 band 3. RFP band

1. 1kb ladder 2. P4 purification 3. RFP purification

The P4 purification turned out slightly dirty and the RFP turned out completely dirty. We repeated the purifications by loading the previously “purified” sample and repeating the procedure.

07/03/12 1. Ladder 1 kb 2. Purified P4 3. Purified RFP We used Roche kit to purify the band again.

1. 1kb ladder 2. cut P4 3. cut RFP

The RFP came out fine, but P4 was degraded, we will have to repeat P4’s PCR. (Gel is recycled, which is why image is blurry). We transformed LasR from 2010 distribution in DH5.

07/04/2012

1. Degraded P4. 2. Purified RFP. 3. 1kb Ladder. We repeated the gel where we checked the re-purification, and indeed we need to repeat P4’s PCR.

1. 1 kb ladder 2. P4 PCR (1) 3. P4 PCR (2) 4. Negative control P4 PCR

The PCR worked, but a band purification will be needed. We fused all of the PCR product and loaded it.

1. 1 kb ladder 2. P4 PCR product

1. 1 kb ladder. 2. Cut P4.

1. P4 purified from band 2. 1 kb ladder

We grew bacterial culture in antibiotics for LasR lysis.

Rfp+terminator ligation Buffer 3.5 l RFP 15 l Terminator 8 l T4 Ligase 1 l H2O 7.5 l total 35 l At 22ºC

07/05/12

1. 1 kb ladder 2. LasR lysis 3. LasR lysis 4. LasR lysis 5. LasR lysis 6. LasR lysis 7. LasR lysis 8. LasR lysis 9. LasR lysis Cells were transformed with DH5 with RFP+terminator ligation.

1. 1 kb ladder 2. Terminator digested with EcoRI and XbaI/ dephosphatated 3. RFP digested with EcoRI and SpeI. LasR lysis were digested. We ran a gel with LasR PCRs to add RBS prefix and suffix. 1. XbaI SpeI LasR digestion (3 hours) 2. XbaI SpeI LasR digestion (3 hours) 3. XbaI SpeI LasR digestion (3 hours) 4. XbaI SpeI LasR digestion (3 hours) 5. 1 kb ladder 6. LasR PCR 7. LasR PCR 8. LasR PCR 9. LasR PCR 10. Negative control LasR PCR

06/07/12

We ran LasR’s PCRs again, the last PCR didn’t work, which is why we lowered the temperature to 65ºC. We left the digestions all night.

PCR 95ºC 4 min 95ºC 1 min 55ºC 1 min 65ºC 1 min go to 2:4 3 times 72ºC 5 min

1. LasR PCR 2. LasR PCR 3. LasR PCR 4. LasR PCR 5. LasR PCR 6. LasR PCR 7. LasR PCR 8. LasR PCR 9. Negative control LasR PCR 10. 1 kb ladder 11. X/S LasR digestion 12. X/S LasR digestion 13. X/S LasR digestion 14. X/S LasR digestion 15. X/S LasR digestion Since they didn’t work, we decided to do it directly from the distribution from 2012 and 2010.

We noticed our mistake…. The sequence we designed our primers for was an incorrect sequence!