Team:UNAM Genomics Mexico/Notebook/ANDMetal

From 2012.igem.org

Revision as of 04:12, 20 September 2012 by Abieltega (Talk | contribs)


UNAM-Genomics_Mexico


Cadmium/Heavy metals AND Gate



Contents

 The logic Random info




MAY

  • 1. 10 kb ladder
    2. Lysis PRMn25
    3. Lysis PRMn25
    4. Lysis PRMn25
    5. Purified PFRC54(A3)
    6. Total DNA (PFRC54)







05/29/2012


Our group is in charge of building part of the “and” construction. We started analyzing if the plasmid we have with P4 actually had what we needed.

The plasmid PRMn25 contains the protein P4. It has Amp100 resistance and comes in Escherichia coli NFI. Cells were lysed to make sure the plasmid was present in these cells (5000bp). We ran a gel with 3 lysis, a sample from the plasmid PFRC54 (A3 promoter) and a sample of total DNA from the strain from which PFRC54 was obtained.







  • 1. 10 kb ladder
    2. SpeI PRMn25 digestion
    3. EcoRI PRMn25 digestion
    4. PRMn25 lysis
    5. SpeI PRMn25 digestion
    6. EcoRI PRMn25 digestion
    7. PRMn25 lysis
    8. SpeI PRMn25 digestion
    9. EcoRI PRMn25 digestion
    10. PRMn25 lysis





05/31/2012


Plasmid PRMn25 was digested with SpeI and EcoRI. We do not have the sequence of the plasmid, but there seem to be several restriction sites for SpeI and just one site for EcoRI. The digestions were left for 4 hours and they were plused in the microwave 3 times, 10 seconds each time. Only Dulce’s digestion worked, even though it was the “dirtiest” sample.









JUNE

  • 1.10 kb ladder
    2. PRMn25 (P4) lysis 1
    3. PRMn25 (P4) lysis 2
    4. ---------------
    5. 10 kb ladder
    6. EcoRI PRMn25 digestion
    7. BamHI PRMn25 digestion




06/06/2012


We repeated the lysis of PRMn25.
Digestions (20 µl)
H2O 12 µl
Enzime 1 µl
Buffer 10x 2 µl
Plasmid 5 µl
37ºC

PRMn25 was digested with EcoRi and BamHI. Since we don’t have the sequence we used these enzyme to confirm the restriction sites mentioned in Rojo et al. (1990). These sites were corroborated and the vector was linearized. We recycled the gel used for the PRMn25 lysis, which is why the gel seems out of phase.



  • 1. 10kb ladder
    2. PRMn25 (P4) lysis 1
    3-12. Cell lysis of cells transformed with lysis 1




06/08/12



The lysis worked so we transformed PRMn25 in DH5α. We performed a lysis on these cells to see if they had been transformed correctly with PRMn25.

We also transformed PFRC54. TRANSFORMATION PROTOCOL






06/11/12


We designed primers for our project. (Note from 07/10/12: we redesigned the primer for LasR, since the sequence was incorrect.)
OLIGOS 14/06/12
LASR
UPPER 5'-3'
PREFIX+RBS+SPACER+LASR
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCATTAGTAGAT
LOWER 5'-3'
SUFIX+LASR
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA TCATAATGTAATTAA

P4 5'-3'
PREFIX+RBS+SPACER+P4
upper
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGCCTAAAACACAA
SUFIX+P4
lower 5'-3'
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CTACACCATACTTTT


A3 (PROMOTER)
UPPER 5'-3'
PREFIX+A3
5' GTTTCTTCGAATTCGCGGCCGCTTCTAGAG taactttttgcaaga 3'
LOWER 5'-3'
SUFIX+A3
5'GTTTCTTCCTGCAGCGGCCGCTACTAGTA ctacttaattatacc 3'


RFP
UPPER 5'-3'
PREFIX+RBS+SPACER+RFP
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCTTCCTCCGAA
LOWER 5'-3'
SUFIX+RFP
GTTTCTTCCTGCAGCGGCCGCTACTAGTA TTATTAAGCACCGGT



GUSA
UPPER 5'-3'
PREFIX+RBS+SPACER+GUSA
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG atgttacgtcctgta
LOWER 5'-3'
SUFIX+GUSA
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA tcattgtttgcctcc


ARAC without LVA (version 2 registry part: BBa_C0080)
UPPER 5'-3'
PREFIX+RBS+SPACER+ARAC
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGGCTGAAGCGCAA
LOWER 5'-3'
SUFIX+ARAC
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CAACTTGACGGCTAC


  • 1. 1 kb ladder.
    2.BBa_B0014 (1) – terminator
    3.BBa_B0014 (4) – terminator
    4.BBa_E1010 (RFP) Lysis
    5.purified BBa_E1010 PSB12K3 (AraC AND team)
    6.700 bp ladder





06/14/2012


We obtained the terminator from the 2012 distribution (plate 2 24C) and we transformed the DNA in DH5α TRANSFORMATION PROTOCOL. The terminator (BBa_B0014) comes in the PSBIAK3 plasmid with resistance to Amp and Km. The RFP (BBa_E1010) comes in the plasmid PSBI2K3 with resistance to Amp and we obtained it from the 2012 distribution plate 2 (17E). We obtained the purified plasmid of the RFP from the AraC AND team. (Diego, Jonathan, and Abiel).








  • 1. 1 kb ladder
    2. Terminator lysis (BBa_B0014)
    3. RFP lysis (BBa_E1010)




06/15/12


Due to the failed digestions, we did the RFP and terminator lysis again.
The AraC team has the terminator plasmid purified, we are thinking of using that one.











  • 1. 700 bp ladder
    2. BBa_B0014 lysis (terminator)
    3. BBa_E1010 lysis (RFP)
    4. BBa_E1010 lysis (RFP AraC team)
    5. 1 kb ladder




06/18/12


We used the RFP that we transformed and the RFP that the AraC team did as a positive control. The terminator still looks strange, since we can’t observe supercoling which is normally observed.

We are waiting for our primers, and the team will be going to a math modeling course for a week.









  • 1. 1 kb ladder
    2. PCR RFP
    3. negative control PCR RFP
    4. P4 PCR
    5. negative control PCR P4


JULY

07/02/12


We did 2 PCRs, since the primers have arrived. We purified by miniprep RFP and P4. With this PCR we will add the prefix (EcoRI and XbaI) and RBS to the beginning of the sequence, and suffix (restiction sites for SpeI asn PstI).
RFP, P4 PCR PROTOCOL
TM’s
RFP UP 78ºC
RFP LW 75.5 ºC
P4 UP 73.6 ºC
P4 LW 73.9ºC
Taking into account both TM’s, we used the same amplification program for both, thermocycle B progam iGEM.
We ran a gel and we observed fragments that correspond to the RFP and P4, we can also observe other fragments which means we will have to purify the bands.



  • 1. 1 kb ladder
    2. PCR product P4
    3. PCR product RFP

  • 1. 1kb ladder
    2. P4 purification
    3. RFP purification



07/03/12


We used Roche kit for band purification.

The P4 purification turned out slightly dirty and the RFP turned out completely dirty. We repeated the purifications by loading the previously “purified” sample and repeating the procedure.








  • 1. Degraded P4.
    2. Purified RFP.
    3. 1kb Ladder.

  • 1. 1 kb ladder
    2. P4 PCR (1)
    3. P4 PCR (2)
    4. Negative control P4 PCR

  • 1. P4 purified from band
    2. 1 kb ladder
    3. (Do not pay attention to this well).



07/04/2012


We repeated the gel where we checked the re-purification, and indeed we need to repeat P4’s PCR.

The PCR worked, but a band purification will be needed. We fused all of the PCR product and loaded it.

We grew bacterial culture in antibiotics for LasR lysis.

Rfp+terminator ligation LIGATION PROTOCOL








  • 1. 1 kb ladder
    2-9. LasR lysis

  • 1. 1 kb ladder
    2. Terminator digested with EcoRI and XbaI/ dephophatated
    3. RFP digested with EcoRI and SpeI.

  • 1-4. XbaI SpeI LasR digestion (3 hours)
    5. 1 kb ladder
    6-9. LasR PCR
    10. Negative control LasR PCR


07/05/12


Cells were transformed with DH5α with RFP+terminator ligation.TRANSFORMATION PROTOCOL
LasR lysis were digested. We ran a gel with LasR PCRs to add RBS prefix and suffix.









  • 1-8. LasR PCR
    9. Negative control LasR PCR
    10. 1 kb ladder
    11-15. X/S LasR digestion

  • 1. 1 kb Ladder
    2. LasR 2012
    3. LasR 2012
    4. LasR 2010
    5. LasR 2010
    6. Negative Control (-)


07/06/12


We ran LasR’s PCRs again, the last PCR didn’t work, which is why we lowered the temperature to 65ºC. We left the digestions all night. PCR PROTOCOL
Since they didn’t work, we decided to do it directly from the distribution from 2012 and 2010.

We noticed our mistake…. The sequence we designed our primers for was an incorrect sequence!

We need to redo LasR primers.
Our ligation didn’t work.
We redid RFP+terminator ligation and left it for the weekend. LIGATION PROTOCOL





07/09/12


We transformed the RFP+terminator ligation in DH5α and plated it in LB Km30. TRANSFORMATION PROTOCOL
We digested RFP with EcoRI and SpeI. DIGESTION PROTOCOL


  • 1. 1 kb Ladder
    2. RFP digested with EcoRI and SpeI
    3. Dephosphated terminator digested with EcoRI and XbaI
    4. RFP PCR (Prefix+RBS+RFP+Suffix)
    5. PCR RFP (-)


07/10/12


By 9am we didn’t observe colonies in our LB Km30 with yesterday’s transformation, so using yesterday’s RFP digestions we redid the ligation.
We did another PCR of RFP because we ran out of it.
We ran a gel with the dephosphated terminator and digested RFP.
The PCR turned out ok except for some non-specific bands, we will need to extract the correct DNA band.









  • 1. 1 kb ladder
    2. RFP PCR to extract the band

  • 1. 1kb Ladder
    2. RFP 1 PCR
    3. RFP 2 PCR
    4. RFP 3 PCR
    5. RFP 4 PCR
    6. RFP 5 PCR
    7. RFP (-) PCR

  • 1.1 kb ladder.
    2. RFP PCR.
    3. RFP PCR.

  • 1. 1 kb ladder.
    2. RFP PCR extracted.
    3. RFP PCR extracted.














07/11/12


We loaded the whole PCR product from the PCR.
>We took a picture of the gel to check the purification elutions but we did not observe anything so we quantified it on the nanodrop.
Sample 1) 5.9 ng/µl
Sample 2) 2.5 ng/µl

>With the RFP digested with EcoRI and SpeI we did another ligation with the terminator digested with EcoRI and XbaI and left it at 22ºC.

>We transformed yesterday’s ligation in DH5α and plated it in LB Km30. Since our ligations have not worked we decided to redo the digestions on the terminator (E0014). We asked the other AND team to give us the purified plasmid, but it wasn’t enough so we streaked 2 plates LB Km30 so we could have the strain with the terminator. Tomorrow we will put liquid cultures and do lysis.

>We did digestions in another vector to see the efficiency of the enzymes as a test. We used PBBR-GusA with 5 µl of PBBR GusA, one digestion with 1.5 µl of EcoRI, one with 1 µl of SpeI and one with 1 µl of SpeI and 1.5 µl of EcoRI.

We left them at 37ºC.
>We did 5 new RFP PCRs.
>We streaked again the following strains:
-DH5α +PRFc54
-DH5α +Terminator

The PCRs seem to show the band we need, we will have to extract them.


  • 1. 1 kb ladder.
    2. GusA-PBBR
    3. PBBR-GusA digested with SpeI.
    4. PBBR-GusA digested with EcoRI.
    5. PBBR-GusA digested with SpeI/EcoRI.
    6. RFP+terminator ligation.




07/12/12


We checked the transformations from the ligation “3” from RFP+terminator. We didn’t observe colonies.
>We transformed the ligation “4” RFP+terminator in DH5α, they were plated in LB Km30 .
>We ran a gel with GusA digestions.

>We digested 80 µl of the purified RFP with EcoRI and SpeI DIGESTION PROTOCOL.
>We left liquid cultures in LB Km30 so we can do an alkaline lysis of the plasmid containing the terminator (B0014).





  • 1. 1 kb ladder.
    2. Terminator alkaline lysis.
    3. Terminator alkaline lysis.
    4. Terminator alkaline lysis.
    5. Terminator alkaline lysis.
    6. 1 kb ladder.
    7. Terminator digested with E/X.
    8. RFP. digested with E/S.



07/13/12


>We did alkaline lysis of the terminator cultures from last night. We ran it and they all look ok, but we’ll use the first one because it seems to be the cleanest.
We ligated RFP/terminator and ran a gel to see RFP and the terminator. LIGATION PROTOCOL.

>We checked the transformations and didn’t see colonies.








  • 1. 1 kb Ladder.
    2. B0014/terminator E/X digestion.
    3. E0010/RFP E/S digestion.
    4. RFP from the other team.

  • 1. 1 kb ladder.
    2. RFP pcr.
    3. RFP pcr.
    4. RFP pcr.

  • 1. 1 kb ladder.
    2. Purified RFP.
    3. Purified RFP.
    4. Purified RFP.

07/16/12


We ran a gel with the RFP digestion, the purified terminator, and the RFP terminator ligation that was left for the whole weekend. (GEL NOT SHOWN)

>We digested the terminator with EcoRI and XbaI DIGESTION PROTOCOL.

> We digested RFP 1 with EcoRI and SpeI DIGESTION PROTOCOL.

In the gel we can see that the terminator digestion in ok, although it is still partial. We need to leave it for the whole night. We can’t see the RFP digestion; it is possible that it degraded. We will concentrate RFP.


  • 1. 1 kb ladder
    2. RFP lysis.
    3. RFP lysis 2010
    4. Terminator Digestion.
    5. RFP Digestion.

  • 1. 1 kb ladder.
    2. RFP PCR lysis.
    3. RFP PCR lysis.
    4. RFP PCR lysis.
    5. RFP PCR lysis.
    6. RFP PCR lysis.
    7. RFP PCR lysis.
    8. Negative control.

  • 1. 1 kb ladder.
    2. PCR RFP lysis.
    3. PCR RFP lysis.
    4. PCR RFP lysis.
    The pcr looks fine, now we will run 3 samples in fused wells so we can cut them and extract the DNA.

  • 1. 1kb ladder.
    2. Purified RFP.
    3. Purified RFP.
    4. Purified RFP.
















07/17/12


We ran 6 50 µl reactions of the PCR to amplify RFP. We will use as DNA RFP from the lysis, one from 2012, and one from 2010. We will make a dilution, use 1 µl of lysis and diluted them in H2O.
PCR protocol.

>We can still observe bands in the purification, we will try to do a better PCR.
>We digested the terminator lysis with EcoRI and XbaI and we decided to switch buffers. We used buffer 2 even though EcoRI might have a star effect. DIGESTION PROTOCOL





  • 2. 1 kb ladder.
    3. Terminator digested E/X.

  • 1. 1 kb ladder
    2. RFP PCR with hot start
    3. Negative Control
    4. Terminator Lysis
    5. Terminator digestion E/X.

  • 1. 1 kb ladder.
    2. RFP lysis PCR.
    3. RFP lysis (other team).
    4. Negative control.



07/18/12


We did a PCR using hot star and without MgCl2. HOT START PCR PROTOCOL

We left an RFP digestion and took the DNA from the RFP PCR which looked good. PCR PROTOCOL

From these PCR products we left the PCR digestion with EcoRI and SpeI and used enzymes from the same company. DIGESTION PROTOCOL





  • 1. 1 kb ladder.
    2. E/S RFP digestion.
    3. E/S RFP digestion (RFP PCR lysis).
    4. E/S RFP digestion (Cut RFP PCR from the other team).

  • 1. 1 kb ladder.
    2. E/X terminator 1 digestion.
    3. E/X terminator 2 digestion.

  • 1. 1 kb ladder.
    2. Terminator Lysis 1.
    3. RFP Lysis 2.

  • 1. 1 kb ladder.
    2. RFP E/S digestion.
    3. Terminator 2 E/X digestion.
















07/19/12


From the three RFP digestions we left yesterday we ran a gel to prove that our DNA wasn’t being degraded, as it had been happening.

> Our DNA wasn’t degraded, we will use these digestions to do the ligation.
>We did lysis of the terminator cultures by miniprep. LYSIS PROTOCOL

We ligated RFP+terminator. LIGATION PROTOCOL
We transformed the ligation. TRANFORMATION PROTOCOL







07/20/12


We observed two colonies, we put them in liquid LB.



  • 1.1 kb ladder.
    2.RFP-terminator lysis.
    3.RFP-termintor lysis.

  • 1.1 kb ladder.
    2.E ligation 1 digestion.
    3.P ligation 1 digestion.
    4.E/P ligation 1 digestion.
    5.E ligation 2 digestion.
    6.P ligation 2 digestion.
    7.E/P ligation 2 digestion.



07/23/12


We made a lysis of the ligation using miniprep.


>We did the following digestions
DIGESTION PROTOCOL
•EcoRI/PstI ligation
•EcoRI ligation
•PstI ligation

The results indicate that the vector only ligated with itself.

We put B0014 and E1010 digestions. DIGESTION PROTOCOL
Boo14 EcoRI
Boo14-XbaI
B0014 EcoRI/XbaI
E1010 EcoRI
E1010 SpeI
E1010 EcoRI/SpeI





Retrieved from "http://2012.igem.org/Team:UNAM_Genomics_Mexico/Notebook/ANDMetal"