"
Team:Buenos Aires/Results/Bb2
From 2012.igem.org
(→Parts to use) |
(→Parts to use) |
||
| Line 34: | Line 34: | ||
| - | {| | + | {| class="wikitable" border="1" |
| - | + | |- | |
| - | |- | + | |<!--column1-->[[File:Bsas2012-Bb5.png|800px]] |
| - | |General | + | |- |
| - | |} | + | |Picture: General Design of Biobrick 5. |
| + | |} | ||
== Promoter choice == | == Promoter choice == | ||
Revision as of 16:12, 24 September 2012
Contents |
Construct Desing based on Biobrick Registry Parts
His Secretion in Bacteria In the spirit of the competition we decided to design an extra construct besides our main biobrick. In this case, we decided to create it solely by using parts that came in the iGEM Kit 2012 distribution, and that could work for the same purposes that our main biobrick, which is mainly the export of aminoacids.
We designed a plausible construct that could work for the export of His using 5 parts of the registry, but we didnt find enough parts in order to design a simmilar one for the export of Trp.
Furthermor, the binding and preparation of this device is much more complex and has many more steps than what our main biobrick needs to work.
Therefore, we conclude that our main biobrick is an important contribution to the registry part, given that it allows the export of aminoacids to be enhanced with the use of only one part, without the need of the many steps that we describe in this section and consequently reducing the risk of failure and errors.
Aim
To create a biobrick that would enhance Histidine secretion in E. coli using standard parts of the registry as a proof that one can increase the production and secretion of an aminoacid and its measurement in the culture medium.
To learn how to use and merge standard parts from the registry provided at the iGEM Kit.
To characterize the functioning of existent parts in the registry and new combinations of them, therefore contributing the improvement of the iGEM record.
To proove that our main biobricks, devices 1 and 3 for the export of His, are an important contribution to iGEM, given that they are capable of His export with far less steps involved.
To proove that our main biobricks, devices 2 and 4 for the export of Trp, are an important contribution to iGEM, given that there are was no biobrick with such function available.
Parts to use
In order to accomplsPromoter (constitutive or inducible); RBS; Peptide Signal (Secretion Tag), Histidine Tag (repeated) and a Terminator.
|
| Picture: General Design of Biobrick 5. |
Promoter choice
We found many usable parts to use as promoters and chose:
Promoter + RBS: BBa_K081005
http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100
http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030
Inducible Promoter (IPTG) + RBS (Strong): BBa_J04500 http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 http://partsregistry.org/wiki/index.php?title=Part:BBa_B0034
We would use the second one, so that the system is plausible of regulation.
Signal Peptide Options
Unfortunately, we found very few signal peptide biobrick options, solely two and tested for cyanobacterium.
"pilA1 signal sequence from cyanobacterium Synechocystis; secretes protein": BBa_K125300 (partially confirmed)
http://partsregistry.org/Part:BBa_K125300 tggctagtaattttaaattcaaactcctctctcaactctccaaaaaacgggcagaaggtggt
"slr2016 signal sequence from cyanobacterium Synechocystis; secretes protein" : BBa_K125310 (partially confirmed)
http://partsregistry.org/Part:BBa_K125310 tggcagcaaaacaactatggaaaattttcaatcctagaccgatgaagggtgga
We could use any of them, but knowing that they are fit for Cyanobactierium, not E. Coli.
HisTag Options
Methionine + His Affinity Tag x 6: BBa_K133035 (partially confirmed) http://partsregistry.org/Part:BBa_K133035 http://partsregistry.org/cgi/partsdb/puttext.cgi
Methionine is there only to be able to express the protein, so this is a HisTag, and it is functional to our purposes. We would put this 3 times in a row to make the histag stronger but then we have 2 questions:
- the methionine that remains in the middle of each histag, would it make the structure unstable?
For example, placing it three times in a row we get: atgcaccaccaccaccaccac/atgcaccaccaccaccaccac/atgcaccaccaccaccaccac
- This sequence does not carry a Stop Codon and we found that several of the parts of the registry do not carry one either, which could be a major issue.
His Tag BBa_K157011 (Bad Sequencing :( )
http://partsregistry.org/Part:BBa_K157011:Design
Discarded for Bad Sequencing
Stop Codon
There are no stop codons in the HIsTag availables at the Kit. Therefore we would need to use another biobrick carrying a stop codon and use its restriction sites to cut it and keep only the Stop Codon part.
There is a biobrick that has several things and then ends with a hisstop. It has several restriction sites before a 6His and Stop, so we could use this part as a biobrick if we were able to cut it. http://partsregistry.org/Part:BBa_K133038
In this site we can see the restriction sites present at this construct: http://tools.neb.com/NEBcutter2/cutshow.php?name=c8ecf24a-
What restriction enzyme do we use in order for the remaining part to be used as a biobrick together with the other ones?
Terminator
There are several options for terminators
Doble terminador: BBa_B0015 ; BBa_B0024
From Coliphage: BBa_B0012
Any of them would be ok for our purposes.
