Team:Goettingen/week10-3

(Difference between revisions)

Revision as of 10:46, 21 September 2012

Language:

English,

Deutsch

Startpoint of Saturated mutagenesis experiment!

Observations and results:
According to the agarose gel the PCR worked well. A band at the expected size of 3769 bp was observed for both reactions.

Important pages:
Home; Team; Official Team Profile; Project; Parts submitted to the Registry; Modeling; Notebook; Saftey; Attributions

@@ Line 539: / Line 539: @@
 <ul>
 <li>Experiment: <br>We aim to apply directed evolution to reprogram the bacterial chemoreceptor TAR in order to enable the perception of novel substances. A saturated mutagenesis PCR was performed to mutate five individual amino acid residues in the ligand binding site of TAR. The primers that are utilized are the following:<br><br>
-TARR6973Fw: <br>gcgcaGGAAAGGTCTCACTGAGTnnNTCAGCGGTAnnNATGATGATGGATTCCTCCAATCAACAAAG<br>
+TARR6973Fw: <br>gcgcaGGAAAGGTCTCACTGAGT<b>nnN</b>TCAGCGGTA<b>nnN</b>ATGATGATGGATTCCTCCAATCAACAAAG<br>
 TARR6973Rv: <br>gcgcaGAGTAGGTCTCATCAGGTTAATGCGCGTTTGCAG<br>
-TARY149F150T154Fw: <br>gcgcaGGAAAGGTCTCAGGAGCTnnNnnNGCTCAGCCAnnNCAGGGAATGCAAAATGCAATGGGCGAAG<br>
+TARY149F150T154Fw: <br>gcgcaGGAAAGGTCTCAGGAGCT<b>nnNnnN</b>GCTCAGCCA<b>nnN</b>CAGGGAATGCAAAATGCAATGGGCGAAG<br>
 TARY149F150T154Rv: <br>gcgcaGAGTAGGTCTCACTCCAGTATTGCCATAATCTAGGTAATC<br><br>
 We firstly did a test PCR with both primer pairs to verify the <a href="https://2012.igem.org/Team:Goettingen/Project/Methods">mutagenesis PCR protocol</a> and conditions. As a template we use the vector pSB1C3_TAR_QC_18C isolated from <i>E. coli</i> DH10B since this promoter is the strongest among the promoter constructs we use. After the amplification we have multiple linear vectors that contain every possible mutation.