Team:Buenos Aires/Results/Bb2

From 2012.igem.org

(Difference between revisions)
(→Construct Desing based on Biobrick Registry Parts)
(→Bacteria Exportable His-rich peptide Generator)
 
(29 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:Buenos_Aires/Templates/menu}}
{{:Team:Buenos_Aires/Templates/menu}}
-
== Why this biobrick? ==
+
= Why this biobrick? =
-
We were having some custom related issues with the synthesized dna we ordered (see aa-rich export devices), so we started designing a biobrick that could be used for the same purpose, but that uses just parts included in the 2012 kit. Yes, you are correct: a PlanB!
+
We were having some '''custom related''' issues with the synthesized dna we ordered (see [[Team:Buenos_Aires/Results/Bb1 | aa-rich export devices]]), so we started designing '''a biobrick that could be used for the same purpose, but that uses just parts included in the 2012 kit'''. Yes, you are correct: '''a PlanB'''!
-
Although we did not work in the lab with this ''planB'' biobrick - because fortunately the synthesized dna made it through customs - we are including it in the registry and the wiki for documentary purposes only. Just follow this link <partinfo>BBa_K792014</partinfo> to access its entry in the registry.
+
Although we did not work in the lab with this ''planB'' biobrick - because fortunately the synthesized dna made it through customs (although very late) - we are including it in the registry and the wiki for documentary purposes only. Just follow this link <partinfo>BBa_K792014</partinfo> to access its entry in the registry.
-
== Bacteria Exportable His-rich peptide Generator ==
+
= Bacteria Exportable His-rich peptide Generator =
-
In the spirit of the competition we decided to design an extra construct besides our main biobricks.  
+
As mentioned before, for this biobrick we had to use solely parts that came in the iGEM Kit 2012 Spring distribution, and that could work for the same purposes that our main biobrick, which is mainly the export of aminoacids.  As there are much more parts for E. coli than for yeast, we decided to build a bacterial device as a "proof of principle" that amino acid secretion can regulated in this way.  
-
As mentioned before, for this biobrick we had to use solely parts that came in the iGEM Kit 2012 Spring distribution, and that could work for the same purposes that our main biobrick, which is mainly the export of aminoacids.
+
We designed a plausible construct that could work for the export of ''His'' using 5 parts of the registry, but we didn't find enough parts in order to design a simmilar one for the export of ''Trp''.  
-
We designed a plausible construct that could work for the export of His using 5 parts of the registry, but we didnt find enough parts in order to design a simmilar one for the export of Trp.  
+
Furthermore, the binding and preparation of this device is much more complex and has many more steps than what our main biobrick would require to work.  Therefore, we conclude that our main biobrick is an important contribution to the registry part, given that it allows the export of aminoacids His and Trp to be enhanced with the use of only one part, without the need of the many steps that we describe in this section and consequently reducing the risk of failure and errors.
-
Furthermore, the binding and preparation of this device is much more complex and has many more steps than what our main biobrick would require to work.
+
<!--
 +
==== Aim ====
-
Therefore, we conclude that our main biobrick is an important contribution to the registry part, given that it allows the export of aminoacids His and Trp to be enhanced with the use of only one part, without the need of the many steps that we describe in this section and consequently reducing the risk of failure and errors.
+
* To create a biobrick that would enhance Histidine secretion in E. coli using standard parts of the registry as a proof that one can increase the production and secretion of an aminoacid and its measurement in the culture medium.
 +
* To learn how to use and merge standard parts from the registry provided at the iGEM Kit.
 +
* To characterize the functioning of existent parts in the registry and new combinations of them, therefore contributing the improvement of the iGEM record.
 +
* To proove that our main biobricks, devices 1 and 3 for the export of His, are an important contribution to iGEM, given that they are capable of His export with far less steps involved.
 +
* To proove that our main biobricks, devices 2 and 4 for the export of Trp, are an important contribution to iGEM, given that there are was no biobrick with such function available.
 +
-->
-
== Aim ==
+
== Device final structure ==
-
- To create a biobrick that would enhance Histidine secretion in E. coli using standard parts of the registry as a proof that one can increase the production and secretion of an aminoacid and its measurement in the culture medium.  
+
{|
 +
|
 +
Our device is composed by:
 +
* '''Promoter''' (<partinfo>BBa_J04500</partinfo>)
 +
* '''Ribosome binding site''' (<partinfo>BBa_B0034</partinfo>)
 +
* '''Peptide signal''' or secretion tag so that the aminoacid is exported out of the cell (<partinfo>BBa_K125310</partinfo>)
 +
* '''Payload''', a ''histidine tag'' repeated several times in order to have a long peptide enriched in this aa (<partinfo>BBa_K133035</partinfo>)
 +
* '''Terminator''' (<partinfo>BBa_B0024</partinfo>)
 +
|
 +
{|width="100%"
 +
|+ '''Structure of the device'''
 +
|align="center" | [[File:Bsas2012-Bb5.png|500px]]
 +
|}
 +
|}
 +
This construct should be able to export '''Histidine''', for sure in ''Cyanobacterium'' and to be tested in ''E.Coli'' and ''S. cereviciae''.
 +
'''More details about the design process (and choices made) can be found in the following sections'''.
-
- To learn how to use and merge standard parts from the registry provided at the iGEM Kit.
+
== Design process ==
-
 
+
=== Promoter ===
-
- To characterize the functioning of existent parts in the registry and new combinations of them, therefore contributing the improvement of the iGEM record.
+
-
 
+
-
 
+
-
- To proove that our main biobricks, devices 1 and 3 for the export of His, are an important contribution to iGEM, given that they are capable of His export with far less steps involved.
+
-
 
+
-
 
+
-
- To proove that our main biobricks, devices 2 and 4 for the export of Trp, are an important contribution to iGEM, given that there are was no biobrick with such function available.
+
-
 
+
-
== Parts to use ==
+
-
 
+
-
In order to create this biobrick we would need a promoter (constitutive or inducible, a ribosome binding site(RBS),a  peptide signal or secretion tag so that the aminoacid is exported out of the cell, a histidine tag (repeated several times in order to have a long peptide enriched in his) and a terminator.
+
-
 
+
-
 
+
-
{| class="wikitable" border="1"
+
-
|-
+
-
|<!--column1-->[[File:Bsas2012-Bb5.png|800px]]
+
-
|-
+
-
|Picture: General Design of Biobrick 5.
+
-
|}
+
-
 
+
-
== Promoter choice ==
+
We found many usable parts to use as promoters. We found Promoters + RBS ideal for our purposes, in order to economize ligation steps.  
We found many usable parts to use as promoters. We found Promoters + RBS ideal for our purposes, in order to economize ligation steps.  
-
+
We considered using two parts:
-
We considered using two Biobricks:
+
# Promoter + RBS (<partinfo>BBa_K206015</partinfo>), a strongest constitutive promoter in J23100 family (J23100) + mid-strength RBS from the community collection (B0030, 0.6.  It looks like a reliable sequence but it has not been tested according to the registry.
 +
# Inducible Promoter (IPTG) + RBS (Strong)  (<partinfo>BBa_J04500</partinfo>). This part has been tested and according to the registry it works well.
-
1) Promoter + RBS: BBa_K206015
+
We finally decided to use the second opton (<partinfo>BBa_J04500</partinfo>)  in order to make our system plausible of regulation through IPTG. This kind of regulation could also have been implemented in our main biobricks, for the same purposes or making the system more flexible.
-
Strongest constitutive promoter in J23100 family (J23100) + mid-strength RBS from the community collection (B0030, 0.6.  
+
-
It looks like a reliable sequence but it has not been tested according to the registry.
+
=== Signal Peptide ===
-
 
+
-
 
+
-
2) Inducible Promoter (IPTG) + RBS (Strong): BBa_J04500
+
-
This part has been tested and according to the registry it works well.
+
-
 
+
-
Sequence:
+
-
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaat
+
-
taatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca
+
-
tactagagaaagaggagaaa
+
-
 
+
-
 
+
-
We finally decided to use Biobrick 2: BBa_J04500, in order to make our system plausible of regulation through IPTG.
+
-
This kind of regulation could also have been implemented in our main biobricks 1 and 3, for the same purposes or making the system more flexible.
+
-
 
+
-
== Signal Peptide Options ==
+
-
Unfortunately, we found very few signal peptide biobrick options, solely two and tested in Cyanobacterium.
+
-
 
+
-
 
+
-
'''Our two options were:'''
+
-
 
+
-
1) pilA1 signal sequence from cyanobacterium Synechocystis; secretes protein: BBa_K125300
+
-
 
+
-
 
+
-
Sequence:
+
-
tggctagtaattttaaattcaaactcctctctcaactctccaaaaaacgggcagaaggtggt
+
-
 
+
-
 
+
-
 
+
-
2) slr2016 signal sequence from cyanobacterium Synechocystis; secretes protein:  BBa_K125310
+
-
 
+
-
 
+
-
Sequence:
+
-
tggcagcaaaacaactatggaaaattttcaatcctagaccgatgaagggtgga
+
 +
Unfortunately, we found very few signal peptide biobrick options, solely two and tested in Cyanobacterium. Our two options were:
 +
# pilA1 signal sequence from cyanobacterium Synechocystis; secretes protein: <partinfo>BBa_K125300</partinfo>
 +
# slr2016 signal sequence from cyanobacterium Synechocystis; secretes protein: <partinfo>BBa_K125310</partinfo>
These parts are only partically confirmed and optimized for working in Cyanobacterium, not E. coli or Yeast. We could use any of them in order to test them but not having any E.coli or yeast optimized signal peptide available at the registry is a critical obstacle in the project.
These parts are only partically confirmed and optimized for working in Cyanobacterium, not E. coli or Yeast. We could use any of them in order to test them but not having any E.coli or yeast optimized signal peptide available at the registry is a critical obstacle in the project.
 +
We would use the second one:  <partinfo>BBa_K125310</partinfo>.
 +
=== Payload ===
-
We would use Biobrick 2:  BBa_K125310.
+
The only option available in iGEM Kit Spring distribution 2012 was Methionine + His Affinity Tag x 6: <partinfo>BBa_K133035</partinfo>. This part is only partially confirmed. We would put this part 3 times in a row in order to have a larger peptide - so it would take 3 ligation steps to obtain a larger peptide enriched Histidine, whereas in our main biobrick 1 and 3, it already comes in the same construct.
-
== HisTag (Payload) Options ==
+
=== Terminator ===
 +
{|
 +
|- valign="top"
 +
| width="70%" |
-
The only option available in iGEM Kit Spring distribution 2012 was:
+
There are several options for terminators, but we would use a double terminator in order to be sure that it works. We choose the double terminator <partinfo>BBa_B0024</partinfo>. This sequence has a double terminator in several of reading frames, which could be very useful.  
-
 
+
| align="center" |
-
Methionine + His Affinity Tag x 6:  BBa_K133035
+
{| class="wikitable" style="width:200px"
-
This part is only partially confirmed.
+
-
 
+
-
 
+
-
We would put this sequence 3 times in a row in order to have a larger peptide:
+
-
 
+
-
Sequence:
+
-
atgcaccaccaccaccaccacatgcaccaccaccaccaccacatgcaccaccaccaccaccac
+
-
 
+
-
 
+
-
Note: It would take 3 ligation steps to obtain a larger peptide enriched Histidine, whereas in our main biobrick 1 and 3, it already comes in the same construct.
+
-
 
+
-
== Terminator ==
+
-
There are several options for terminators, but we would use a double terminator in order to be sure that it works.  
+
-
 
+
-
Double terminador: BBa_B0024
+
-
 
+
-
This sequence has a double terminator in several of reading frames, which could be very useful.  
+
-
 
+
-
 
+
-
Sequence:
+
-
aaataataaaaaagccggattaataatctggctttttatattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtga
+
-
 
+
-
 
+
-
 
+
-
{| class="wikitable" border="1"
+
  |-
  |-
-
  |<!--column1-->[[File:Bsas2012-Translate.png|500px]]
+
  |<!--column1-->[[File:Bsas2012-Translate.png|200px]]
  |-
  |-
-
  |Picture: Different Reading Frames of BBa_B0024. Frames 1 and 3 are useful as double terminators.  
+
  |Different Reading Frames of BBa_B0024. Frames 1 and 3 are useful as double terminators.  
  |}
  |}
 +
|}
-
== Complete construct sequence and chosen assembly method ==  
+
== Assembly method ==  
-
 
+
-
All the chosen parts are compatible with RFC 21 Standard, which is an in frame assembly method and would be our choice for assembling these parts.
+
-
 
+
-
Therefore the final sequence with prefix, suffix and scars would be:
+
 +
All the chosen parts are compatible with '''RFC 21 Standard''', which is an in frame assembly method and would be our choice for assembling these parts.
{| class="wikitable" border="1"
{| class="wikitable" border="1"
Line 149: Line 97:
  |Picture: Final sequence with prefix, suffix and scars assembled with RFC 21 Standard method.  
  |Picture: Final sequence with prefix, suffix and scars assembled with RFC 21 Standard method.  
  |}
  |}
-
 
-
This construct should be able to export histidine, for sure in cyanobacterium and to be tested in ''E.Coli and S. cereviciae.
 
-
''
 

Latest revision as of 02:55, 27 September 2012

Contents

Why this biobrick?

We were having some custom related issues with the synthesized dna we ordered (see aa-rich export devices), so we started designing a biobrick that could be used for the same purpose, but that uses just parts included in the 2012 kit. Yes, you are correct: a PlanB!

Although we did not work in the lab with this planB biobrick - because fortunately the synthesized dna made it through customs (although very late) - we are including it in the registry and the wiki for documentary purposes only. Just follow this link <partinfo>BBa_K792014</partinfo> to access its entry in the registry.

Bacteria Exportable His-rich peptide Generator

As mentioned before, for this biobrick we had to use solely parts that came in the iGEM Kit 2012 Spring distribution, and that could work for the same purposes that our main biobrick, which is mainly the export of aminoacids. As there are much more parts for E. coli than for yeast, we decided to build a bacterial device as a "proof of principle" that amino acid secretion can regulated in this way.

We designed a plausible construct that could work for the export of His using 5 parts of the registry, but we didn't find enough parts in order to design a simmilar one for the export of Trp.

Furthermore, the binding and preparation of this device is much more complex and has many more steps than what our main biobrick would require to work. Therefore, we conclude that our main biobrick is an important contribution to the registry part, given that it allows the export of aminoacids His and Trp to be enhanced with the use of only one part, without the need of the many steps that we describe in this section and consequently reducing the risk of failure and errors.


Device final structure

Our device is composed by:

  • Promoter (<partinfo>BBa_J04500</partinfo>)
  • Ribosome binding site (<partinfo>BBa_B0034</partinfo>)
  • Peptide signal or secretion tag so that the aminoacid is exported out of the cell (<partinfo>BBa_K125310</partinfo>)
  • Payload, a histidine tag repeated several times in order to have a long peptide enriched in this aa (<partinfo>BBa_K133035</partinfo>)
  • Terminator (<partinfo>BBa_B0024</partinfo>)
Structure of the device
Bsas2012-Bb5.png

This construct should be able to export Histidine, for sure in Cyanobacterium and to be tested in E.Coli and S. cereviciae. More details about the design process (and choices made) can be found in the following sections.

Design process

Promoter

We found many usable parts to use as promoters. We found Promoters + RBS ideal for our purposes, in order to economize ligation steps. We considered using two parts:

  1. Promoter + RBS (<partinfo>BBa_K206015</partinfo>), a strongest constitutive promoter in J23100 family (J23100) + mid-strength RBS from the community collection (B0030, 0.6. It looks like a reliable sequence but it has not been tested according to the registry.
  2. Inducible Promoter (IPTG) + RBS (Strong) (<partinfo>BBa_J04500</partinfo>). This part has been tested and according to the registry it works well.

We finally decided to use the second opton (<partinfo>BBa_J04500</partinfo>) in order to make our system plausible of regulation through IPTG. This kind of regulation could also have been implemented in our main biobricks, for the same purposes or making the system more flexible.

Signal Peptide

Unfortunately, we found very few signal peptide biobrick options, solely two and tested in Cyanobacterium. Our two options were:

  1. pilA1 signal sequence from cyanobacterium Synechocystis; secretes protein: <partinfo>BBa_K125300</partinfo>
  2. slr2016 signal sequence from cyanobacterium Synechocystis; secretes protein: <partinfo>BBa_K125310</partinfo>

These parts are only partically confirmed and optimized for working in Cyanobacterium, not E. coli or Yeast. We could use any of them in order to test them but not having any E.coli or yeast optimized signal peptide available at the registry is a critical obstacle in the project.

We would use the second one: <partinfo>BBa_K125310</partinfo>.

Payload

The only option available in iGEM Kit Spring distribution 2012 was Methionine + His Affinity Tag x 6: <partinfo>BBa_K133035</partinfo>. This part is only partially confirmed. We would put this part 3 times in a row in order to have a larger peptide - so it would take 3 ligation steps to obtain a larger peptide enriched Histidine, whereas in our main biobrick 1 and 3, it already comes in the same construct.

Terminator

There are several options for terminators, but we would use a double terminator in order to be sure that it works. We choose the double terminator <partinfo>BBa_B0024</partinfo>. This sequence has a double terminator in several of reading frames, which could be very useful.

Bsas2012-Translate.png
Different Reading Frames of BBa_B0024. Frames 1 and 3 are useful as double terminators.

Assembly method

All the chosen parts are compatible with RFC 21 Standard, which is an in frame assembly method and would be our choice for assembling these parts.

Bsas2012-Finalbb5.JPG
Picture: Final sequence with prefix, suffix and scars assembled with RFC 21 Standard method.
Retrieved from "http://2012.igem.org/Team:Buenos_Aires/Results/Bb2"