Team:Buenos Aires/Results/Bb2

From 2012.igem.org

Revision as of 14:39, 24 September 2012

• iGEM BsAs
  • The team
  • Official roster
  • Members
  • Where we come from

  • Safety
  • Key questions

  • Attributions
  • Attributions

  • Sponsors
  • Institutional

  Data Page
• Project
  • Synthetic ecology
  • Overview
  • Motivation
  • Design
  • Possible applications

  • Schemes
  • Crossfeeding
  • Independent Population Control
  • Cross-population control
  • Stochastic State Transitions

  • Modeling
  • Modeling synEcology
  • Advanced modeling

  Data Page
• Results and Devices
  • Strains characterization
  • Strains description
  • Fluorescence screening
  • Screening of strain proportion
  • Auxotrophy confirmation
  • Coculture in liquid medium
  • Revertant control
  • Trp basal production
  • Growth dependence

  • BBs design
  • Trp/His export devices
  • Backup devices
  • Preparing for sending

  • Testing
  • BioBricks testing
  • SynEco testing

  Data Page
• Human practices
  • Garage Lab
  • Spreading the word
  • Solving local problems

  • EMBO
  • Seeding SynBio in Latin America

  Data Page

Construct Desing based on Biobrick Registry Parts

His Secretion in Bacteria In the spirit of the competition we decided to design an extra construct besides our main biobrick. In this case, we decided to create it solely by using parts that came in the iGEM Kit 2012 distribution, and that could work for the same purposes that our main biobrick, which is mainly the export of aminoacids.

We designed a plausible construct that could work for the export of His using 5 parts of the registry, but we didnt find enough parts in order to design a simmilar one for the export of Trp.

Furthermor, the binding and preparation of this device is much more complex and has many more steps than what our main biobrick needs to work.

Therefore, we conclude that our main biobrick is an important contribution to the registry part, given that it allows the export of aminoacids to be enhanced with the use of only one part, without the need of the many steps that we describe in this section and consequently reducing the risk of failure and errors.

Aim

To create a biobrick that would enhance Histidine secretion in E. coli using standard parts of the registry as a proof that one can increase the production and secretion of an aminoacid and its measurement in the culture medium.

To learn how to use and merge standard parts from the registry provided at the iGEM Kit.

To characterize the functioning of existent parts in the registry and new combinations of them, therefore contributing the improvement of the iGEM record.

Parts to use

Promoter (constitutive or inducible); RBS; Peptide Signal (Secretion Tag), Histitide Tag; Terminator.

Promoter choice

We found many usable parts to use as promoters and chose:

Promoter + RBS: BBa_K081005 http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030

Inducible Promoter (IPTG) + RBS (Strong): BBa_J04500 http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 http://partsregistry.org/wiki/index.php?title=Part:BBa_B0034

We would use the second one, so that the system is plausible of regulation.

Signal Peptide Options

Unfortunately, we found very few signal peptide biobrick options, solely two and tested for cyanobacterium.

"pilA1 signal sequence from cyanobacterium Synechocystis; secretes protein": BBa_K125300 (partially confirmed)

http://partsregistry.org/Part:BBa_K125300 tggctagtaattttaaattcaaactcctctctcaactctccaaaaaacgggcagaaggtggt

"slr2016 signal sequence from cyanobacterium Synechocystis; secretes protein" :  BBa_K125310 (partially confirmed)

http://partsregistry.org/Part:BBa_K125310 tggcagcaaaacaactatggaaaattttcaatcctagaccgatgaagggtgga

We could use any of them, but knowing that they are fit for Cyanobactierium, not E. Coli.

HisTag Options

Methionine + His Affinity Tag x 6: BBa_K133035 (partially confirmed) http://partsregistry.org/Part:BBa_K133035 http://partsregistry.org/cgi/partsdb/puttext.cgi

Methionine is there only to be able to express the protein, so this is a HisTag, and it is functional to our purposes. We would put this 3 times in a row to make the histag stronger but then we have 2 questions:

- the methionine that remains in the middle of each histag, would it make the structure unstable?

For example, placing it three times in a row we get: atgcaccaccaccaccaccac/atgcaccaccaccaccaccac/atgcaccaccaccaccaccac

- This sequence does not carry a Stop Codon and we found that several of the parts of the registry do not carry one either, which could be a major issue.

His Tag BBa_K157011 (Bad Sequencing :( ) http://partsregistry.org/Part:BBa_K157011:Design Discarded for Bad Sequencing

Stop Codon

There are no stop codons in the HIsTag availables at the Kit. Therefore we would need to use another biobrick carrying a stop codon and use its restriction sites to cut it and keep only the Stop Codon part.

There is a biobrick that has several things and then ends with a hisstop. It has several restriction sites before a 6His and Stop, so we could use this part as a biobrick if we were able to cut it. http://partsregistry.org/Part:BBa_K133038

In this site we can see the restriction sites present at this construct: http://tools.neb.com/NEBcutter2/cutshow.php?name=c8ecf24a-

What restriction enzyme do we use in order for the remaining part to be used as a biobrick together with the other ones?

Terminator

There are several options for terminators

Doble terminador: BBa_B0015 ; BBa_B0024

From Coliphage: BBa_B0012

Any of them would be ok for our purposes.