Team:University College London/LabBook/Week9


(Difference between revisions)
(Friday 10.8.12)
(97 intermediate revisions not shown)
Line 51: Line 51:
! Biobrick !! Growth
! Biobrick !! Growth
| 1750016 sample 1 || No Growth
| I750016 sample 1 || No Growth
| 1750016 sample 2 || No Growth
| I750016 sample 2 || No Growth
| 1750016 sample 3 || No Growth
| I750016 sample 3 || No Growth
| B0030 sample 1 || No Growth
| B0030 sample 1 || No Growth
Line 80: Line 80:
<html><div class="protocol protocol-Miniprep">Miniprep Protocol 1 (ANACHEM)</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Miniprep2}}<html></div></html>
<html><div class="protocol protocol-Miniprep">Miniprep Protocol 1 (ANACHEM)</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Miniprep2}}<html></div></html>
<html><div class="protocol protocol-Nanodrop">Nanodrop Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Nanodrop}}<html></div></html>
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html>
?What happened next?
'''Results:''' There was no product for BBa_J23106 on the gel, therefore either the transformation failed or the concentration is very low
Line 105: Line 105:
! Ligation !! No. innoculations !! Broth !! Antibiotic
! Ligation !! No. innoculations !! Broth !! Antibiotic
| J23119 + B0034 || 3 || ||  
| J23119 + B0034 || 3 || Lysogeny Broth || Kanamycin
Line 134: Line 134:
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html>
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html>
?What do we conclude from the gel?
'''Results:''' There was no product on the gel, suggesting the ligation failed.
Line 143: Line 143:
== Monday 8.8.12==
== Monday 8.8.12==
'''Aim:''' To repeat Expt 8.2, where we undertook PCR amplification of PSB1A3, PSB1C3, PSB1K3 for 3A assembly. While we achieved bands of the correct size for all three plasmid backbones in Expt 8.2, the nanodrop concentration for PSB1A3 and PSB1C3 was very low (unusable). Therefore we decided to repeat the PCR. As the concentration of PSB1K3 was not particularly high, we decided to repeat this again also.
'''Aim:''' To repeat Expt 8.2, where we undertook PCR amplification of pSB1A3, pSB1C3, pSB1K3 for 3A assembly. While we achieved bands of the correct size for all three plasmid backbones in Expt 8.2, the nanodrop concentration for pSB1A3 and pSB1C3 was very low (unusable). Therefore we decided to repeat the PCR. As the concentration of pSB1K3 was not particularly high, we decided to repeat this again also.
PCR protocol ??
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html>
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html>
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html>
'''Conclusion:''' There were no products on the gel. We feel the poor nanodrop results from Expt 8.2, and the poor electrophoresis results from this Expt may be a result of the choice of polymerase. Our supervisors recommended we try Phusion Polymerase, which we will attempt tomorrow.
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.1, with a 1000bp ladder. No products were detected. We expected a product corresponding to the size of the plasmid pSB1K3 (2000bp), pSB1C3 (2000bp) and pSB1A3 (2000bp) in Lanes 1-3 respectively. These are indicated by the letters A (pSB1K3), B (pSB1C3) and C (pSB1A3).  
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/1/14/Ucligem2012Expt_9.1.png}}
{| class="wikitable"
! Backbone !! Expected Size
| pSB1K3 || 2204bp
| pSB1C3 || 2070bp
| pSB1A3|| 2155bp
'''Conclusion:'''  We feel the poor nanodrop results from Expt 8.2, and the poor electrophoresis results from this Expt may be a result of the choice of polymerase. Our supervisors recommended we try Phusion Polymerase, which we will attempt tomorrow.
== Tuesday 9.8.12 ==
== Tuesday 9.8.12 ==
Line 158: Line 173:
'''Aim:''' To repeat PCR with Phusion Polymerase to amplify the three plasmid backbones. As we had more confidence that this PCR reaction would work, we included an extra plasmid, pSB1T3, also required for ligation.  
'''Aim:''' To repeat PCR with Phusion Polymerase to amplify the three plasmid backbones. As we had more confidence that this PCR reaction would work, we included an extra plasmid, pSB1T3, also required for ligation.  
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html>
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html>
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html>
'''Conclusion:''' Bands were detected, for all but one plasmid backbone (at the right region) INSERT PIC
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.1, with a 1000bp ladder. In Lane 1 can be seen a product corresponding to the correct size of pSB1A3 (2155) as indicated by A. In Lane 2 is a product, shown by B, which is of the correct size for the plasmid pSB1K3 (22040bp). In Lane 3, we expect a band of size 2461bp, for the plasmid pSB1T3. This is shown by C. As it is absent, it would appear the PCR reaction failed. In Lane 4 is a product corresponding to pSB1C3 (2070bp) as shown by D.
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/9/99/Ucl2012Expt9.1.2.png}}
{| class="wikitable"
! Backbone !! Expected Size
| pSB1K3 || 2204bp
| pSB1C3 || 2070bp
| pSB1A3|| 2155bp
| pSB1T3 || 2461bp
'''Conclusion:''' The PCR reaction worked for pSB1K3, pSB1C3 and pSB1A3. This would suggest the Phusion Polymerase is a better choice than Taq polymerase. These plasmids can now be nanodropped, and if their concentration is sufficient they can be used for ligation.
== Thursday 10.8.12 ==
== Thursday 10.8.12 ==
Line 170: Line 205:
'''Aim:''' To carry out nanodrop for the PCR reaction of plasmids with phusion polymerase
'''Aim:''' To carry out nanodrop for the PCR reaction of plasmids with phusion polymerase
<html><div class="protocol protocol-Nanodrop">Nanodrop Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Nanodrop}}<html></div></html>
<html><div class="protocol protocol-Nanodrop">Nanodrop Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Nanodrop}}<html></div></html>
{| class="wikitable"
{| class="wikitable"
Line 178: Line 215:
! Plasmid !! λ260 !! λ 280
! Plasmid !! λ260 !! λ 280
| PSB1A3 (ng/μl) || 45.7 || 45.4
| pSB1A3 (ng/μl) || 45.7 || 45.4
| PSB1C3 (ng/μl) || 52.2 || 48.0
| pSB1C3 (ng/μl) || 52.2 || 48.0
| PSB1K3 (ng/μl) || 57.9 || 59.4
| pSB1K3 (ng/μl) || 57.9 || 59.4
'''Conclusion:''' The results of the nanodrop indicate that we have usable concentrations of the plasmids, though they are not particularly high. However, we can attempt to use these for 3A ligation.
'''Conclusion:''' The results of the nanodrop indicate that we have usable concentrations of the plasmids, though they are not particularly high. However, we can attempt to use these for 3A ligation.
Line 194: Line 232:
== Wednesday 8.8.12 ==
== Wednesday 8.8.12 ==
'''Aim:''' To extract the Laccase gene for the Degradation module and the irrE gene for the Salt Tolerance module.
'''Aim:''' To extract the Laccase gene for the Degradation module and the IrrE gene for the Salt Tolerance module.
Protocol: Extracting Colony DNA (irrE) - in notes???
DNA for the laccase gene was extracted from cultured colonies according to the protocol below:
Protocol: Genomic Extraction
<html><div class="protocol protocol-DNAExtractionFromColonies">DNA Extraction From Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColonyDNAExtraction}}<html></div></html>
Protocol: Primer Design
DNA for IrrE was extracted by Genomic Extraction
Protocol: Genomic Extraction
Step?: The design of the primers is shown by the table below
<html><div class="protocol protocol-PrimerDesign">Primer Design Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PrimerDesign}}<html></div></html>
The design of the primers is shown by the table below
Protocol: PCR
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html>
Step?: The table below gives the identity of the primers used for each reaction.
'''Step 1 - Setting up PCR tubes''' The table below gives the identity of the primers used for each reaction.
{| class="wikitable"
{| class="wikitable"
Line 224: Line 265:
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc
| rowspan="4" |BBa_K729001 || rowspan="4" |IrrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc
|  ST2R ||tcactgtgcagcgtcctgcg
|  ST2R ||tcactgtgcagcgtcctgcg
Line 232: Line 273:
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg
== Thursday 9.8.12 ==
== Thursday 9.8.12 ==
Line 252: Line 292:
'''Aim:''' inoculation of marine bacterium. We aim to grow up a stock of the marine bacterium Oceanibulbus indolifex, which has been selected as one of the chassis we wish to investigate.  
'''Aim:''' inoculation of marine bacterium. We aim to grow up a stock of the marine bacterium Oceanibulbus indolifex, which has been selected as one of the chassis we wish to investigate.  
Oceanibulbus was ordered from NCMB and recieved as a liquid stock.  
Oceanibulbus was ordered from NCMB and recieved as a liquid stock.  
Step 1: Prepare agar plates
Step 1: Prepare agar plates
Step 2: Dip an inoculation loop into the liquid stock of bacteria and spread over the surface of the agar
Step 2: Dip an inoculation loop into the liquid stock of bacteria and spread over the surface of the agar
Step 3: Leave the bacteria to grow overnight or over the weekend.
Step 3: Leave the bacteria to grow overnight or over the weekend.
== Friday 10.8.12 ==
== Friday 10.8.12 ==
Line 266: Line 309:
'''Results:''' The image below indicates there was growth for both inoculations of O.indolifex.  
'''Results:''' The image below indicates there was growth for both inoculations of O.indolifex.  
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/9/9f/Ucligem2012Oceo.png}}
Line 273: Line 317:
== Thursday 9.8.12 ==
== Thursday 9.8.12 ==
'''Aim:''' To check the selectivity of our antibiotic stocks. After growth on agar plates, our transformations frequently fail to grow after inoculation into falcons. This has led us to consider the possibility that the selection has not been strong enough, leading to the growth of untransformed cells. Today we will set up the agar plates using the stocks we wish to test.
'''Aim:''' To check the selectivity of our antibiotic stocks. After growth on agar plates, our transformations frequently fail to grow after inoculation into falcons. This has led us to consider the possibility that the selection has not been strong enough, leading to the growth of untransformed cells. We have designed an experiment to test whether our stocks of antibiotics are effective enough. Numerous agar plates will be made with varying antibiotic resistance, and will be inoculated with a variety of antibiotic-resistant and non-resistant bacteria. If non-resistant bacteria can grow on the antibiotic-inoculated agar, we will have some indication of whether the antibiotic activity is high enough.
Making plates
Making plates
'''Step?:''' The table below indicates the plates that were made with each antibiotic. NB// we have several eppendorf stocks of antibiotics; the plate was labelled according to the eppendorf stock it came from. This is intended to identify any of our stocks which may not be of sufficient quality to create a selective agar.  
The table below indicates the plates that were made with each antibiotic. NB// we have several eppendorf stocks of antibiotics; the plate was labelled according to the eppendorf stock it came from. This is intended to identify any of our stocks which may not be of sufficient quality to create a selective agar.  
{| class="wikitable"
{| class="wikitable"
Line 284: Line 330:
! Antibiotic Stock !! Presumed Concentration
! Antibiotic Stock !! Presumed Concentration
| Kanamycin 06 ||  
| Kanamycin 01 || 50ug/ml
| Tetracycline 02 ||  
| Chloramphenicol 01 || 50ug/ml
| Tetracycline 09||  
| Chloramphenicol 02 || 50ug/ml
| Chloramphenicol 03 || 50ug/ml
| Tetracycline 01 || 50ug/ml
| Tetracycline 02|| 50ug/ml
| Tetracycline 03 || 50ug/ml
| Ampicillin 01 || 50ug/ml
| Ampicillin 01 || 50ug/ml
Line 298: Line 352:
| Ampicillin 04 || 50ug/ml
| Ampicillin 04 || 50ug/ml
== Friday 10.8.12 ==
== Friday 10.8.12 ==
Line 304: Line 357:
'''Aim:''' To set up our samples on the plates made yesterday
'''Aim:''' To set up our samples on the plates made yesterday
'''Method:''' the plates from yesterday have been split into half (in order to prevent wasting resources). Each side is being treated as a separate sample.
'''Method:''' the plates from yesterday have been split into half (in order to prevent wasting resources). Each side is being treated as a separate sample.
Step?: The following table summarises the type of plates and their contents. Top10, W3110 and pTopDsh have no antibiotic resistance, and so they are our negative controls – there should be no growth except on drug-free agar.
The following table summarises the type of plates and their contents. Top10, W3110 and pTopDsh have no antibiotic resistance, and so they are our negative controls – there should be no growth except on drug-free agar. WNu has Ampicillin resistant, and should go in the presence of Ampicillin but not other antiobiotics. pTopDsh carries Tetracycline resistance, and should grow in the presence of Tetracycline but not the other antibiotics.
{| class="wikitable"
! Antibiotic Stock !! Sample Added !! Expected Result !! Result
|rowspan="2"| Kanamycin 01 || WNu || No growth (WNu is Ampicillin resistant only) || no colony
| WNu|| No growth (WNu is Ampicillin resistant only)|| no colony
|rowspan="2"| Chloramphenicol 01 || Cobalt Curli Cells  || Growth (Cobalt Curli cells is Chloramphenicol resistant) || colonies
| WNu || No growth (WNu is Ampicillin resistant only)|| no colony
|rowspan="2"| Chloramphenicol 02 ||Cobalt Curli Cells || Growth (Cobalt Curli cells is Chloramphenicol resistant) || colonies
| WNu || No growth (WNu is Ampicillin resistant only)|| no colony
|rowspan="2"| Chloramphenicol 03 || Cobalt Curli Cells|| Growth (Cobalt Curli cells is Chloramphenicol resistant) || colonies
|W3110 || No growth (W3110 has no resistance)|| no colony
|rowspan="2"| Tetracycline 01|| WNu ||No growth (WNu is Ampicillin resistant only)|| no colony
|75 ||Growth (75 is Tetracycline Resistant)|| colonies
|rowspan="2"| Tetracycline 02|| WNu ||No growth (WNu is Ampicillin resistant only)|| no colony
|75 ||Growth (75 is Tetracycline Resistant)|| colonies
|rowspan="2"| Tetracycline 03|| WNu ||No growth (WNu is Ampicillin resistant only)|| no colony
|75 ||Growth (75 is Tetracycline Resistant)|| no colony
|rowspan="2"|  Ampicillin 01 || pTopDsh || No Growth (pTopDsh has no resistance)|| no colony
|WNu||No growth (WNu is Ampicillin resistant only)|| colonies
| rowspan="2"| Ampicillin 02|| WNu || Growth (WNu is Ampicillin resistant)|| no colony
|W3100 || No Growth (W3100 has no resistance)|| colonies
| rowspan="2"| Ampicillin 03 || WNu ||Growth (WNu is Ampicillin resistant)|| no colony
| pTopDsh || No Growth (pTopDsh has no resistance)|| no colony
|rowspan="2"|  Ampicillin 04 || WNu ||Growth (WNu is Ampicillin resistant)|| colonies
| pTopDsh || No Growth (pTopDsh has no resistance)|| no colony
|rowspan="5"|  Control - No Drug || W3110 || Growth||colonies
| Top10 || Growth||‎ colonies
| 75 || Growth|| colonies
| CoCurli || Growth|| colonies
|pTopDsh || Growth|| colonies
Plates results are as expected, no problem with the activity of the antibiotics however we are not sure if the antibiotic are at the concentration stated. 
Line 314: Line 429:
== 9-5==
== Friday 10.8.12 ==
'''Aim:''' To characterise the unmodified Curli BioBrick. As part of our experiment, we want to change the promoter in front of the Curli cluster of genes. This experiment will test the protocol we intend to use using the original BioBrick (BBa_K540000)
Congo Red
<html><div class="protocol protocol-CurliCharacterisation">Curli Characterisation Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/CurliCharacterisation}}<html></div></html>
'''Step 2 - Streak Cells:''' Streak a sample of WNu onto a Antibiotic-inoculated Congo Red plate and a Antibiotic-Free Congo Red Plate. Do the same for the CoCurli (BBa_K540000 transformed) cells. The table below indicates the results expected for each of these four plates.
{| class="wikitable"
! Cell Type !! Expected Results on Antibiotic-free Congo Red Agar !! Expected Results on Chloramphenicol-inoculated Congo Red Agar
|  WNu || Formation of White Colonies || No Colony Formation (WNu are not Chloramphenicol-resistant)
|  K540000 (cobalt curli) transformed cells || Formation of Red Colonies ||  Formation of Red Colonies
'''Step 3 - Incubate:''' A sample of each were cultured at 30 degrees over the weekend because Curli production is expressed better at lower temperatures.
</div><div class="experiment"></div><img id="9-6" src="" /><div class="experimentContent">
</div><div class="experiment"></div><img id="9-6" src="" /><div class="experimentContent">
== 9-6==
== Friday 10.8.12==
'''Aim:''' To assay the nuclease activity in a test of the protocol. We will use a cell line called WNu which has native secreted nuclease activity. This, alongside a nuclease-negative control, will be cultured on agar containing DNA. Nuclease activity will be indicated by the presence of 'halos' surrounding the colonies, where nuclease activity has degraded DNA and increased the translucence of the agar.
Prepare DNAase agar +IPTG + amp.
The table below summarises the results from this experiment. Also included is an image of the agars, with the halo of nuclease activity indicated.
{| class="wikitable"
! Sample !! Ampicillin + IPTG !! Ampicillin !! No Antibiotic
|Control BBa_K540000 transformed cells || Opaque || Opaque || Opaque
| WNu Cells || Halo Formation || Halo Formation || Halo Formation
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/ed/Ucligem2012expt9.6.png}}
</div><div class="experiment"></div></html>
</div><div class="experiment"></div></html>

Latest revision as of 03:51, 27 September 2012


Monday 6.7.12

Aim: Inoculate the Plates that were transformed on Thursday. On Thursday we began Expt 8.5 by transforming the BioBricks, and our results on Friday indicated there was growth for all. (However, the negative control was contaminated, so we will have to be careful to assess the analytical restriction digest for correct products). The table below describes the BioBricks that were used:

The two constitutive promoters were used because we were never able to detect our previous constitutive promoter BBa_J23119 (Expt 7.3) and our 3A ligation of BBa_J23119 and BBa_B0034 failed (Expt 8.4). This does not necessarily indicate our transformation of BBa_J23119 has failed, but we decided to transform several more in case. The RBS promoter BBa_B0030 was transformed for the same reason. The Gas Vesicle Cluster was transformed because all previous attempts have failed.


Picking Colonies Protocol
Step 1 – Creating culture media: In a sterile environment, set up X numbers of falcons, each with 5mls of media.

Step 2 - Inoculating Colonies into a Selective Broth:: Add Yul of antibiotic to reach desired antibiotic concentration.

(For Ampicillin this is 50ug/ml, For Kanamycin it is 25ug/ml, for Tetracycline it is 15ug/ml, and for Chloramphenicol it is 25ug/ml)

Step 4 – Selecting a Colony: Select a clear, isolated colony and using an inoculation hoop scoop up a colony onto the tip. Deposit in the falcon tube

Step 5 - Culture: Culture your falcon tubes overnight at a temperature of 37 oC. Leave for no longer than 16 hours.

Step 2 – Inoculating Colonies into a Selective Broth: The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.

Samples Volume Inoculated Broth (ml) Antibiotic (ug/ml)
BioBrick BBa_J23100 10ul Lysogeny Broth (5) Ampicillin(50ug/ml)
BBa_J23106 10ul
BBa_B0030 10ul
BBa_I750016 10ul

Tuesday 7

Aim: Results from Colony Picking

ResultsThe table below indicates there was growth for all BioBricks.

Biobrick Growth
I750016 sample 1 No Growth
I750016 sample 2 No Growth
I750016 sample 3 No Growth
B0030 sample 1 No Growth
B0030 sample 2 No Growth
B0030 sample 3 No Growth
J23100 sample 1 No Growth
J23100 sample 2 No Growth
J23100 sample 3 No Growth
J23106 sample 1 Growth
J23106 sample 1 Growth
J23106 sample 1 Growth

Conclusion: We are unsure why we have failed to get colonies for many of the BioBricks. Again, we are considering the possibility that our agar is not selective enough. Initially we thought this may be due to adding Antibiotic while the agar is too hot, leading to degradation of the sample. However this has been corrected in the protocol, but the problem is persisting. Instead we are considering running a troubleshoot by testing the selectivity of the various eppendorfs of antibiotic stocks we made at the beginning of the summer. If any show less selectivity then we can stop using them. This will be considered for later in the week. Meanwhile, we can miniprep and nanodrop BBa_J23106 (strong constitutive promoter)

Miniprep Protocol 1 (ANACHEM)

Step 1 - Pellet Cells: Pellet 1.5-5ml bacterial culture containing the plasmid by centrifugation g = 6000

Time = 2 min

Temperature = (15-25oC)

Step 2 - Resuspend Cells: Add 250ul S1 to the pellet and resuspend the cells completely by vortexing or pipetting. Transfer the suspension to a clean 1.5ml microcentrifuge tube.

Step 3 - Puncturing Cell Membrane: Add 250ul S2 gently mix by inverting the tube 4-6 times to obtain a clear lysate. Incubate on ice or at room temperature for NOT longer than 5 min.

Step 4 - Neutralising S2: Add 400ul Buffer NB and gently mix by inverting the tube 6-10 times, until a white precipitate forms.

Step 5 - Centrifuge:

g: 14000

Time:10 minutes

Temperature: (15-25oC)

Step 6 - Centrifuge: Transfer the supernatant into a column assembled in a clean collection tube (provided. Centrifuge:

g = 10,000

Time: 1 minute

Temperature: (15-25oC)

Step 7 - Wash Column: Discard the flow-through and wash the spin column by adding 700ul of Wash Buffer. Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 8 - Remove residual ethanol: Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 9 - Elute DNA: Place the column into a clean microcentrifuge tube. Add 50-100ul of Elution Buffer, TE buffer or sterile water directly onto column membrane and stand for 1 min. Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 10 - Storage: Store DNA at 4oC or -20oC

Electrophoresis Protocol

Preparing the Gel

Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water

Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.

Step 3: Cool solution under running cold water.

Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)

Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles

Running a gel

Step 6: Add 1 part loading buffer to five parts of loading sample

Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm

Step 8: Add 5ul of DNA ladder to lane 1

Step 9: Add samples to the remaining wells

Step 10: Run at 100 volts for 1hour and 15 minutes

Imaging the Gel

Step 11: Place gel in GelDoc 2000 chamber

Step 12: Turn GelDoc 2000 chamber on 

Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire

Step 14: Alter the exposure/settings to give a clear image.

TAE - Tris-acetate-EDTA

EDTA - ethylenediamine tetraacetic acid

Results: There was no product for BBa_J23106 on the gel, therefore either the transformation failed or the concentration is very low

Monday 6.7.12

Aim: Repeat the inoculation of the ligation products (J23119 + B0034) done last week. Innoculation is only done for the (J23119 + B0034), but not for the (starvation promoter + B0034) because that ligation did not transform.


Picking Colonies Protocol
Step 1 – Creating culture media: In a sterile environment, set up X numbers of falcons, each with 5mls of media.

Step 2 - Inoculating Colonies into a Selective Broth:: Add Yul of antibiotic to reach desired antibiotic concentration.

(For Ampicillin this is 50ug/ml, For Kanamycin it is 25ug/ml, for Tetracycline it is 15ug/ml, and for Chloramphenicol it is 25ug/ml)

Step 4 – Selecting a Colony: Select a clear, isolated colony and using an inoculation hoop scoop up a colony onto the tip. Deposit in the falcon tube

Step 5 - Culture: Culture your falcon tubes overnight at a temperature of 37 oC. Leave for no longer than 16 hours.

Step 2 – Inoculating Colonies into a Selective Broth: The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.

Ligation No. innoculations Broth Antibiotic
J23119 + B0034 3 Lysogeny Broth Kanamycin

Tuesday 7

Aim: Check results of Colony Picking

Results: The table below indicates whether there was growth for the BioBricks ligations

Ligation Growth/No Growth
J23119+B0034 sample 1 Growth
J23119+B0034 sample 2 Growth
J23119+B0034 sample 3 Growth

Conclusion: We can proceed now to miniprep the samples, and run them on a gel to test the presence of a band


Miniprep Protocol 1 (ANACHEM)

Step 1 - Pellet Cells: Pellet 1.5-5ml bacterial culture containing the plasmid by centrifugation g = 6000

Time = 2 min

Temperature = (15-25oC)

Step 2 - Resuspend Cells: Add 250ul S1 to the pellet and resuspend the cells completely by vortexing or pipetting. Transfer the suspension to a clean 1.5ml microcentrifuge tube.

Step 3 - Puncturing Cell Membrane: Add 250ul S2 gently mix by inverting the tube 4-6 times to obtain a clear lysate. Incubate on ice or at room temperature for NOT longer than 5 min.

Step 4 - Neutralising S2: Add 400ul Buffer NB and gently mix by inverting the tube 6-10 times, until a white precipitate forms.

Step 5 - Centrifuge:

g: 14000

Time:10 minutes

Temperature: (15-25oC)

Step 6 - Centrifuge: Transfer the supernatant into a column assembled in a clean collection tube (provided. Centrifuge:

g = 10,000

Time: 1 minute

Temperature: (15-25oC)

Step 7 - Wash Column: Discard the flow-through and wash the spin column by adding 700ul of Wash Buffer. Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 8 - Remove residual ethanol: Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 9 - Elute DNA: Place the column into a clean microcentrifuge tube. Add 50-100ul of Elution Buffer, TE buffer or sterile water directly onto column membrane and stand for 1 min. Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 10 - Storage: Store DNA at 4oC or -20oC

Electrophoresis Protocol

Preparing the Gel

Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water

Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.

Step 3: Cool solution under running cold water.

Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)

Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles

Running a gel

Step 6: Add 1 part loading buffer to five parts of loading sample

Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm

Step 8: Add 5ul of DNA ladder to lane 1

Step 9: Add samples to the remaining wells

Step 10: Run at 100 volts for 1hour and 15 minutes

Imaging the Gel

Step 11: Place gel in GelDoc 2000 chamber

Step 12: Turn GelDoc 2000 chamber on 

Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire

Step 14: Alter the exposure/settings to give a clear image.

TAE - Tris-acetate-EDTA

EDTA - ethylenediamine tetraacetic acid

Results: There was no product on the gel, suggesting the ligation failed.

Monday 8.8.12

Aim: To repeat Expt 8.2, where we undertook PCR amplification of pSB1A3, pSB1C3, pSB1K3 for 3A assembly. While we achieved bands of the correct size for all three plasmid backbones in Expt 8.2, the nanodrop concentration for pSB1A3 and pSB1C3 was very low (unusable). Therefore we decided to repeat the PCR. As the concentration of pSB1K3 was not particularly high, we decided to repeat this again also.


PCR Protocol

Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below

PCR Components Volume (ul)
5x Reaction Buffer 10
25mM MgCl2 4
10mM dNTPs 1
10uM Forward primer 5
10uM Reverse primer 5
DNA Polymerase 0.25
Nuclease Free Water 24.25
Template DNA 0.5
Total Volume 0.5

Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.

PCR conditions Temp (oC) Time (s)
Initial Denaturation (1 cycle) 95 30
Denaturation/Annealing/Extension (30 cycles) 95/55/72 10/25/120
Final Extension (1 cycle) 72 600
Hold 4

Electrophoresis Protocol

Preparing the Gel

Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water

Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.

Step 3: Cool solution under running cold water.

Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)

Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles

Running a gel

Step 6: Add 1 part loading buffer to five parts of loading sample

Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm

Step 8: Add 5ul of DNA ladder to lane 1

Step 9: Add samples to the remaining wells

Step 10: Run at 100 volts for 1hour and 15 minutes

Imaging the Gel

Step 11: Place gel in GelDoc 2000 chamber

Step 12: Turn GelDoc 2000 chamber on 

Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire

Step 14: Alter the exposure/settings to give a clear image.

TAE - Tris-acetate-EDTA

EDTA - ethylenediamine tetraacetic acid

Results: The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.1, with a 1000bp ladder. No products were detected. We expected a product corresponding to the size of the plasmid pSB1K3 (2000bp), pSB1C3 (2000bp) and pSB1A3 (2000bp) in Lanes 1-3 respectively. These are indicated by the letters A (pSB1K3), B (pSB1C3) and C (pSB1A3).

Backbone Expected Size
pSB1K3 2204bp
pSB1C3 2070bp
pSB1A3 2155bp

Conclusion: We feel the poor nanodrop results from Expt 8.2, and the poor electrophoresis results from this Expt may be a result of the choice of polymerase. Our supervisors recommended we try Phusion Polymerase, which we will attempt tomorrow.

Tuesday 9.8.12

Aim: To repeat PCR with Phusion Polymerase to amplify the three plasmid backbones. As we had more confidence that this PCR reaction would work, we included an extra plasmid, pSB1T3, also required for ligation.


PCR Protocol

Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below

PCR Components Volume (ul)
5x Reaction Buffer 10
25mM MgCl2 4
10mM dNTPs 1
10uM Forward primer 5
10uM Reverse primer 5
DNA Polymerase 0.25
Nuclease Free Water 24.25
Template DNA 0.5
Total Volume 0.5

Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.

PCR conditions Temp (oC) Time (s)
Initial Denaturation (1 cycle) 95 30
Denaturation/Annealing/Extension (30 cycles) 95/55/72 10/25/120
Final Extension (1 cycle) 72 600
Hold 4

Electrophoresis Protocol

Preparing the Gel

Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water

Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.

Step 3: Cool solution under running cold water.

Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)

Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles

Running a gel

Step 6: Add 1 part loading buffer to five parts of loading sample

Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm

Step 8: Add 5ul of DNA ladder to lane 1

Step 9: Add samples to the remaining wells

Step 10: Run at 100 volts for 1hour and 15 minutes

Imaging the Gel

Step 11: Place gel in GelDoc 2000 chamber

Step 12: Turn GelDoc 2000 chamber on 

Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire

Step 14: Alter the exposure/settings to give a clear image.

TAE - Tris-acetate-EDTA

EDTA - ethylenediamine tetraacetic acid

Results: The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.1, with a 1000bp ladder. In Lane 1 can be seen a product corresponding to the correct size of pSB1A3 (2155) as indicated by A. In Lane 2 is a product, shown by B, which is of the correct size for the plasmid pSB1K3 (22040bp). In Lane 3, we expect a band of size 2461bp, for the plasmid pSB1T3. This is shown by C. As it is absent, it would appear the PCR reaction failed. In Lane 4 is a product corresponding to pSB1C3 (2070bp) as shown by D.

Backbone Expected Size
pSB1K3 2204bp
pSB1C3 2070bp
pSB1A3 2155bp
pSB1T3 2461bp

Conclusion: The PCR reaction worked for pSB1K3, pSB1C3 and pSB1A3. This would suggest the Phusion Polymerase is a better choice than Taq polymerase. These plasmids can now be nanodropped, and if their concentration is sufficient they can be used for ligation.

Thursday 10.8.12

Aim: To carry out nanodrop for the PCR reaction of plasmids with phusion polymerase


Nanodrop Protocol

Software ND-1000 Model:

Step 1: Initialise the spectrophotometer by pipetting 1 µ of clean water onto lower optic surface, lowering the lever arm and selecting ‘initialise’ in the ND-1000 software

Step 2: Wipe and add elution buffer as negative control. Click blank in ND-1000 software

Step 3: Wipe and add 1 µl sample

Step 4: On the software set lambda to 260nm

Step 5: Lower the lever arm and click measure in ND-1000 software

Step 6: Take readings for concentration and purity

Step 7: Once measurement complete, wipe surface

Plasmid λ260 λ 280
pSB1A3 (ng/μl) 45.7 45.4
pSB1C3 (ng/μl) 52.2 48.0
pSB1K3 (ng/μl) 57.9 59.4

Conclusion: The results of the nanodrop indicate that we have usable concentrations of the plasmids, though they are not particularly high. However, we can attempt to use these for 3A ligation.

Wednesday 8.8.12

Aim: To extract the Laccase gene for the Degradation module and the IrrE gene for the Salt Tolerance module.


DNA for the laccase gene was extracted from cultured colonies according to the protocol below:

DNA Extraction From Colonies Protocol

Step 1 - Picking Colony: Using a pipette select an isolated colony

Step 2 - Deposit: Dip the colony in 10ul of dH20, preferably in screw top container

Step 3 - Boiling Stage:Boil the dH20 100 for 5-10mins

Step 4 - Centrifuge:

Time: 1 min

RPM: 8000

Temp: 18oC

Step 5 - Remove Supernatant: The supernatant contains the DNA template.

DNA for IrrE was extracted by Genomic Extraction

Protocol: Genomic Extraction

Primer Design Protocol

Primers should be designed to:

1) Be 18-25 nucleotides in length

2) Have a melting temperature that does not differ by more than 5oC between the two primers of a pair

3) GC nucleotides should constitute 40-60%

4) Have a 3’primer end that is not complimentary to any region of the primer pair

5) Contain an equal distribution of the nucleotides

6) Closely match the target sequence (and so known polymorphic sites are avoided)

7) Have a GC clamp on either end

The design of the primers is shown by the table below

PCR Protocol

Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below

PCR Components Volume (ul)
5x Reaction Buffer 10
25mM MgCl2 4
10mM dNTPs 1
10uM Forward primer 5
10uM Reverse primer 5
DNA Polymerase 0.25
Nuclease Free Water 24.25
Template DNA 0.5
Total Volume 0.5

Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.

PCR conditions Temp (oC) Time (s)
Initial Denaturation (1 cycle) 95 30
Denaturation/Annealing/Extension (30 cycles) 95/55/72 10/25/120
Final Extension (1 cycle) 72 600
Hold 4

Step 1 - Setting up PCR tubes The table below gives the identity of the primers used for each reaction.

DNA Extracted Function Module Primer Pair Primer Primer Sequence
BBa_K729002 Laccase GeneDegradation LR1/LF1 LR1 gaatacggtctttttataccg
LF1 gaaataactatgcaacgtcg
REVLF2/LFTW0 REVLF2 gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg
LFTW0 gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg
BBa_K729001 IrrESalt Tolerance STF1/ST2RSTF1 atggggccaaaagctaaagctgaagcc
ST2R tcactgtgcagcgtcctgcg
STF3/ST4R STF3 gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc
ST4R gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg

Thursday 9.8.12

Aim: Run a gel for the PCR reaction of irrE and Laccase carried out yesterday.


Electrophoresis Protocol

Preparing the Gel

Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water

Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.

Step 3: Cool solution under running cold water.

Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)

Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles

Running a gel

Step 6: Add 1 part loading buffer to five parts of loading sample

Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm

Step 8: Add 5ul of DNA ladder to lane 1

Step 9: Add samples to the remaining wells

Step 10: Run at 100 volts for 1hour and 15 minutes

Imaging the Gel

Step 11: Place gel in GelDoc 2000 chamber

Step 12: Turn GelDoc 2000 chamber on 

Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire

Step 14: Alter the exposure/settings to give a clear image.

TAE - Tris-acetate-EDTA

EDTA - ethylenediamine tetraacetic acid

Results: The image belows shows that the gel failed to produce any products of the correct size. We feel the best explanation of this is that there was human error somewhere along the lines – leading to a mix up of the samples.

Thursday 9.8.12

Aim: inoculation of marine bacterium. We aim to grow up a stock of the marine bacterium Oceanibulbus indolifex, which has been selected as one of the chassis we wish to investigate.

Method Oceanibulbus was ordered from NCMB and recieved as a liquid stock.

Step 1: Prepare agar plates

Step 2: Dip an inoculation loop into the liquid stock of bacteria and spread over the surface of the agar

Step 3: Leave the bacteria to grow overnight or over the weekend.

Friday 10.8.12

Aim: Check the results of O.indolifex culture

Results: The image below indicates there was growth for both inoculations of O.indolifex.

Thursday 9.8.12

Aim: To check the selectivity of our antibiotic stocks. After growth on agar plates, our transformations frequently fail to grow after inoculation into falcons. This has led us to consider the possibility that the selection has not been strong enough, leading to the growth of untransformed cells. We have designed an experiment to test whether our stocks of antibiotics are effective enough. Numerous agar plates will be made with varying antibiotic resistance, and will be inoculated with a variety of antibiotic-resistant and non-resistant bacteria. If non-resistant bacteria can grow on the antibiotic-inoculated agar, we will have some indication of whether the antibiotic activity is high enough.

Method: Making plates

The table below indicates the plates that were made with each antibiotic. NB// we have several eppendorf stocks of antibiotics; the plate was labelled according to the eppendorf stock it came from. This is intended to identify any of our stocks which may not be of sufficient quality to create a selective agar.

Antibiotic Stock Presumed Concentration
Kanamycin 01 50ug/ml
Chloramphenicol 01 50ug/ml
Chloramphenicol 02 50ug/ml
Chloramphenicol 03 50ug/ml
Tetracycline 01 50ug/ml
Tetracycline 02 50ug/ml
Tetracycline 03 50ug/ml
Ampicillin 01 50ug/ml
Ampicillin 02 50ug/ml
Ampicillin 03 50ug/ml
Ampicillin 04 50ug/ml

Friday 10.8.12

Aim: To set up our samples on the plates made yesterday

Method: the plates from yesterday have been split into half (in order to prevent wasting resources). Each side is being treated as a separate sample.

The following table summarises the type of plates and their contents. Top10, W3110 and pTopDsh have no antibiotic resistance, and so they are our negative controls – there should be no growth except on drug-free agar. WNu has Ampicillin resistant, and should go in the presence of Ampicillin but not other antiobiotics. pTopDsh carries Tetracycline resistance, and should grow in the presence of Tetracycline but not the other antibiotics.

Antibiotic Stock Sample Added Expected Result Result
Kanamycin 01 WNu No growth (WNu is Ampicillin resistant only) no colony
WNu No growth (WNu is Ampicillin resistant only) no colony
Chloramphenicol 01 Cobalt Curli Cells Growth (Cobalt Curli cells is Chloramphenicol resistant) colonies
WNu No growth (WNu is Ampicillin resistant only) no colony
Chloramphenicol 02 Cobalt Curli Cells Growth (Cobalt Curli cells is Chloramphenicol resistant) colonies
WNu No growth (WNu is Ampicillin resistant only) no colony
Chloramphenicol 03 Cobalt Curli Cells Growth (Cobalt Curli cells is Chloramphenicol resistant) colonies
W3110 No growth (W3110 has no resistance) no colony
Tetracycline 01 WNu No growth (WNu is Ampicillin resistant only) no colony
75 Growth (75 is Tetracycline Resistant) colonies
Tetracycline 02 WNu No growth (WNu is Ampicillin resistant only) no colony
75 Growth (75 is Tetracycline Resistant) colonies
Tetracycline 03 WNu No growth (WNu is Ampicillin resistant only) no colony
75 Growth (75 is Tetracycline Resistant) no colony
Ampicillin 01 pTopDsh No Growth (pTopDsh has no resistance) no colony
WNuNo growth (WNu is Ampicillin resistant only) colonies
Ampicillin 02 WNu Growth (WNu is Ampicillin resistant) no colony
W3100 No Growth (W3100 has no resistance) colonies
Ampicillin 03 WNu Growth (WNu is Ampicillin resistant) no colony
pTopDsh No Growth (pTopDsh has no resistance) no colony
Ampicillin 04 WNu Growth (WNu is Ampicillin resistant) colonies
pTopDsh No Growth (pTopDsh has no resistance) no colony
Control - No Drug W3110 Growthcolonies
Top10 Growth‎ colonies
75 Growth colonies
CoCurli Growth colonies
pTopDsh Growth colonies

Plates results are as expected, no problem with the activity of the antibiotics however we are not sure if the antibiotic are at the concentration stated.

Friday 10.8.12

Aim: To characterise the unmodified Curli BioBrick. As part of our experiment, we want to change the promoter in front of the Curli cluster of genes. This experiment will test the protocol we intend to use using the original BioBrick (BBa_K540000)


Congo Red

Curli Characterisation Protocol

Step 1 - Prepare: Set out the Congo Red plates already prepared.

Step 2 - Streak Cells: Streak a sample of control cells (cells not expressing Curli) onto one antiobiotic-free congo red plate, and onto one antibiotic-inoculated congo red plate. Do the same for the curli-expressing cell line.

Step 3 - Incubate: Incubate cells overnight at 37oC or over the weekend at 30oC.

Step 2 - Streak Cells: Streak a sample of WNu onto a Antibiotic-inoculated Congo Red plate and a Antibiotic-Free Congo Red Plate. Do the same for the CoCurli (BBa_K540000 transformed) cells. The table below indicates the results expected for each of these four plates.

Cell Type Expected Results on Antibiotic-free Congo Red Agar Expected Results on Chloramphenicol-inoculated Congo Red Agar
WNu Formation of White Colonies No Colony Formation (WNu are not Chloramphenicol-resistant)
K540000 (cobalt curli) transformed cells Formation of Red Colonies Formation of Red Colonies

Step 3 - Incubate: A sample of each were cultured at 30 degrees over the weekend because Curli production is expressed better at lower temperatures.

Friday 10.8.12

Aim: To assay the nuclease activity in a test of the protocol. We will use a cell line called WNu which has native secreted nuclease activity. This, alongside a nuclease-negative control, will be cultured on agar containing DNA. Nuclease activity will be indicated by the presence of 'halos' surrounding the colonies, where nuclease activity has degraded DNA and increased the translucence of the agar.

Method Prepare DNAase agar +IPTG + amp.

Results The table below summarises the results from this experiment. Also included is an image of the agars, with the halo of nuclease activity indicated.

Sample Ampicillin + IPTG Ampicillin No Antibiotic
Control BBa_K540000 transformed cells Opaque Opaque Opaque
WNu Cells Halo Formation Halo Formation Halo Formation