Self-service!

To mark a part as finished, add "✓" before the title. To mark it as taken, add your name(s) after the title in the following way: "<title> - <name(s)>".

For TAs

✓ Buy antibodies!

[1]

LovTAP

Info on LovTAP - Diego

References on the fluorescence of LOV2: [2], [3]

Original RO plasmid

✓ RO plasmid + Spc transfromation

Using our competent cells. Done on June the 28th, and on June the 29th. Plates with colonies in the fridge.

✓ Miniprep and gel

Done on June the 29th and July 4th. Looks like transformation was a success!!

✓ Maxiprep

Done the 12th July. Digestion and gel done the 16th July.

Insert polyA

The readout has no polyA!

✓ Digest RO plasmid for polyA insertion

Plasmid digested with KpnI + BamHI and KpnI + XhoI

excise poly A sequence

ligation and miniprep

Maxiprep

Original LovTAP plasmid

Mini-preps done and correct plasmids confirmed.

✓ Transformation LovTAP + Amp

Done the 29th June. One plate in the fridge, dated 28-06-12.

✓ Maxiprep

Done the 12th July. Digestion and gel done the 16th July.

Make selection possible

✓ Design primers to integrate puromycin into the LovTAP plasmid - Sander

Not done yet. Still need to decide in which direction the integration should be done (integrate puromycin into the LovTAP plasmid or integrate LovTAP into pMP-PB).

• Puromycin → LovTAP plasmid
  • No control over directionality (only a single available RS)
  • Less worries about mutations (mutated versions of puromycin will just die during the selection process)
• LovTAP → pMP-PB
  • Integration easy and controlled (lots of easy to use RS)
  • (Too?) Efficient expression thanks to strong promoter & intron.
  • Interference of non-used gene sequences?

Insert puromycin:

Run the following primers on pMB-PB (4 random bases, PsiI, matching part):

Primer 1 (54.9 °C, 10 + 16bp): 5' - CTGC TTATAA GTCTGACGCTCAGTGG → 3'
Primer 2 (55.5 °C, 10 + 14bp): 5' - GCTT TTATAA CTTCATCCCCGTGG → 3'
Annealing temp: 54.9 °C 

Digestion: NEBuffer 4 & PsiI @ 37°C

Check if the puromycin was inserted in the correct direction (if there is product, the puromycin was inserted in the correct direction):

Primer 1 (55.3 °C, 31bp): 5' - CTAAATTGTAAGCGTTAATATTTT → 3'
Primer 2 (53.5 °C, 13bp): 5' - CCGACGTCGAGGT → 3'
Annealing temp: 53.5 °C 

✓ Design primers to integrate puromycin into the RO plasmid - Sander

See LovTAP plasmid design, uses same primers.

✓ Design primers to integrate LovTAP into pMP-PB - Sander

Primer 1: SpeI
Primer 2: NotI
Primer 1 (71.5°C, 10 + 18bp): 5' - CAGG ACTAGT ATGAGCTCCCCAAGCTTGGG → 3'
Primer 2 (68.8°C, 12 + 24bp): 5' - GTTT GCGGCCGC AGAGGTACCGGAATTCCTCAATCG → 3'
Annealing temperature:68.8°C

✓ Design primers to integrate RO into pMP-PB - Sander

Primer 1: AscI
Primer 2: XbaI
Primer 1 (62 °C, 12 + 14bp): 5' - ACCA GGCGCGCC CCGCATCTCGAGCG → 3'
Primer 2 (62 °C, 10 + 17bp): 5' - CTAT TCTAGA CAGGTTTCCCGACTGGA → 3'
Annealing temp: 62 °C

✓ Investigate use of different antibiotics in the plasmids

In general using the same antibiotics will result in a 50/50 split of intake of the plasmid. Alternatives are:

• Puromycin
• Zeocin
• Blasticidin
• Hygromycin B

Where Zeocin has a significantly different method of operation (Zeocin cuts up DNA while the other antibiotics interfere with the protein synthesis process).

Unless the results aren't satisfactory, we'll continue using only puromycin which has been shown to work.

Produce the modified plasmids

Using the previously designed primers:

• PCR → part we want to add surrounded by RS
• Digestion of the plasmid & PCR product
• Ligation
• Selection

Transfect

✓ Transient transfection - Alex, Mouna, June

Can be done as soon as the plasmid has been produced in high quantities (maxi-prep). Maxiprep of both RO and LovTAP done the 12th July. LB medium prepared the 16th July.

Stable transfection

Need to modify the plasmids for selection & perform max-prep.

Experiment

Western Blot

Check whether LovTAP is being expressed using a Western Blot. The last Western Blot didn't work at all.

Back to cloning

LovTap isn't being expressed. The western blot shows no expression, the backbone wasn't tailored for mammalian expression at all!

Prepare PMP backbone

✓Miniprep

✓Digest PMP to test backbone quality

HindIII and XBAI

✓Digest PMP to insert LovTap

SpeI and NotI

Ligate LovTap into PMP backbone

Miniprep of new version in PMP backbone

Maxiprep

Transfect mammalian cells

Basic tests

Test whether the LovTAP works (just test whether something is being expressed). Then check if there is a difference in expression level between the dark state and the light state. This difference should be a factor of about 5 (not sure, need to check again?).

Other tests

Try to optimize expression (amount of light, plasmid proportions, etc...).

Increase efficiency

The version of LovTAP we're using isn't the ultimate one, if we have enough time (and most of all, got the thing working in mammalian cells) we could try some form of site-directed mutagenesis to increase the efficiency.

Fussenegger

Melanopsin

✓ Get the main plasmid DNA sequence

Received the phy42 backbone from Fussenegger.

✓ Miniprep the phy42 w/melanopsin

On August the 1st we got 4 colonies on our plate from the transformed DNA-in-paper we got from Fussenegger. We minipreped the 4 of them.

✓ Digest plasmid to check quality

Done on August the 2nd.

✓ Sequence plasmid

Sequence received on August the 4th 2012. Only the forward work, reverse to be redone.

✓ Maxiprep

On August the 7th we transformed one of the minipreps. Correct maxiprep begin september

✓Design and order PCR primers for biobricking

run PCR w/ biobrick primers

Readout

Prepare PGL 4.30 backbone for readout

Miniprep

✓Digest plasmid to insert desired readout

MfeI and Hind III for SEAP

FseI and HindIII for TNFR and eGFP

✓ Prepare readout DNA for Insertion in backbone

✓ SEAP

✓ PCR w/ primers to add restriction sites

✓ Digest to insert into PGL 4.30

MfeI and Hind III

✓ TNFR

✓ PCR w/ primers to add restriction sites

✓ Digest to insert into PGL 4.30

FseI and HindIII

✓ Ligate with pGL4.30 backbone

Done on August 7th. Transformation done the same day.

✓ Miniprep TNFR pGL4.30 backbone

Done on August 9th

✓ eGFP

✓ PCR w/ primers to add restriction sites

✓ Digest to insert into PGL 4.30

FseI and HindIII

✓ Ligation

Colonies were found for all three readouts after overnight culture of transformed bacteria.

✓ Miniprep

✓ Maxiprep

Transfect Mamallian Cells

Being done. Sampling schedule:

• 06.09.12
  • 16:00 Transfection
  • 19:00 Put tube spin cells in well plate (3h after transfection). Take T = 0h sample of first well plate transfer
  • 22:00 Take T = 3h sample of first well plate transfer
• 07.09.12
  • 09:00 Take T = 14h sample of first well plate transfer
  • 16:00 Put tube spin cells in well plate (24h after transfection).
  • 19:00 Take T = 24h sample of first well plate transfer. Take T = 3h sample of second well plate transfer
• 08.09.12
  • 09:00 Take T = 38h sample of first well plate transfer. Take T = 17h sample of second well plate transfer
  • 19:00 Take T = 48h sample of first well plate transfer. Take T = 27h sample of second well plate transfer

Bioreactor

We talked to Dominique, who proposed a rather easy solution. Take an incubator and cover the window, add LEDs to a tubespin holder for light-state experiments and use a dark box (fixed to the shaker) for the dark-state experiments.

Requisition and modifiy an incubator

Get exclusive access to an incubator and modify it to not let any light pass in (stick something on the front window...).

Create LED strips

We need ~8 candella per tube (~8 lumen) of blue light. The LovTAP experiment used light at 468nm. The LEDs need to be ordered and the light chain+circuitry+power supply needs to be created.

Buy 20 of the following (2 packets): Blue LEDs

Calculate the right resistances (and buy them). If LEDs connected in parallel groups where each group is composed of 2 LEDs in parallel for a resistance (see drawing if not clear) → 65 ohm ("rounded" up to 68 ohm to be able to buy them) (http://www.ledstar.ch/Widerstand-025Watt-68-Ohm_1)

Create the circuit (use a few AA batteries?). 6V (can be supplied by either four AA batteries or by a relatively standard charger.

Thought 2: Use 12V as there are more power sources for it?

The batteries will only last 6-9h under full load, so rechargeable batteries or external chargers need to be considered.

It can also be done more efficiently with 3 AA batteries → 4.5V (not all switches are necessary):

Buy LED sticks? - Diego

Dasgip makes them. See July the 13th. They ended up telling the price: some 4000 Fr. just for the 4 sticks. We need to look for a homemade solution.

Microcontroller

Arduino, nice and cheap!

Create a "dark box"

Modify the plexiglass box in the corner of the cell lab so it blocks all light (add paper/aluminium foil or paint). This is not needed for the first experiments where a bit of tape should suffice.

Build lighting model

3D print bioreactor?

Small scale metallic

Biobricking

Nothing done yet! Use the primer design helper (in the dropbox primers folder) to quickly design the primers.

Make a list of all biobrickable stuff!

• TNFR:Fc
• LovTAP mammalian
• Melanopsin

Wiki

Made a basic templating system that can be extended later (shouldn't change the code of the pages themselves).

Start the designing! - Sander

Decided on the (slightly kitschy) lab-bench design. Comparable to the style of the 2010 EPFL iGEM team, but with more doodling and randomly placed objects in the background!

Using this page for testing.

Fill it!

The templates should be complete enough to be able to work with the wiki now without needing to reenter all data later. In progress!

Others

✓ Competent cell preparation

Requisite for E. coli transformation. Done the 25th of May. The cells are in the -80ºC freezer.

Safety

All members followed safety course given by university. Need to meet with the Stéphane Karlen to get a more detailed (more relevant) safety opinion. Email sent asking for an appointment (12-7 Diego).