Introduction

LovTAP-VP16 is the name of the protein our light switch is based on. But it has never been expresed before and, therefore, there is no literature telling us under what conditions it works or whether it works at all. It's a fusion protein between LovTAP, which is itself a fusion protein, and a part of VP16, a viral transcription activator.

In this case we don't want any kind of steric interaction between LovTAP and VP16, since that might alter the functionality of one or both parts and we just want VP16 to be transported by LovTAP. To ensure this, a linker might be needed to physically separate the domains. Since LovTAP-VP16 has to be in the nucleus of the cell to work, the minimal linker would be a 7 residues long Nuclear Localazation Signal (NLS) from the virus SV40, with the amino aced sequece PKKKRKV.

In order to visually verify if a longer linker would be needed, we put together the existing crystal structures of the domains LovTAP-VP16 consists of: LOV2, TrpR, NLS and VP16.

How LovTAP is thought to work

Allosteric regulation

In a protein, generally an enzyme, an allosteric site is any part of the protein other than the active site.

Allosteric regulation of a protein consists in modifying its properties by interacting with an allosteric site. One example would be the regulation in the tryptophan (trp) operon, a group of genes studied in E. coli that are required for the synthesis of the amino acid tryptophan. The expression of these genes can be blocked by the homodimeric protein tryptophan repressor (TrpR), by binding the operator of the operon. TrpR repressing function is only active when tryptophan is bound to its allosteric sites, i.e. it blocks the production of tryptophan when the concentration of tryptophan is high.

LovTAP

In a paper published in 2008 [http://www.pnas.org/content/105/31/10709.abstract], Strickland et al. propose to modify the protein TrpR such that its activity can be controlled by light. This is done by fusing it to a light sensitive protein, the plant phototropin LOV2 (Light-Oxygen-Voltage), whose sensitivity to blue light is conferred by the ligand chromophore flavin mononucleotide (FMN). The fusion is done in a way that both domains share a common α-helix, which would create a sort of lever that could transfer the conformational changes in LOV2 when light-activated towards TrpR, triggering its activation.

TrpR

Dimerizes and bind the TrpO sequence: CGTACTAGTTAACTAGTACG

LOV2

Saturates at 20 mW/cm^-2 irradiance at 470 nm according to Strickland 2008.

LOV2 photoproduct from phot1 has a half life of 30-40 s in Arabidopsis and rize. LovTAP has LOV2 from phot1 in Avena sativa. [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC161699/table/TII/]

VP16

[http://pubs.acs.org/doi/full/10.1021/bi0482912|Paper] stating that the part of VP16 we used (456-490) behaves as transcriptional activator.

Building LovTAP-VP16

Fig. 1: A reconstruction of how LovTAP-VP16 might look like in the active state, binding a Trp operator. Red: TrpR domain, blue: LOV2 domain, yellow: Nuclear localization signal, green: VP16 domain

According to the plasmid designed by Nicolas Gobet, LovTAP-VP16 consists of the following domains (from N to C terminal):

• Residues 456 to 490 of the Herpes virus VP16 protein. It corresponds to one of it's activation domains.
• Nuclear Localization Sequence (NLS): PKKKRKV
• Residues 401 to 543 of phot1 LOV2 from Avena sativa.
• Residues 22 to 106 of Trp Repressor from E. coli.

In order to build the molecule, we used [http://pymol.org/ PyMOL]. All the structure parts LovTAP-VP16 is made of, except the NLS were taken from the [http://www.rcsb.org/pdb/home/home.do RCSB Protein Data Bank].The TrpR dimer and the DNA in the binding position were taken from the file 1TRR, the LOV2 domain from 2V0U and VP16 from 2K2U.

To fuse the TrpR and LOV2 domains, we followed the instructions given by Strickland et al (2008). Since the fusion happens at residue 543 of LOV2 and residue 22 of TrpR, we applied PyMOL's command "align" to residues 542, 543 and 544 of LOV2 and 21, 22 and 23 of TrpR. The resulting pdb files were then truncated and fused into a single file with a text editor. Back in PyMOL, the NLS sequence was appended to the LOV2 domain. To finish, the VP16 domain was positioned by aligning its terminal C with the terminal N of LovTAP-NLS, at the NLS and then fused by applying the "fuse" command to the same 2 atoms. In order to illustrate the photoinduced conformation of LovTAP-VP16 we rotated the LOV2 domain, leaving the α-helix in its place, from residue 522, until the clashes with the TrpR on the other monomer disappeared. The resulting activated dimer, bound to DNA, can be seen in fig. 1.

Light and dark conformations

In fig. 1, we have seen how a LovTAP-VP16 dimer in the light-induced state can be compatible with a high DNA affinity conformation.

What happens in the dark? As Strickland et al proposed, we can see, in fig. 2, how maintaining the high DNA affinity conformation while the LOV2 domains are bound to their respective J&alpha-helices would imply very important steric clashes. Therefore the conformation will change to another with a lower DNA affinity.

What if only one of the monomers of the dimer are activated? Rotating and mo

Fig. 2: In the dark conformation, with the LOV2 domain bound to its J&alpha-helix, there would be important steric clashes between the LOV2 domain in one monomer (dark blue) and the TrpR in the other monomer (light red).

Conclusions

We can see that the α-helical subdomain (residues 465 to 490 according to Hendrik et al) of VP16 that is supposed to bind TFIIB, one of the coffactors that VP16 is thought to bind to trigger the activation cascade, seems to be free of any sort of sterical constraints. This allowed us to decide that an additional linker between the LOV2 domain and the VP16 domain is not required.