Team:Austin Texas/Spinach reporter

From 2012.igem.org

Revision as of 20:27, 2 October 2012 by Benslater (Talk | contribs)

Contents

"Project 3: Spinach+mCherry Dual florescence Reporter"

Background

In an effort to improve both efficiency and quality of promoter strength measurements, we focused on developing a dual fluorescence reporter for simultaneous monitoring both transcription and translation. To measure both processes separately, two fluorescent reporters, the Spinach aptamer and mCherry red fluorescent protein, were assembled into a single construct. The Spinach-mCherry dual reporter is a unique concept; Spinach is a short RNA aptamer that binds to its ligand, DFHBI, and allows it to emit green fluorescence similar to GFP. This gives insight into the direct production of the mCherry-encoding mRNA without the need to wait for protein folding and maturation of the fluorophore. This technique attempted to expand upon current efforts to measure promoter strength relative to a reference standard used by the iGEM community.

Design

The reporter was designed in two ways: with the mCherry gene 5' of the spinach aptamer, and the mCherry gene 3' of the spinach aptamer. The construct was assembled in a pET plasmid, with the spinach aptamer containing a small, stabilzing tRNA scaffold on both sides of the gene. (original Spinach pET plasmid was obtained from Xi Chen of the Ellington Lab, University of Texas at Austin) The plasmid containing mCherry was obtained from Addgene (find citation) Through the use of gibson assembly, the DNA coding for the mCherry fluorescent protein was inserted in the spinach pET plasmid, both 5' and 3' of this gene. Include image of constructs Little troubleshooting was needed as the gibson worked quite well. However, many errors were encountered when using various fluorescent plate readers, very often wasting whole trials due to machine error. (more detail?) T7 Promoter used: TAATACGACTCACTATAGGGT, resembles closely Bba_J64997 (Should I reference this or make my own part page for this promoter?)

Results

Protocol

The protocol for using the dual fluorescent reporter was performed as follows: -Grow culture of construct (both 5' and 3') overnight -Dilute on the following day and allow for growth until mid-log phase -Induce BL21 cells (used for DE3 or AI) with either 1mM IPTG, and 1mM IPTG and 0.2% arabinose, respectively. -Add 200uL aliquots of construct and control cells in a 96-well plate -DFHBI, the fluorphore for spinach fluorescence was added either into the well plate or the culture of cells -Dilution series of DFHBI were performed, revealing 100-200uM DFHBI being the ideal concentration in culture for max RFU values and minimal cell death -Analyze graphs of Spinach Fluorescence vs Time


Data

Graphs of Spinach fluorescence vs time (calculated by (RFUt/OD600t - RFUc/OD600t) vs time) -Show the 5', 3' construct graphs

Issues with results

After considerable time with the Spinach+mCherry dual fluorescence reporter it became that mCherry was not developing in the plate reader experiments, but this was not immediately obvious. Originally, the plate reader being used for this project was showing no fluorescence change in either the wavelengths of spinach or mcherry (ex and em), so the assumption was made that the construct was not performing as intended. It wasn't until trying multiple other flurescence plate readers that we stumbled upon a Tecan F200 in the Zhang lab (UT Austin) that was performing as intended. Once the plate reader issue had been realized, it was not obvious that the mCherry fluorescence protein was not able to develop fully during the plate reader experiments. This can likely be contributed to the the nearly-anaerobic conditions that existed in the machine during fluorescence trials, as well other issues, including the demanding qualities of the construct itself. (Should I mention that we got mCherry fluorescence under blue light but not in a plate reader?)

Given the difficulty with quantifying the translational strength/RBS aspect of the construct, it was decided that focus would be put on characterizing the Spinach aptamer + stabilizing tRNA scaffold by itself.

Spa+tRNA Graphs with varying levels of DFHBI.

Note: the graphs I have to add include the 5' and 3' constructs as well SpA by itself. I'll include these, any other images besides the constructs themselves need to be added? Perhaps something relating to protocol?