Omega-3 fatty acid synthesis
ω-3 Fatty acids are an essential component of our diet and are paramount to maintaining human health. Our team is recreating this synthetic pathway in E. coli, using genes from the cyanobacteria Synechocystis and the trypanosomatid Leishmania major. Combining the DNA code for elongase and desaturase enzymes, we can convert the plain fatty acid of E. coli into highly valuable ω-3 fatty acids.
-
Figure 1: "Synechocystis sp."
-
Figure 2: "Trypanosome cruzi"
-
Figure 3: "Leishmania major"
Omega-3 fatty acids are an essential part of the human diet (Bender, Bender, 1999). Human beings, as all larger organisms, cannot synthesize ω-3 fatty acids, This is due to a lack of the enzyme Δ15 desaturase, which creates a double bond at the 15th carbon of a long-chain fatty acid. Certain microrganisms, such as microalgae and cyanobacteria, do contain this desaturase and can thus directly synthesize ω-3 fatty acids (Arts et al, 2009). ω-3 fatty acids then enter the food chain – algae are eaten by fish, and seafood is subsequently the main source of ω-3 for humans(Tonon et al, 2002).
However, the current economic policies of overfishing are a serious contributor to marine biodestruction. As the human population is estimated to rise to 9.1 billion by 2050 (Cohen, 2003), pressure on fish stock will increase. Additionally, global warming will reduce the availability of ω-3 (Arts et al, 2009): at higher temperatures, microalgae produce less ω-3 desaturated fatty acids. Desaturated carbon chains cause a lower melting temperature in the membrane, which the microorganism wants to avoid by synthesizing more saturated fatty acids in their membranes (Garwin, Cronan, 1980). Thus, the combination of declining fish stock and a decrease in overall ω-3 fatty acids is making the supply for human nutrition a relevant issue.
Harvesting algae directly is costly and ineffective (Borowitzka, 1997). There is much potential in expressing a metabolic pathway for ω-3 fatty acid synthesis in E. coli, which is cheaper and more accessible.
Figure 4: "The metabolic pathway to ω-3 fatty acids"
Figure 4 shows the elongation and desaturation enzymes necessary to convert an 18:1 fatty acid, which E. coli synthesizes, into an poly-unsaturated fatty acid.
modified from Livore et al, 2006
E. coli naturally synthesize poly-unsaturated fatty acids up to a carbon chain length of 18, with a single desaturation (18:1) (Marr, Ingraham, 1969). Valuable ω-3 fatty acids require a double bonds at the third carbon from the end of its carbon chain and can have >20 carbons.
In order to have E. coli synthesize ω-3 fatty acids, we needed to introduce enzymes that could elongate and desaturate fatty acid substrates (cf. Fig. 4).
The genes for Δ12, Δ15 (ω6) and Δ6 were obtained from Synechocystis sp., a cyanobacterium. The trypanosomatid Leishmania major provided the DNA for the ELO 6 gene. Additionally, we used Trypanosome cruzi as a secondary source of Δ12.
However, our first successful ligations of Δ12 did not yield us with the expected 18:2 fatty acid. We hypothesized that E. coli’s inherent 18-carbon chain fatty acid might not be suited as a substrate for Δ12 – the double bond is in a different position, the 11th. Therefore, we "fed" our cells with suitable 18:1, to then observe 18:2 fatty acid, and ultimately ω-3 desaturation, in the mass spec results!
The following genes were employed (please click for sequences and KEGG numbers):
These genes were amplified through PCR (Promega, GoTaq HotStart) at temperatures 48°C and 56°C.
We were able to ligate these genes to two distinct pET-Duet vectors (vectors with two multicloning sites), one of them containing Δ12 and Δ15 desaturases, and the other Duet vector ligated only to Δ6 desaturase.
The recombinant plasmids were transformed into E. coli strains BL21(DE3), tested for protein expression and lipid profiles were obtained from transformed E. coli.
Fig. 5: "UV photograph of PCR results"
The figure shows the results of a PCR extraction of our genes of choice, done with GoTaq HotStart PCR kit at 2 different annealing temperatures: Δ12 (48°C) - Δ12 (56°C) - Δ15 (48°C) - Δ15 (56°C) - Δ6 (48°C) - Δ6 (56°C).
All primers are notated 5' to 3'. Initially, we worked with NdeI and XhoI as the restriction sites.
When using the pET-duet vector, we needed additionally primers for the alternative restriction sites and His-tags. For Δ6 and Δ12, we cut with HindIII and EcoRI; NdeI and XhoI were used for Δ15 and ELO6.
After a number of expression attempts, some initial conclusions were reached. All experiments done on ELO6 failed. Also, Δ12 from T. cruzi gave overall weaker results than the same gene from Synechocystis. As such, latter work was only carried out on genes from Synechocystis.
Δ6, Δ12, and Δ15 was successfully expressed in pET-15b and transformed into cell strains BL21(DE3) and BL21(DE3)PlysS. However, functionality could not be established. It was hypothesized that the naturally-occuring 18:1 fatty acid in E. coli is the wrong substrate for the desaturases. This fatty acid has its desaturation at the 11th carbon. Thus, the E. coli were manually fed 18:1 (Δ9).
Additionally, a pET-duet vector expressing Δ12 and Δ15 was used to start assembling the metabolic pathway. Due to time constraints, no duet vector BioBrickTM was submitted.
Analysis
Lipid Analysis
Lipids were extracted from transformed E. coli using the Blight/Dyer method. (Please refer to the Lipid extraction lab book entry for further detail.)
Mass Spectrometry
Lipids were extracted from transformed E. coli using the Blight/Dyer method. (Please refer to the Lipid extraction lab book entry for further detail.)
We then analyzed the the fatty acid content of the transformed cells to determine whether it differed from the previously analyzed background lipid composition. This was done using mass spectrometry.
Bradford protein assay
A Bradford protein assay was carried out to asses protein concentration (Bradford, 1976).
Sequencing
We sent off samples to GATC for sequencing.
By combining a number of genes, we were able to recreate the pathway described above (Fig. 4).
Bradford protein assay
Chart 1: "Bradford protein assay"
This chart shows the results of a Bradford protein assay. It was carried out on the following ligated plasmids transformed into BL21: Δ12 in pET-15b (in 2 colonies), Δ12 in pLYS, Δ12 in pET-duet (in 2 colonies), Δ6 in pET-duet, Δ12/Δ15 in pET-duet (in 2 colonies).
The Bradford protein assay discuss results
Mass Spectrometry
Sequencing results
- 16/7/12 Δ15
Δ15 and Δ6 desaturases from Synechocystis in pET-15b were sent off for sequencing. Once again, the results were discouraging even though protein and lipid analysis showed the opposite. BLAST showed that the gene found in both samples corresponded to a T. brucei HMG-CoA reductase which we thought we had cut out from the plasmid. We thus performed a PCR, using the vectors sent off for sequencing as a template.
Sequence
atATACCAtggGcAgCAGccaTcnnCATcaTCAtnncAGCagCGGCCTggtgCCGCGCGGCAGCCATATGCTTCgtagga
cTCTCTCatgtgCTtgtGGGACAGGCAAAACGGGttgGGGCGCAAtgaGCAATGCCgagCTTGTTaAAGCcgtAAGCAgt
cGTCAAttAACCTTTTATGGGTTAGAGCacgCTCTGgagCCCGACTACCAGCGCGCTATCGcTgtGCGTCGtgAGGTGgt
gtCCGACTAtgtgGCATCCTCCCAAAgTGCggaGGTGAAGAGGAAAAGCTTGGAGCGTATACCATTTGAAAACTACGAAT
GGGATCGAGTGGTTGGTCAGAACTGTGAAAATATTGTGGGTTACGTTCCTATTCCTCTTGGTATGGCTGGGCCAATAATA
ATGGATGGCTGTGAATACCCCATTCCCATGGCCACGACAGAAGGTGCCCTggtTGCCAGCACACATCGAGGCGCACGAGC
TATATCCCAAAGTGGGGGCTGTAAGACACTGATCTTGGGCGAGGGCATGTCACGTGCTCCAGTAGTGGAGGTTGAGTCTT
TGGAAGAGGCGGGAAggcttCATAATTTTTGTGTagaAAAtttcaCTGAAATCAAAGCAGCTTTCGAGagaCGACGCGAT
TTGGGAattGCAGTCGCTCAAGTGCGTCATCATCGGTCnnnannCCTATATTCggTTCCGCGCGAccaCCGGagatGCga
tg
- 16/7/12 Δ6
Sequence
AnTTCCCCcTctaGaaTaTTTTTGTTtACTTtAAGaAGGAGATATACCATGGGCAGCAGCCATcncTcAtcaTCATCACA
GCAGCGGCCTGGTGCCGCGCGGCAGCCATATGCTTCGTAGGACTCTCTCATgtGCTTGTGGGACAGGCAAAACGGGTTGG
GGCGCAATGAGCAATGCCGaGCTtgTTAAAGCCGTAAGCAGTCGTCAATTAACCTTTTATGGGTTAGAGCAGGCTCTGGA
GCCCGACTACCAGCGCGCTATCGCTGTGCGTCGTGAGGTGGTGTCCGACTATGTGGCATCCTCCCAAAGTGCGGAGGTGA
AGAGGAAAAGCTTGGAGCGTATACCATTTGAAAACTACGAATGGGATCGAGTGGTTGGTCAGAACTGTGAAAATATTGTG
GGTTACGTTCCTATTCCTCTTGGTATGGCTGGGCCAATAATAATGGATGGCTGTGAATACCCCATTCCCATGGCCACGAC
AGAAGGTGCCCTGGTTGCCAGCACACATCGAGGCGCACGAGCTATATCCCAAAGTGGGGGCTGTAAGACACTGATCTTGG
GCGAGGGCATGTCACGTGCTCCAGTAGTGGAGGTTGAGTCTTTGGAAGAGGCGGGAAGGCTTCATAATTTTTGTGTAGAA
AATTTCACTGAAATCAAAGCAGCTTTCGAGAGCACGACGCGATTTGGGAAGTTGCAGTCGCTCAAGTGCGTCATCATCGG
TCGCAnAGCCTATATTCGGTTCCGCGCGACCACCGGAGATGCGATGGGGATGAACATGATAACCAAAGGTGTCGACAAGG
CATTGGAGTTAAtanAGCAnAACTTTCCGTCGATGAAGGTTATTGCGTTGTCGGGGAACTACTGCACTGanaagAAACcC
TCCGCAGTGAACTGGATTGaggggaaGAGGAAnAAaCTGTcnnttgCCgaagGCGCTcgtaaaggggCgaAGt
- 29/6/12 ELO6
After showing successful insertion of L. major Δ6 elongase in pET-15b, the sample was sent off for sequencing. Unfortunately, the gene sequenced was not the Δ6 elongase we were hoping to find, but a T. brucei mevalonate kinase, which was previously inserted in the pET-15b vectors we had been using. Thus, we digested some fresh pET-15b to be used in the future.
Sequence
GnanTTTGTTtAcTttaagaaggagaTATACCATGGGcAGCAGCCATcatCATcatcaTCACAGCAGCGGCCTggtGCCG
CGCGGCagCCATATGGTCGTGGCATCGtgTCCGGGAAAAGTGCTGATTCTTGGTGGTTAcCTAATAGttGAGGAGCCAAA
TGTTGGTATTTCCGTAGGAACAACCGCGCGCTTCGTGACACGTGTGGCGTCgtgGAAAAAATGCTCTGATGGAAAGTGTC
GAGTGCACATCGTCTCGTCACAGTTCAACAAggaGTTTACGTTTGAATGCGCGGCTGAAGAGGACAGTGATTCCACTATC
AAGATTGTGCAATTAGAGGGTGCACCATCGCCGTTTCTCTTCTACGGTATTTTGTACTCGGTTGCCGGCGCTCTATTATT
TGGTGGTGATATTTTTCGTGATGTTACCCTAGAGTTGTTGGCGGATAACGATTTCTACAGCCAAAGGAATTATTTGGAGT
CCCAAGGCAAGCCGGTGACCGCAGCCAACCTGCGGCTCATCCCCCGTTATACGCCCCTCTTGGGGGAGGTTTCCAAAACT
GGTCTAGGATCTTCAGCGGCAATGACCACTAGTGTCGTAGCGTGCCTGCTCCAACTTTTTGTTTTTGATTCGAAGAAAAA
CAATGCCACTGAGTCCGTGGAGAGGGCACCGGAGCTACCTCTACGTTTGGAGGATGTAACAGAGTTCATTCATCGTATTA
GTCAGGTTGCCCACTGCGTAGCACAGGGAAAAGTGgGGAGCGGGTTTGATGTCTACACGGCCACGTTCGGGACGTGTGTG
TACCGACGGTTCTCCGCACGCGTGCTGGAnAAGCTCGTAAAGGgtAATGAACCTCCGAAGCGCGTCGCTATTCCTCTTTT
ACGTGAGTGTGTCGAGACGGATGAAGTGTGgGTTCAGAGGATACcCTtccGGCTTCCTACCGGGTTGCAGCTTCTTTTAG
GGGATGTACACAAGGGAGgAacaGAAAcACCTGGCATGGTGTcgaAGGTCATGTCatgnnagnggTCGGTGACCacGGAC
CCcAACAGnttgnggnnnngantTcCCATgnntAAT
- 23/7/12 Δ12
15b forward gave 0 nucleotides
15b reverse gave 0 nucleotides
20b forward gave a 41 nucleotide result.
A BLAST search showed this to be compatible with Crocosphaera watsonii (genome shotgun sequence, 21%), a diazotrophic cyanobacteria.
20b reverse gave 0 nucleotides
ARTS, et al, 2009. Lipids in Aquatic Ecosystems. New York. Springer.
BENDER D. A. and BENDER, A. E, 1999. Benders' dictionary of nutrition and food technology. Cambridge: CRC Press.
BRADFORD, M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 7;72:248-54.
COHEN, J., 2003. Human Population: The Next Half Century. Science, New Series, Vol. 302, No. 5648. Pp. 1172-1175.
GARWIN J. L. and CRONAN J. E. Jr, 1980. Thermal modulation of fatty acid synthesis in Escherichia coli does not involve de novo enzyme synthesis. J Bacteriol, 141(3): 1457–1459.
LIVORE V., TRIPODI K., UTARRO A., 2007. Elongation of polyunsaturated fatty acids in trypanosomatids. FEBS Journal, 274: 264–274.
MARR A., INGRAHAM J., 1969. Effect of temperature on the composition of fatty acids in Escherichia coli. J. Bactiol. 84(6). Pp. 1260–1267.
TONON T., et al, 2002. Long chain polyunsaturated fatty acid production and partitioning to triacylglycerols in four microalgae. Phytochemistry, Vol 61 Iss 1. Pgs 15-24.