"
Team:Ehime-Japan/Project
From 2012.igem.org
| Home | Team | Official Team Profile | Project | Parts Submitted to the Registry | Modeling | Notebook | Safety | Attributions |
|---|
Contents |
Overall project
Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)
Project Details
Project
Let's make toppling dominoes with E.coli
This project is based on an idea that, if E.coli transformants that emit green light when they catch green light are placed along a line on an agar plate, and if the end is activated with UV or blue light so that it emit green light, it would look like domino toppling with the green light moving along the line toward the other end. We planned to construct this light transfer system by using the red and green light sensor systems, the light receptor PCB catches light and activate transcription of a specific promoter upstream the lacZ reporter gene. So, we replaced the lacZ gene with the sequences coding for GFP and RFP.
pJT118 harbors the lacZ reporter gene in addition to the green sensor components. So, we replaced the lacZ sequence with the DNA coding for GFP.pJT106b contains the sequence for the lacZ reporter for the red light sensor. So, we replaced it with the gene for RFP. We also construct a pJT118 derivative containing the RFP gene.
With these plasmids, we believe that we could draw movie pictures on an ager plate canvas. Our first one would be that of a firework in which a ball of green light would go straight upward and burst, scattering lines of red light. The data for the plasmid construction experiments are shown below.
Plasmid construction 1,We amplified a sequence in pJT118 spanning almost all of the plasmid except the region of the lacZ ORF, by PCR with KOD Fx Neo. (using the primers GCGGCCGCTCGAGTCTAATTTTTTTGandATCTATCATAGATAAAGTTAGTAATTAAAC ). The 5780bp fragment was obtained and gel-purified.
2,We amplified the sequence of the GFP ORF from BioBrick using the primers CTTTATCTATGATAGATATGCGTAAAGGAGAAGAACTT and GACCTGAGCGGCCGCTTTGTATAGTTCATCCATGCCAT.The 750bp fragment was gel-purified.
3,We put the fragment from 1and2 together by the InFusion svstem(Clontech). The miniprep plasmid sample from acolony was checked by agarose gel electrophoresis(Figure1,the middlelabeled as118+GFP). The other plasmids were constructed in almost the same way, and checked on agarose gels (Figures 1and 2).
Primer List
106b
TTCGGAGGAAGCCATCTCTAGTATTTCTCCTCTTTCTCCA
ACCGGTGCTTAATAAGCGGCCGCTCGAGTCTAATACTAGAGCC
RFP
CTTTATCTATGATAGATATGGCTTCCTCCGAAGACGTTATCA
GACCTGAGCGGCCGCTTATTAAGCACCGGTGGAGTGACTGACGA
GFP
CTTTATCTATGATAGATATGCGTAAAGGAGAAGAACTT
GACCTGAGCGGCCGCTTTGTATAGTTCATCCATGCCAT
pJT118
GCGGCCGCTCGAGTCTAATTTTTTTG
ATCTATCATAGATAAAGTTAGTAATTAAA
