Team:SUSTC-Shenzhen-B/comment

Comments

BGI reasercher

I am a scientist in BGI, the unit of synthetic biology. This is my first time using your TTEC website.

I input the sequence as follows:

AGAGAATATAAAAAGCCAGATTATTAATCCGGCTTTTTTATTATTT

Then , the programme gave me the predicted efficiency and the structure of the terminator. Comparing the predicted efficiency value with the measured one, they are almost the same.

Precise and reliable as the software is, I really enjoy this searching experience. Obviously, I hope more researchers can use this software to simplify their work and this software will be stronger!