Team:SUSTC-Shenzhen-B/comment
From 2012.igem.org
Comments
BGI reasercher
I am a scientist in BGI, the unit of synthetic biology. This is my first time using your TTEC website.
I input the sequence as follows:
AGAGAATATAAAAAGCCAGATTATTAATCCGGCTTTTTTATTATTT
Then , the programme gave me the predicted efficiency and the structure of the terminator. Comparing the predicted efficiency value with the measured one, they are almost the same.
Precise and reliable as the software is, I really enjoy this searching experience. Obviously, I hope more researchers can use this software to simplify their work and this software will be stronger!
Yi Deng
Dr. Deng Yi was graduated from Department of Biology at Shandong University with a bachelar’s s degree in 1996 and a master’s degree in 1999. In 2002, she graduated magna cum laude with a Ph. D. degree from Ruhr-University Bochum, Germany. From 2003 to 2008, she did the postdoctoral training at Naitonal Institutes of Health (USA). After moving to Hong kong with her family she worked in the Hong Kong University of Science and Technology and the Chinese University of Hong Kong, and in 2012 she joined South University of Science and Technology of China as an Associate Professor. Dr. Deng has a broad interest in the field of cell biology and her work has addressed fundamental questions about membrane trafficking and intracelluar proterin transport as well as cell cycle regulation and ageing. Currently her research interestes are mainly focused on two aspects: 1. the regualtion of proterin machinaries that control cell adhesion and mirgation; 2. the molecular mechanisms of human islet amyloid polypeptide-induced pancreatic beta cell damage.
Rui Zhao
Mr. Rui Zhao got his bachelor degree and master degree in Tsinghua University, majored in applied mathematics. His research interests mainly focus on computational and bioinformatics. He joined in the South University of Science and Technology of China last year then participated this IGEM program.
Yinlan Zhao
I was graduated from Wuhan Institute of technology, majored in bioengineering in 2005. In 2012, I got my Ph.D degree from Medical School of Wuhan University. I was interested in innate immunity and molecular biology of virus.