"
Non-antibiotic selectable and counter-selectable markers
Nitroreductase
Background
Nitroreductase is an Enterobacter cloacae enzyme which reduces nitrogen containing compounds (Nicklin & Bruce, 1998). Other nitroreductases were implemented in converting nitro drugs such as metronidazole into their active form which is essential part of their toxicity (Nillius, Muller, & Muller, 2011). Bearing this in mind, we decided to look into nitroreductases’s potential as counter selectable marker.
Cloning
pSBIC3-nitroreductase
The nitroreductase gene was cloned using these primers and inserted into the standard biobrick vector pSBIC3. This construct was confirmed trough sequencing. Method.
Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT
Close the primers.
Sequencing results:
aacttataaatattcttaggcttatctctagggaggatttctggaattcgcggccgcttctagagcaccaggagttgttctggatatgatttctgtcgccctgaaacggcactccaccaaggcgttcgaccc
cgctaaaaaactgaccgcatacgatccggaaaagatcaaacccctgctgcaataccgtccgtccaacaccctgtcccagccgtggcactttattgtccttgcaccgaggaaggtaaaccttgcgtggtttcc
tctgccgaaagcacttacgtcttctacgatcgcaaaacgctggacgcttctctcgtggtggtgttctgcgcgaaaaccgcttcggatgatgccttcatggaacgcttggtggatcatgaagaacccgatggc
cggt
Close the sequencing results.
Method: The nitroreductase PCR product was purified and digested with EcoRI HQ and SpeI together with pSBIC3. These were ligated, E.coli cells transformed with the ligation and the white colonies (RFP disruption) were miniprepped. Detailed method procedures in methods section.
Figure 1: DNA gel of PCR product of BS-nitred with primers specific for nitroreductase. The product is around 0.6-0.7 kb which corresponds to the size of nitroreductase gene, around 0.6 kb.
Figure 2: DNA gel of pSBIC3-nitroreductase ligation. The band is around 2.5-2.6 kb which corresponds to the vector pSBIC3 (around 2 kb) together with the nitroreductase (0.6 kb). Sample 2 was confirmed with sequencing.
Close the method.
Plac-lacZ-nitroreductase
It was further proceeded to add a promoter and a reporter gene in front of the nitroreductase gene (plac-lacZ). Method.
Method: The sequence confirmed PSBIC3- nitroreductase was digested with EcoRI HQ and XbaI while Edinbrick1 was digested with EcoRI HQ and SpeI. These were ligated together. The ligations were transformed into cells and the transformants plated on LB+chloramphenicol+IPTG+Xgal plate. The blue colonies (contain lacZ) were further used. Colony PCR screen of pooled blue plac-lacZ-nitroreductase transformants with lacZ forward primer and reverse nitroreductase primer showed a band corresponding to lacZ-nitroreductase.
Figure 3: DNA gel with Colony PCR products of pooled blue plac-lacZ-nitroreductase transformants with lacZ forward primer and reverse nitroreductase primer resulted in in bands around 1.2-1.3 kb which corresponds to nitroreductase (0.6 kb) plus lacZ (0.6 kb).
To confirm the presence of plac-lacZ-nitroreductase in pSBIC3, the samples in the smallest pool were minipreped, digested with EcoRI and SpeI to check the size of the insert.
Figure 4: DNA gel with plac-lacZ-nitroreductase which was digested with EcoRI HQ and SpeI.. The biggest band is likely to correspond to psBIC3 around 2.2-2.3 kb, the middle band is likely to correspond to plac-lacZ-nitroreductase around 1.5 kb and the smallest fragment is unknown.
Figure 5: DNA gel with plac-lacZ-nitroreductase which was digested with EcoRI HQ to linearise the DNA. There are two distinctive bands, one around 3.0 kb and one around 3.6 kb likely to correspond to psBIC3 with plac-lacZ-nitroreductase and plac-lacZ.
Close the method.
PstI restriction site (expand)
The original sequence used for primer design has PstI restriction site. However the sequencing results suggests that there is no such site. The sequence confirmed psBIC3-nitroreductase was digested with PstI and run alongside an undigested sample.
Figure 6: DNA gel with psBIc3-nitroreductase undigested and digested with PstI. Only one band at around 3 kb is visible corresponding to the linearized plasmid confirming that there is no PstI restriction site.
Close the method.
Characterisation
Specific activity
Before cloning the nitroreductase gene in the biobrick vector, 3 nitroreductase genes into different vectors with different promoters and control which were available in the lab were used to test nitroreductase specific activity. Method is detailed in the methods section.
The change of NADH concentration was estimated by the change of OD340 absorbance per minute, background is subtracted and specific activity calculated. The results are presented in the diagram below.
Figure 7: Comparison of the specific activity of 3 nitroreductase genes into different vectors with different promoters and control.
BS-nitred was used further for characterization experiments as it showed highest specific activity.
Plates
To determine the relative toxicity of different compounds, 5 ul of DMSO, MTZ and DNBA were added on three distinct spots in a freshly spread plates.
DMSO was determined to be non-toxic, DNBA showed small difference between the different strains while MTZ distinctively more toxic to BS-nitred and BS-contol.
Numerous plates experiments with MTZ concentration ranging from 0 ug/ml to 300 ug/ml and various concentrations of DNBA and NFT were made to determine concentrations at which BS-control was growing which BS-nitred’s growth is inhibited. Similar growth patterns were observed in DNBA and NFT plates. All metronidazole experiments showed inhibited growth of BS-nitred in comparison to BS-control however the inhibition was never 100 % which is required for nitroreductase to be used as a counterselectable markers.
Figure 7: Overnight plates with 100 ug/ml MTZ concentration with and without IPTG with different nitroreductase strains and control. BS-nitred’s growth was inhibited in comparison with BS-control however there are still some BS-nitred colonies growing.
Figure 8: Comparison of growth of BS-contol and BS-nitred at 90 ug/ml metronidazole. BS-nitred’s growth is clearly inhibited in comparison to BS-control however growth inhibition is not absolute.
We could not find a concentration of metronidazole at which nitroreductase containing cells’ growth was inhibited while control cells were growing. We determined that this gene is not suitable as a counter-selectable marker on plates.
To be continued...
