Team:Stanford-Brown/Biomining/Harvesting

From 2012.igem.org

Revision as of 02:26, 3 October 2012 by Jsborden (Talk | contribs)


Harvesting

The FliC gene codes for flagellin, a protein that arranges itself in a hollow cylinder to form the filament of a bacterial flagellum. The N and C termini of flagellin and alpha-helices flanking the termini form the inner core of the filament cylinder (Bergman). The central portion, or “dispensable region,” forms the outer surface of the filament, and is highly variable.

iGEM Team Slovenia 2008 used the FliC gene to design a chimeric fusion protein expressing the antigenic segment of H. pylori on E. coli flagella ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K133038 BBa_K133038]). Our team wanted to use the same flagellar expression mechanism to express metal binding sequences, and our part is an improvement on the Slovenian biobrick. In the process, we designed the FliC gene with a multiple cloning site (MCS) in the dispensable region so that any iGEM team can insert a protein to be expressed in the dispensable region.


Engineered MCS FliC:

FliC construct.001.jpg


Biobricks used: [http://partsregistry.org/Part:BBa_J23100 Promoter J23100], [http://partsregistry.org/Part:BBa_B0030 RBS B0030], [http://partsregistry.org/Part:BBa_B0015 Terminator B0015]


We inserted the following metal-binding sequences into the FliC disposable region:

"HTTC" (Cu+2)

HNLGMNHDLQGERPYVTEGC -->CATAACCTGGGCATGAACCATGATCTGCAGGGCGAACGCCCGTATGTGACCGAAGGCTGC

"HypB1" (Cu+1)

CTTCGCG -->TGCACCACCTGCGGCTGCGGC

"HypB2" (Cu+1)

MCTTCGCGEG -->ATGTGCACCACCTGCGGCTGCGGCGAAGGC


HTTC4 - inserted fully

HTTC6 - close to perfect insertion (couple of bases off)

HTTC8 - inserted fully

HTTC9 - inserted fully

HTTC10 - close to perfect insertion

HypB14 - inserted fully

HypB24 - inserted fully

HypB24 - inserted fully

Undergoing metal-binding assays now and flagella imaging on SEM.


CITATIONS Flagellin Dispensable Regions: Molly A. Bergman,Lisa A. Cummings,Robert C. Alaniz,Laura Mayeda,Ivana Fellnerova,Brad T. Cookson. CD4+-T-Cell Responses Generated during Murine Salmonella enterica Serovar Typhimurium Infection Are Directed towards Multiple Epitopes within the Natural Antigen FliC. 2005 Infect Immun. 73(11): 7226–7235

E.Coli FliC gene: http://biocyc.org/ECOLI/sequence-rc?type=GENE&object=EG10321

Synthetic Metal Accumulation Bacteria: Kouichi Kuroda and Mitsuyoshi Ueda. Molecular design of the microbial cell surface toward the recovery of metal ions. Current Opinion in Biotechnology 2011, 22:427–433

Retrieved from "http://2012.igem.org/Team:Stanford-Brown/Biomining/Harvesting"