Team:LMU-Munich/Data/Vectors

pSB_Bs1C

pSB_Bs1C is one of our empty vectors. It integrates into the amyE locus of Bacillus subtilis and carries a chloramphenicol resistance as well as an ampicillin resistance for E. coli. In between the two recombination sites, there is the constitutively expressed Cm resistance and the multiple cloning site which contains RFP to simplify the insertion of your BioBrick.

The plasmid is then transformed into B. subtilis and checked via the resistance for "integration at all" and via a starch test for "integration into the right locus". Correct integration results in loss of halo due to disruption of the amylase gene.

We tested this vector with various inserts, for example the final construct of our Sporobeads with GFP. The starch test demonstrated that the plasmid inserted correctly in the amyE locus and fluorescence microscopy revealed the functionality of the construct.

pSB_Bs4S

pSB_Bs4S is also an empty vector with only the multiple cloning site and the spectinomycin resistance gene in between the homologous regions. This vector integrates into the thrC locus of B. subtilis.

We tested the integration of this plasmid with the threonine test and a construct from the Suicideswitch as an insert.

pSB_Bs2E

pSB_Bs2E is our third empty vector, aiming to provide a set of three empty vectors with three different integration loci and three different compatible resistance casseettes for full flexibility in their combination.

This vector is still a work in progress, but currently only the multiple cloning site is missing. Of course, it is not tested yet.

pSB_Bs1C-lacZ

pSB_Bs1C-lacZ is a reporter vector, which contains the multiple cloning site upstream of a functional reporter device, consisting of ribosome binding site, β-galactosidase gene lacZ and terminator. Also, a chloramphenicol resistance is in between the two flanking homolgy regions. Upon chloramphenicol selection, this vector integrates into the amyE locus, which can be verified by the starch test.

This vector was used for several [2012.igem.org/Team:LMU-Munich/Data#Anderson_Promoter_Evaluation promoter evaluations].

pSB_Bs3C-luxABCDE

pSB_Bs3C-luxABCDE is our second reporter vector. It contains the multiple cloning site upstream of a functional reporter device, consisting of the lux-operon and a downstream terminator. Upon chloramphenicol selection, this vector integrates, this vector integrates into the sacA locus of B. subtilis by double homologous recombination.

Correct integration is verified by colony PCR. One primer is located outside the integration site and its respective partner is located on the inegrated part of the vector, facing outwards. gDNA from W168 as a negative control should not give a PCR product.

A pre-version of this vector with one forbidden PstI site was used for most promoter evaluations (All graphs that you can find in the Data section of the promoters derive from this pre-version). To proof that our final version also works, we did another experiment where we compared the luminescence of P_lepA in the pre- and final version of pSB_Bs3C-luxABCDE. Here you can see the results of this experiment:

In this experiment, the finished vector showed about half of the activity throughout the measurement, hence while the absolute luminescence values are lower, the overall dynamics are unaffected.

pSB_Bs4S-P_Xyl

CAUTION: DOES NOT WORK! CANNOT BE TRANSFORMED INTO B. SUBTILIS

pSB_Bs4S-P_Xyl is an integrative expression vector. Upstream of the multiple cloning site, there is a xylose-inducible promoter, P_xyl, followed by a terminator downstream. In the absence of xylose, P_xyl is inhibited by the repressor XylR, which is expressed in B. subtilis and not part of this vector. For selection, a spectinomycin resistance cassette is located in between the recombination sites. This vector integrates into the thrC locus, which can be checked by the threonine test.

However, we could not manage to transform this vector into B. subtilis, although we tried three times. Moreover, the team from Groningen also tested this vector, but again was not able to transform it into B. subtilis, either.

There are two possible reasons for the failure: First, a defective resistance cassette or second, the presence of a forbidden restriction site preventing correct linearization prior to transformation.

pSB_Bs0K-P_spac

CAUTION: THIS VECTOR DOES NOT WORK AS EXPECTED! THE PROMOTER IS STRONG CONSTITUTIVE INSTEAD OF IPTG-INDUCIBLE!

pSB_Bs0K-P_spac is a replicative expression vector with a kanamycin resistance. The IPTG -inducible promoter P_spac is followed by the multiple cloning site and a terminator. Moreover, it contains lacY, encoding aβ-Galactosid-Permease, and lacI, encoding the Lac-repressor. In the presence of IPTG, LacI is released from the promoter and the gene of interest is expressed.

The ble gene encodes the bleomycin resisitance protein (BRP), which can be used for by bleomycin selection in E. coli and B. subtilis. We did not use this resistance.

The presence of the vector can be checked by colony PCR with the primers: CTACATCCAGAACAACCTCTGC and TTCGGAAGGAAATGATGACCTC. We did not perfom the colony PCR because we selected for functionality of our lacZ-construct (see figure below) on plates with X-Gal and IPTG, and got blue colonies.

lacZ-activity in Miller units in pSBBs0K-Pspac depending on B. subtilis growth phase.

This expression vector was tested by insertion of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823016 lacZ] into the multiple cloning site, transformation into W168 and ONPG assays. Overnight cultures were diluted 1:100 in LB-medium and incubated at 37°C, 230 rpm. Cells were harvested in 2 ml reaction tubes and frozen. For the induction assay, a culture of about OD₆₀₀=0.9 was split into 3 ml aliquots in test tubes with different IPTG-concentrations and incubated for another hour. (Same results were obtained for OD₆₀₀=0.3, data not shown.)

lacZ-activity in Miller units in pSBBs0K-Pspac depending on IPTG concentrations.

In summary, the figures show that the expression is uniformly very strong [in comparison to the native B. subtilis promoters], even without addition of IPTG. It does change depending on the growth phase, with a maximum strength in the stationary phase.

This vector was designed for the inducible overexpression of proteins, but is constitutively active.

Possible reason for these results are: a dysfunctional Lac-repressor, or point mutations in the operator. This needs to be checked by sequencing.

Sporovector

Our Sporovector is specially designed to give you the opportunity to easily create Sporobeads with any fusion protein you can think of. The part between the EcoRI and PstI is available as BioBrick in pSB1C3 and can be cloned in any of our empty B. subtilis vectors. We also offer it “precloned” in pSB_Bs4S, which in this version lacks the NgoMIV restriction sites.

The Sporovector was created by ligation of three cut PCR-products with special overhangs (P_cotYZ, mRFP and cgeA-B0014). It is designed to allow N-terminal fusions of genes in Freiburg standard ([http://dspace.mit.edu/bitstream/handle/1721.1/45140/BBF_RFC%2025.pdf?sequence=1 RFC25]). Towards that end, the gene to be inserted must be cut with XbaI and AgeI and the vector must be digested with XbaI and NgoMIV. This removes the RFP cassette and allows easy selection for the integration of the new insert. After ligation, there is a scar of six nucleotides between both genes but no restriction site left.

Expression of the gene fusion is controlled by the P_cotYZ-promoter, which was the strongest in our promoter evaluations. The C-terminal part of the resulting fusion gene encodes CgeA, one of the two known spore crust proteins.

The vector is finished but has not yet been tested with an insert. We are working on three additional Sporovectors to also offer C and N-terminal fusions with both cotZ and cgeA.