"
Team:Wageningen UR/Journal/week19
From 2012.igem.org
week 19: 3 September - 9 September
Mark's hair
Mark will get married soon, so he had to spend the entire monday having his hair done. When he finally returned on tuesday, there was no difference.
Polero
Mr "success" Marnix left with polero coat protein at the downstream of IPTG induced promoter in the chloramphenical backbone in DH5 alpha strain. Han and Wouter took over this part experiment and continued. DH5 alpha strain were minipreped and the plasmids were transformed into JM-109, which was a protein expression strain. Colony PCR confirmed the transformation was successful witho both sequencing primers and polero primers.
Hepatitis B general
4 September
- Digestion of HepatitisB with a his tag (PCR fragment)once with Xba1 and Pst1 and once additionally with DPN1 to cut the template DNA from the PCR reaction and avoid transformation with this template construct
- Ligation of the digested fragments into both Bba_J04500 as well as Bba_J04550
5 September
- Transformation with Mach1
7 September
- colony PCR of the transformations from 4. September
-> nothing on the gel – also no positive control!
Hepatitis B ouside modification
- 7 September (Kees)
• 5’phosphorylated primers
By amplifying the whole plasmid, including the whole desired insert, only one pcr step is needed which can be used right away to transform bacteria.
The Primers:
FW-TEV:
P-AAGATAGCGGCGTTGAAGGAGGAAAATCTTTATTTTCAAGGTCTTGCTGCTGCTGtcgacgctggtggaggt
Reverse-TEV: P-TTCTTTTAGTGCTGCGATTTTCTCCTTCAACGCCGCTATCTTAGCAGCAGCAAGCAGATTATTGCCGACCCAG
Legend:
- Blue: HepBcAg gene
- Arrows: primers
- Black: Backbone
- Red Star: 5’phosphorylation on primers and DNA
Schematic overview of the quick change method used'
The primers used for whole plasmid pcr arrived and were diluted to 100µM.
The PCR mixture:
component Volume (µL)
Primers (FW and rev) 2
Enzyme (Phusion Thermo) 0.5
DMSO 100% 1
Buffer (HF Thermo) 10
Template (20ng/µL) 1
MQ water 34
dNTPs 1
PCR protocol: 1: 98˚C; 2min 2: 98˚C; 30s 3: 63˚C; 30s 4: 72˚C; 30s 15× from step 2 5: 4˚C; ∞ After the PCR, 10µL was used to digest with DpnI, 10µL was mixed with T4 ligase and the rest left untreated. DpnI was heat inactivated after which all three different samples (Ligase, DpnI, normal) were used to transform DH5α.
- 8 September (Kees)
• Colonies
All plates contained colonies, however there was only one on the DpnI-digested plate, which would suggested incomplete digestion rather than a wanted colony. Therefore, more of the sample was plated in order to obtain more colonies.
- 9 September (Kees)
• Checked the plates
There were no new colonies at all on the two new plates.
Hepatitis B inside modification
4 September
- Digestion of the step 4 PCR fragment once with Xba1 and Pst1 and once additionally with DPN1 to cut the template DNA from the PCR reaction and avoid transformation with this template construct
- Ligation of the digested fragments into both Bba_J04500 as well as Bba_J04450
5 September
- Transformation with Mach1
7 September
- colony PCR of the transformations from 4. September
-> nothing on the gel – also no positive control!
GFP modification
3 September
- 2nd PCR check of the minipreps from 31.Aug (this time only the ones with high DNA concentration) with sequencing primers as well as with GFP primers (from GFP-coil fusion step1)
-> still no bands on the gel
6 September
- Ligation of the 1st step of the PCR reaction into pJET
- transformation with Mach1
-> very slow growth, only a few colonies of which some where green (probably the template Bba_I13522 (Untagged GFP behind a constitutive promoter))
