|
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|
|
For information on plasmids and DNA mentioned in the notebook, see Stocks and Constructs.
For explanations of abbreviations used, click here.
Isolated plasmid DNA from the cultures of RBS* (<partinfo>BBa_B0030</partinfo>) and LacI (<partinfo>BBa_C0012</partinfo>) inoculated yesterday.
Ligated pBad (<partinfo>Bba_K206000</partinfo>) together with YFP+DTT (<partinfo>BBa_E0030</partinfo> og <partinfo>BBa_B0015</partinfo>), and VGB+RBS (<partinfo>BBa_K561001</partinfo> og <partinfo>BBa_B0034</partinfo>) and VHB+RBS (<partinfo>BBa_K258005</partinfo> og <partinfo>BBa_B0034</partinfo>) with Lysis (<partinfo>BBa_K124017</partinfo>).
Terminator <partinfo>BBa_B0014</partinfo> and re-transformed pllD in pSB1C3 were transferred to liquid cultur.
Ran gel on the PCR-products from yesterday.
5 µl of the PCR product from yesterday was run on gel, but it did not give any results. We looked at the primers and thought we had done something wrong, but we did not. Will try to do the PCR one more time, but with a lower annealing temperature (55°C).
The constructs containing plld ligated with the lysis device(<partinfo>BBa_K112808</partinfo>), and plld in plasmid <partinfo>PSB1C3</partinfo> were miniprepped. The concentration were measured using nano drop.
| Sample | Concentration [ng/µl] |
|---|---|
| pllD + lysis | 45,5 |
| pllD in PSB1C3 | 42,3 |
Inoculated 1 colony from each of three plates containing LacI (<partinfo>BBa_C0012</partinfo>), RBS* <partinfo>BBa_B0030</partinfo> and pllD + lysis (all inoculated 1/8), into 5 mL LB + Amp (BBa_B0030, LacI)/ LB + Cm (pllD + lysis).
Transformed the part <partinfo>BBa_B0014</partinfo> from the distribution kit, and re-transformed pllD in pSB1C3 with DNA taken from the sample shipped to the RHIT team yesterday.
Reviewed the data from the oxygen-promoter experiment on monday. In conclusion, it appears that oxygen levels in the induced (anaerobic) cultures were not as low as desired, as growth rates were very similar between the aerobic and anaerobic cultures, while one would expect anaerobic cultures to grow slower. After correcting for OD, the fluorescence in the cultures at the end of the experiment was lower than the fluorescence measured from a control culture with no expected production of fluorescent protein. For this reason, a full analysis of the rest of the data was not performed.
Gel purification was performed on the gel piece from yesterday, the lysis device cut with X+P. The concentration is 10,1 ng/µl. The lysis device and plld were ligated together, plld (with pSB1C3) as backbone.
The ligated lysis and plld were transformed into competent E.coli DH5α cells. This was also done for the biobricks lacI repressor from E. coli (<partinfo>BBa_C0012</partinfo>) and RBS (<partinfo>BBa_B0030</partinfo>).
The petri dishes from yesterday showed colonies on the dishes with the pSB1C3+Colisin construct and the K+RBS+Colisin construct. One colony from each petri dish were transferred to liquid medium.
Sent a sample of the E. coli pllD promoter in pSB1C3 backbone to the iGEM team at RHIT.
PCR was performed on pBad (<partinfo>Bba_K206000</partinfo>) and DTT (<partinfo>BBa_B0015</partinfo>), the primers used, PCR-mix and programmed times are listed below.
| Primer | Type | Sequence | Tm [°C] |
|---|---|---|---|
| DTT fwd | Forward | CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAG | 72 |
| DTT rev | Reverse | CTCTAGAAGCGGCCGCGAATTCCAGAAATC | 72 |
| pBad scar fwd | Forward | TACTAGAGTACTAGTAGCGGCCGCTGCAGT | 72 |
| pBad fwd | Forward | TACTAGTAGCGGCCGCTGCAGTC | 70 |
| pBad rev | Reverse | GCTAGCCCAAAAAAACGGTATGGAGAAACAGTAGAGAG | 72 |
Mix 1:
Mix 2:
This PCR mix was found here: http://francois.schweisguth.free.fr/protocols/High_fildelity_roche.pdf
The thermal timetable for pBad:
| 1 | Heated lid: | 103°C | |
| 2 | Initial denaturation; | 94°C | 2 min |
| 3 | Denaturation; | 94°C | 15 s |
| 4 | Annealing; | 66°C | 30 s |
| 5 | Elongation; | 72°C | 2 min |
| 6 | Go to step 3, repeat 10 x | ||
| 7 | Denaturation; | 98°C | 10 s |
| 8 | Elongation; | 72°C | 31 s |
| 9 | Go to step 7, repeat 15 x, with 5 s extra each time. | ||
| 10 | Final Elongation; | 72°C | 7 min |
| 11 | Hold | 4°C | ∞ |
The thermal timetable for DTT:
| 1 | Heated lid: | 103°C | |
| 2 | Initial denaturation; | 94°C | 2 min |
| 3 | Denaturation; | 94°C | 15 s |
| 4 | Annealing; | 66°C | 30 s |
| 5 | Elongation; | 72°C | 3 min |
| 6 | Go to step 3, repeat 10 x | ||
| 7 | Denaturation; | 98°C | 10 s |
| 8 | Elongation; | 72°C | 31 s |
| 9 | Go to step 7, repeat 15 x, with 5 s extra each time. | ||
| 10 | Final Elongation; | 72°C | 7 min |
| 11 | Hold | 4°C | ∞ |
The restriction digest for colicin cut with E+P made yesterday was purified using the QIAquick PCR purification kit, and after purification, the following ligations were made:
| Insert | Backbone | Volume of insert [µl] | Volume of backbone [µl] | Amount of T4 DNA ligase buffer [µl] | Amount of T4 DNA ligase [µl] | Amount of dH2O added [µl] |
|---|---|---|---|---|---|---|
| Colicin cut with E+P | pSB1C3 cut with E+P | 4.0 | 2.0 | 1.0 | 0.5 | 2.5 |
| Colicin cut with X+P | K+RBS cut with S+P | 7.0 | 5.0 | 1.5 | 0.75 | 0.75 |
| - | pSB1C3 cut with E+P | - | 2.0 | 1.0 | 0.5 | 6.5 |
| - | K+RBS cut with S+P | - | 5.0 | 1.5 | 0.75 | 7.75 |
Both the ligation and the religations were transformed to competent E.coli DH5α cells.
Restriction digest was run on the Lysis device (<partinfo>BBa_K112808</partinfo>) and the lld-promoter, as described in the protocol. Lysis was cut with X and P, plld cut with S and P. Plld was purified using a PCR purification kit, gel electrophoresis was done with the lysis device. The concentration of the plld was 3,2 ng/µl.
Today, we started testing the Vgb (<partinfo>BBa_K561001</partinfo>) and Vhb (<partinfo>BBa_K258005</partinfo>) promoters. For both promoters, we have made test constructs consisting of promoter, RBS (<partinfo>BBa_B0034</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>) and terminator (<partinfo>BBa_B0015</partinfo>). The testing was carried out by using two parallel cultures of each promoter construct, and inducing one of the parallels by bubbling the culture with nitrogen gas to remove oxygen. Samples were collected every 10 minutes.
Further, the constitutive promoter containing RBS (<partinfo>BBa_K081005</partinfo>) was cut with S+P, and the purified colicin PCR product were cut with X+P, to be ligated tomorrow. Another colicin PCR product sample was cut with E+P, to be ligated into the already cut pSB1C3 tomorrow.
We also test cutted Plld with BpmI and AflIII. This was performed because the number of religations for the pSB1C3 plasmid was higher than it should have been. One of the samples to be test cutted was taken from the miniprepped plasmids of one of the colonies on the religation plate, to be used as negative controll, and three parallel samples from the ligation plate were test cutted. The gel pictures are shown below:
  |
The results from the test cutting were ambigous. The test cut performed with AflIII show the expected fragments, while the test cut performed with BpmI do not. It seems that the promoter is there in all thre parallels; if not it would have been impossible to yield two fragements in the AflIII test cut. But still, if the promoter sequence is as it should have been, also the test cut with BpmI should have yielded two fragments. It is, however, possible, that the BpmI restriction site inside the promoter is ok, but that the restriction site in the plasmid is damaged.
Made LB medium in preparation for experiment with the oxygen-sensitive promoters tomorrow. Inspeccted the pSB1C3 religation plate in the incubator. Many colonies that were not visible at the time of the colony count yesterday has now appeared. The religation and the pllD plate now contains about the same number of colonies, casting doubt on the sucess of the transformation. Moved the plate to the fridge.
Extracted plasmid DNA by miniprep from the pllD (unconfirmed) and pSB1C3 religation cultures inoculated yesterday, and the culture of <partinfo>BBa_E0040</partinfo> (A. vic. GFP) inoculated 26/7. DNA concentrations were measured with NanoDrop, as follows (two parallel measurements were made for each sample):
| Sample | Concentration [ng/µl] |
|---|---|
| pllD 1 | 24,0/22,2 |
| pllD 2 | 25,9/26,5 |
| pllD 3 | 22,8/23,9 |
| pSB1C3 1 | 15,4/15,5 |
| pSB1C3 2 | 20,7/20,7 |
| BBa_E0040 | 38,2/37,8 |
DNA from all the above samples except GFP was digested with Xba1 and Spe1. The digested samples were analyzed by gel electrophoresis to find out whether the desired insert was obtained in any of the samples. 75 V was applied for 45 min, and the gel was imaged. After imaging, electrophoresis was continued at 40 V for a further 30 minutes before imaging again. The result of the second imaging is shown below.
Results of gel electrophoresis: All three samples from the pllD plate showed a short band identical between these samples, but it is difficult to determine the exact size - there seems to be an inconsistency in the migration of the 50 bp ladder on the left side of the gel and the 1 kb ladder on the right. Looking at the 50 bp ladder, the short band in the three first samples seems to be between the third and the fourth band from the bottom, representing 150 and 200 bp respectively. However, looking at the 1 kb ladder on the right, the short bands lie between the first and second ladder bands, equaling 250 and 500 bp respectively. The position of the short bands with respect to the 1 kb ladder appears to be consistent with the expected size of the pllD insert.
Taken together, it seems possible that the short band represents the desired insert, but the samples should be analyzed again to get more data. The samples from the pSB1C3 religation plate does not show this band and is overall much fainter.
The top bands in the pllD wells are on heigth with the seventh band from the bottom, equaling 2500 bp, in the Generuler 1kb ladder on the right. This is approximately the size of the pSB1C3 plasmid and the pllD insert together. The two wells on the right containing DNA from the pSB1C3 religation plate show two faint bands each: One slightly above the top bands in the pllD wells, and one shorter band slightly above the 1000 bp reference band in the 1 kb ladder.
Inspected the plates with PllD in <partinfo>pSB1C3</partinfo> and pSB1C3 religation transformants inoculated yesterday. Growth on both plates, but more on the PllD plate. No growth on negative control (non-transformed cells). Approximate colony cound: Religation: 73 pllD: 240
Assuming other factors are equal, based on these numbers a colony on the lldP plate should have about a 2/3 chance of containing the desired insert. Suggested course of action: Inoculate several colonies from the lddp plate, miniprep, perform a test restriction digest and gel electrophoresis to check size. Use colonies from the religation plate for reference: Plasmids with the desired insert should be about 344 bp larger than the religated plasmid without insert.
Inoculated 3 colonies from the PllD plate and 2 colonies from the pSB1C3 religation plate into 5 mL LB + Cm, and placed the cultures in 37 C shaking incubator. Placed the plates back in 37 C cabinet.
Updated information about stored DNA samples and glycerol stocks on the wiki.
Evening: Moved lldP plate from incubator to fridge.
The PCR batches run yesterday were investigated on gel electrophoresis, and the gel picture shows that colicin has been made!
The colicin PCR product were purified using the QIAquick PCR Purification Kit, and the concentration of product was measured to be 15.3 ng/µl.
Linearized pSB1C3 plasmid was digested with EcoRI and PstI, according to the procedure for [http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones digestion of linearized plasmids], and ligated with the lld promoter made by PCR on wednesday. Religation was also performed, and both the ligated plasmid and the religated plasmid were transformed to competent E.coli DH5α cells.
New primers were ordered for LldR, this time containing the biobrick prefix and suffix.
Discussed experimental design for testing of oxygen-sensitive promoters with Martin. Made a plan for testing both promoters on Monday.
Measured OD600 of samples from the cultures used to make glycerol stocks yesterday. The samples were taken yesterday and kept at 5 C until today. Results: EYFP (RBS+ LVA- TERM)(<partinfo>BBa_E0430</partinfo>): 1,00 pTet RFP (<partinfo>BBa_I13521</partinfo>) : 2,14 ptet GFP (<partinfo>BBa_I13522</partinfo>) : 0,86
Measured YFP, GFP and RFP fluorescence from the following cultures (data): LB (22/7) (D1) K + RBS + YFP + DTT (19/7) (D2) ptet mRFP (23/7) (D3) ptet mRFP (26/7) (D4) ptet GFP (26/7) (D5) EYFP (RBS+ LVA- TERM) (26/7) (D6)
Measurements confirmed that ptet GFP and ptet MRFP produce the desired products and can be used as positive controls. Significant overlap was observed between GFP and YFP fluorescence.
The PCR-products for Plld, LldR, and colicin were run on gel:
Since we are assuming that the Plld promoter is correct, this PCR product were purified using the QIAquick PCR purification kit. The concentration after purification was 16.5 ng/µl DNA.
The biobrick were then cut with EcoRI and PstI, to be ligated with EcoRI and PstI digested pSB1C3 tomorrow.
As no PCR product was made for LldR, and none of the expected product was made in the case of colicin, a new PCR were run, also including Plld, to investigate it on gel again, to see if the length of it relative to the ladder is more precise. For the case of the new PCR mixes, 50 µl were made instead of 20 µl, and 1 µl DMSO, which is known to increase the yield of desired product, was added. The PCR mixes were made according to the following procedure:
The thermocyclers were programmed to use the same PCR programs as the ones used wednesday.
GFP (<partinfo>BBa_E0040</partinfo>) were also transferred to liquid culture.
Today, we also had a video conference with the Rose Hulman Institute of Technology iGEM team, discussing how we could collaborate with each other. It was really nice meeting you, and hopefully, we'll be seing you in Boston in November:-)
Inspected plates with EYFP + LVA and ptet GFP inoculated 24/7, incubated overnight and kept in fridge since yesterday. Good growth.
Discarded K + RBS + RFP plate (17/7) found in incubator cabinet.
Made glycerol stocks from the following cultures: EYFP + LVA (<partinfo>BBa_E0430</partinfo>) (26/7) ptet GFP (<partinfo>BBa_I13522</partinfo>) (26/7) ptet mRFP (<partinfo>BBa_I13521</partinfo>) (26/7)
Re-inoculated following liquid cultures in new LB + amp medium (50 uL to 5 mL), followed by miniprep of the old culture. VGB + RBS + YFP + DTT (25/7) VHB + RBS + YFP + DTT (25/7) EYFP + LVA (25/7) ptet GFP (25/7)
Measured DNA concentrations (two parallels):
VGB + RBS + YFP + DTT: 23,2/22,6
VHB + RBS + YFP + DTT: 15,7/15,5
EYFP + LVA: 19,5/20,1
ptet GFP: 23,2/22,3
Ran gel electrophoresis of the latest PCR products (plld, LldR, colicin operon).
The pBad+RBS+YFP+DTT, the Vgb+RBS+YFP+DTT and the Vhb+RBS+YFP+DTT constructs were transferred to liquid culture. The primers we ordered two and a half weeks ago (!) also arrived this morning, so both the lld promoter, LldR and colicin were amplified using PCR. The following PCR mix was used for the three samples:
In the case of both the lld promoter and the LldR gene, the genome of E.coli K12 (strain ER2925) was used as template. For the colicin batch, the <partinfo>BBa_K150009</partinfo> biobrick was used as template. Two of the primer sets contained prefix and suffix, and for these, two different melting temperatures were determined. The reason for this is that in the first cycles, the only the primer parts able to bind to the template will be determining for the melting temperature, while in the later cycles, where the amplified DNA is dominating as template, also the prefix / suffix parts of the primers will be able to bind to the DNA, and hence the primers will obtain higher melting temperatures. For the two PCR mixes containing primers with prefix and suffix, a three step protocol was used in the first ten cycles, while a two step protocol was used in the last fifteen cycles. Phusion High Fidelity DNA Polymerase (Finnzymes). To calculate the melting temperature, we used Finnzymes' Tm calculator (http://www.finnzymes.fi/tm_determination.html).
| Primer | Type | Sequence | Tm [°C] |
|---|---|---|---|
| lld promoter fwd | Forward | cacattcctataggccgagtaaggt | 66.2 |
| lld promoter rev | Reverse | gcaggtctcctggagtccacgc | 73.8 |
| lldR fwd | Forward | atgattgttttacccagacgcctgt | 69.3 |
| lldR rev | Reverse | tcatgcgtttttctccctcgaat | 69.7 |
| Colicin fwd | Forward | atggaaaccgcggtagcgta | 68.7 |
| Colicin rev | Reverse | tgcgatggtccctccctgaa | 72.6 |
The following PCR programs were used:
lld promoter:
| 1 | Heated lid: | 103°C | |
| 2 | Initial denaturation; | 98°C | 30 s |
| 3 | Denaturation; | 98°C | 10 s |
| 4 | Annealing; | 69°C | 10 s |
| 5 | Elongation; | 72°C | 6 s |
| 6 | Go to step 3, repeat 10 x | ||
| 7 | Denaturation; | 98°C | 10 s |
| 8 | Elongation; | 72°C | 6 s |
| 9 | Go to step 7, repeat 15 x | ||
| 10 | Final elongation; | 72°C | 10 min |
| 11 | Hold | 4°C | ∞ |
lldR:
| 1 | Heated lid: | 103°C | |
| 2 | Initial denaturation; | 98°C | 30 s |
| 3 | Denaturation; | 98°C | 10 s |
| 4 | Annealing; | 70°C | 10 s |
| 5 | Elongation; | 72°C | 24 s |
| 6 | Go to step 3, repeat 25 x | ||
| 7 | Final elongation; | 72°C | 10 min |
| 8 | Hold | 4°C | ∞ |
Colicin:
| 1 | Heated lid: | 103°C | |
| 2 | Initial denaturation; | 98°C | 30 s |
| 3 | Denaturation; | 98°C | 10 s |
| 4 | Annealing; | 70°C | 10 s |
| 5 | Elongation; | 72°C | 31 s |
| 6 | Go to step 3, repeat 10 x | ||
| 7 | Denaturation; | 98°C | 10 s |
| 8 | Elongation; | 72°C | 31 s |
| 9 | Go to step 7, repeat 15 x | ||
| 10 | Final elongation; | 72°C | 10 min |
| 11 | Hold | 4°C | ∞ |
We also transformed the biobrick <partinfo>BBa_E0040</partinfo>, which is a protein coding part coding for GFP.
Transformed the pBAD+RBS+YFP+DTT, VGB+RBS+YFP+DTT, and VHB+RBS+YFP+DTT constructs ligated yesterday to supercompetent E.coli Dh5α cells.
We also started making our iGEM matchmaker, which will be useful for iGEM teams wanting collaboration with other teams.
Some of our primers arrived today, so tomorrow the PCR fun will start.
Transformed the BioBrick parts <partinfo>BBa_E0430</partinfo> and <partinfo>BBa_I13522</partinfo> using the iGEM 2011 DNA distribution kit.
We continnued the assembly of the promoter test constructs. As the test gel run on friday showed the expected fragment, the YFP+DTT samples were separated using gel electrophoresis. The inserts were cut out of the gel, as shown below, and purified using the QIAquick Gel Extraction Kit.
The pBad+RBS, Jen1+RBS, Vgb+RBS and Vhb+RBS backbones were purified using the QIAquick PCR Purification Kit. Concentrations of both inserts and backbones after purification are given below:
| Biobrick | Restriction enzymes used in digest | Concentration [ng/µl] |
|---|---|---|
| YFP+DTT | XbaI + PstI | 4.1 |
| pBad+RBS | SpeI + PstI | 0.5 |
| Vgb+RBS | SpeI + PstI | 1.7 |
| Vhb+RBS | SpeI + PstI | 2.4 |
| Jen1+RBS | SpeI + PstI | 1.2 |
VGB+RBS, VHB+RBS and pBAD+RBS were all ligated with YFP+DTT.
For the YFP + DTT fragment, DNA concentration measurements with NanoDrop after isolation with the quiagen kit were inconsistent. For the samples made from the two gel bands, values ranged from 3.7 to 14.8 and 4.0 to 24.4 ng/uL, respectively. Conclusion: Several measurements should always be made.
Inspected mRFP and RBS plates from yesterday. Good growth on both. No growth on negative controlplate.
Inoculated both mRFP and RBS from the plates into 5 mL LB + Amp (21/7), placed in 37 C shaking incubator
Attempted to measure GFP fluorescence in culture inoculated yesterday with negative result.
Inoculated two new cultures of K + RBS and K + RBS + GFP + DTT by transferring 30 uL from the cultures inoculated yesterday to 3 mL LB + Amp (medium prepared yesterday and kept in refrigerator). Attempted to measure GFP fluorescence at aprox. 2 and 4 h inoculation (OD ~ 0.2 and ~ 1.2} with negative result.
Is the problem with the construct itself/expression of GFP from the plasmid, or with plasmid stability? All cultures tested for GFP fluorescence so far have been "old" (probable stationary phase) or inoculated from "old" cultures. Reports indicate that B-lactamase in old culture media may degrade ampicillin at a high rate and lead to decreased plasmid stability, also when a new culture is inoculated using medium from an existing culture. To rule out this being the problem, a fresh culture should be inoculated from an agar plate and tested for fluorescence during log phase. Another possibility is to inoculate from an existing culture by spinning down the cells, washing the pellet with fresh medium (to remove B-lactamase), decant the washing medium and resuspend the cells in new growth medium.
Transformed cells with the part <partinfo>BBa_I13521</partinfo> (pTet mRFP) from the distribution kit and the part <partinfo>BBa_B0034</partinfo> from miniprep DNA.
Remeasured GFP and RFP fluorescence using different wavelengths and new samples. Results still negative. Re-measured YFP fluorescence on original sample retained in 96-well plate. Results were similar to initial measurement, indicating that YFP is stable for several days.
Inoculated two 5 mL cultures of LB with K + RBS and K + RBS + GFP + DTT respectively, from agar plates.
Attempted to measure fluorescence of cultures inouculated yesterdat with transformants harboring GFP and RFP under constitutive promoter (<partinfo>BBa_K081005</partinfo>). Results were negative - neither GFP or RFP seems to be expressed.
As the GFP and RFP constructs failed, work was started on assembling the promoters Jen1, pBAD, VGB and RBS with YFP. Plasmid DNA of JEN1+ RBS, VGB + RBS, VHB + RBS and pBAD + RBS in pSB1A2 was digested with Spe1 and Pst1. Plasmid DNA of YFP + DTT in psB1AK3 was digested with XbaI and Pst1. For YFP + DTT, digestion was performed on two samples. 4 uL of each sample digested DNA was used for gel electrophoresis to confirm the result,, the rest was stored at - 20 C. Gel visualization showed the expected fragments.
Designed new primers for the DDT terminator in pSB1A3 and ordered all primers designed today and yesterday. Contacted GATC and asked them to send us barcode stickers necessary for sequencing. They were also asked if they would like to join us as sponsors, providing us with sequencing.
Transferred transformants with RFP and GFP constructs to liquid culture.
Measured fluorescence in liquid culture of cells transformed with YFP (<partinfo>BBa_E0030</partinfo>) under a constitutive promoter (<partinfo>BBa_K081005</partinfo>). Results indicated that YFP was expressed (data). Due to the measurement of high fluorescence in the reference LB medium at the indicated maximum emission wavelength 527 nm, emission was measured centered at 544 nm.
Researched the lysis device and luxR+HSL induced promoter. The activity of the lysis device <partinfo>BBa_K112808</partinfo> under the control of <partinfo>BBa_R0062</partinfo> with LuxR constitutively coexpressed under TetR (<partinfo>BBa_R0040</partinfo> has been characterized by Pasotti et al. ([http://www.jbioleng.org/content/5/1/8])
Colonies from the petri dishes of VHB+RBS+RFP+DTT, VGB+RBS+GFP+DTT, Jen1+RBS+GFP+DTT and K+RBS+YFP+DTT were transferred to liquid medium. K+RBS+GFP+DTT and K+RBS+RFP+DTT didn't have any colonies, new petri dishes were made. The old and the new were incubated at 37C.
Inspected DTT, YFP and D2 plates. All showed good growth. Moved the plates to the frigde and discarded the old DTT; YFP and D2 plates (dates, 24/6, 20/6 and 20/6, respectively).
Inspectd RFP and VGB plates made yesterday. Both showed good growth. No growth on negative control plates. Discarded old VGB and RFP plates (dated 25/6 and 20/6). Prepared and stored glycerol stock of RFP and VGB.
Made a new wiki design. Designed primers for amplification of the lldR gene from K12 and the DDT terminator in pSB1A3.
Transformed Vhb+RBS+RFP+DTT, Vgb+RBS+GFP+DTT, Jen1+RBS+GFP+DTT and K+RBS with YFP+DTT, GFP+DTT and RFP+DTT, a control was also made. Ampicillin petri dishes were used, and they are left to incubate for the night.
Prepared and stored glycerol stocks from liquid cultures of DTT, CFP, YFP and "D2" per our protocol.
Measured OD on the cultures used. Result:
DTT: 1,42
CFP: 1,44
YFP: 1,41
D2: 1,35
Performed an experiment to assess effect of induction of lysis device on the number of colony forming units (CFU). Combined the two 3 mL lysis + pBAD cultures inoculated yesterday, mixed and pipetted out 2 mL to two each of two new tubes. Added 19 uL 0,1 M arabinose (solution made 10/7) to one (induced) and equal volume dH2O to the other (control). The cultures were then incubated at 37 C with shaking. Immediately before induction, and at 30 min, 1 h, 2h and 3h after induction, 1 uL culture was pipetted out from each culture, diluted in 1000 uL H2O, the dilution vortex mixed, and 1 uL of the dilution pipetted out into 1000 uL again for a 10^-6 dilution. For each culture and time point, two LA + Amp plates were inoculated with 20 uL and 200 uL of the 10^-6 dilution, respectively. Inoculated plates were incubated at 37 C.
OD measurements were made immediately before induction, at 30 min, 1h and 3h post-induction. Results: Pre-induction: Induced: 1,72 Control: 1,81
30 min: Induced: 1,33 Control: 1,78
1 h: Induced: 1,02 Control: 1,79
3 h: Induced: 1,00/1,09 (remeasurement, new sample) Control: 2,50/2,45 (remeasurement, new sample)
Miniprepped LuxR+DTT and LuxI+DTT by using the Wizard plus SV miniprep kit from Promega. Concentrations are given below:
| Biobrick | Concentration [ng/µl] |
|---|---|
| LuxI+DTT | 37.6 |
| LuxR+DTT | 37.0 |
Vhb+RBS, Vgb+RBS, Jen1+RBS, and K+RBS (<partinfo>BBa_K081005</partinfo>), was cut with S+P, and RFP+DTT, YFP+DTT, GFP+DTT and CFP+DTT was cut with X+P. The next step will be to ligate all promoters together with a fluorescent protein, in order to test them before putting them into the final construct.
A gel electrophoresis was performed on Vhb+RBS, Vgb+RBS, Jen1+RBS and K+RBS as well as all the fluorescent proteins + double terminator. The fluorescent protein genes were cut out and a gel extraction was performed,, as in the protocol. The promoters were purified using the PCR Purification Kit, as described in the protocol. The concentrations after purification are as follows:
| Construct | Concentration [ng/µl] |
|---|---|
| YFP+DTT | 4.9 |
| GFP+DTT | 10.6 |
| RFP+DTT | 32.1 |
| CFP+DTT | 5.3 |
| K+RBS | 8.2 |
| Vhb+RBS | 8.1 |
| Vgb+RBS | 9.0 |
| Jen1+RBS | 10.4 |
K+RBS were ligated together with RFP+DTT, YFP+DTT and GFP+DTT. Jen1+RBS and VGB+RBS were ligated together with GFP+DTT, and VHB+RBS were ligated together with RFP+DTT.
Inspected the plates made yesterday. All plates showed numerous (100++) colonies or bacterial lawn. No difference between plates inouclated with culture diluted in LB and diluted in H2O was immediately appearant. Conclusion: For making new plates from saturated E. coli cultures in LB, a volume of 20 uL from a 10 000 - 100 000 dilution in H2O is probably suitable. Discarded the plates inoculated with LB-diluted culture. Placed the plates inoculated with H2O diluted culture in the refrigerator.
Inoculated two 3 mL LB+Amp aliquots with 30 uL pBAD + lysis culture, placed in 37 C shaking incubator.
Prepared and stored glycerol stocks of LuxR+HSL, LuxR, Lysis, pBAD, GFP and pBAD+lysis.
Made a new stock solution (2 mL) of chloramphenicol.
Made new La+Amp plates (27).
Plated out YFP, CFP, DTT and "D2" from the cultures made 13/7. Inoculated a liquid culture of RFP from the plate made on 20/6, and pf VGB from the plate made 25/6.
Removed liquid cultures of pBAD + lysis,pBAD, LuxR, LuxR+HSL regulated promoter, GFP lysis device and LuxR hybrid promoter from incubator. RFP showed no visible growth - may have used the wrong antibiotic (amp instead of kan).
Plated out LuxR+HSL, Lysis, pBAD, LuxR, GFP and pBAD + lysis, as follows: 1 uL of each culture was added to both of two eppendorf tubes containing 1000 uL LB medium and 1000 uL H2O, respectively. The dilutions were vortex mixed and 20 uL of each dilution plated out on plates containing LA + amp. The plates were incubated at 37 C, while the remainder of the LB dilutions were incubated at 37 C with shaking. All other liquid cultures were placed in the refrigerator.
Miniprepped LuxI+DTT and LuxR+DTT according to protocols. An unexpected white precipitate appeared in the column after eluting the DNA from the filter in the final centrifugation. This was discarded, and the OD of the supernatant was measured with NanoDrop. The resulting concentrations were much higher than expected, 293.8 ng/µl for LuxR+DTT and 264.9 ng/µl for LuxR+DTT.
Due to the unexpected results, new liquid cultures were made for the two samples and the miniprep procedure will be performed again on sunday or monday.
Isolated plasmid DNA from the fluorescense proteins RFP (<partinfo>Bba_E1010</partinfo>), YFP(<partinfo>BBa_E0030</partinfo>), GFP (<partinfo>BBa_K082003</partinfo>) and CFP (<partinfo>BBa_E0020</partinfo>) ligated with a double terminator DTT (<partinfo>BBa_B0015</partinfo>) in addition to the constitutive promoter (<partinfo>BBa_K081005</partinfo>). The concentrations of the isolated samples are given below:
| Biobrick | Concentration [ng/µl] |
|---|---|
| RFP | 40,9 |
| YFP | 55,5 |
| GFP | 41,1 |
| CFP | 47,6 |
| Const. Promoter | 19,8 |
Further work on the test construct in J5. Also, Clone was used to simulate cutting and ligating, yielding the sequence of plasmid <partinfo>pSB1A2</partinfo> assembled with constitutive promoter and RBS (<partinfo>BBa_K081005</partinfo>) using the standard BioBrick assembly method outlined at [http://partsregistry.org/Help:Assembly http://partsregistry.org/Help:Assembly].
LuxI+DTT and LuxR+DTT was transferred to liquid medium for overnight incubation. Miniprepping will be done tomorrow.
We had our weekly meeting with the advisors. A very quick summary can be found in the Dropbox folder.
Inoculated new liquid cultures from existing agar plates of E. coli DH5a cells transformed with the following BioBrick parts/constructs, in preparation for making new plates:
LuxI (<partinfo>Bba_C0061</partinfo>) and LuxR (<partinfo>BBa_C0062</partinfo>) were cut and ligated with the DTT terminator (<partinfo>BBa_B0015</partinfo>). LuxI+DTT and LuxR+DTT were thereafter transformed.
Colonies of the BioBricks RFP (<partinfo>Bba_E1010</partinfo>), YFP(<partinfo>BBa_E0030</partinfo>), GFP (<partinfo>BBa_K082003</partinfo>), CFP (<partinfo>BBa_E0020</partinfo>) and the constitutive promoter (<partinfo>BBa_K081005</partinfo>) where transferred to liquid medium with amp resistance.
Restriction digestion were performed on Jen1+RBS (<partinfo>BBa_K284002</partinfo> and <partinfo>BBa_B0034</partinfo>), VGB+RBS (<partinfo>BBa_K561001</partinfo> and <partinfo>BBa_B0034</partinfo>), VHB+RBS (<partinfo>BBa_K258005</partinfo> and <partinfo>BBa_B0034</partinfo>) and LuxR (<partinfo>BBa_C0062</partinfo>) with the enzymes SpeI and PstI. They are now ready to be ligated together with YFP+DTT and CFP+DTT, to be tested.
The BioBricks RFP (<partinfo>Bba_E1010</partinfo>), YFP(<partinfo>BBa_E0030</partinfo>), GFP (<partinfo>BBa_K082003</partinfo>) and CFP (<partinfo>BBa_E0020</partinfo>) where ligated together with the double terminator DTT (<partinfo>BBa_B0015</partinfo>), and transformed. They are incubated overnight.
Transformed a constitiutive promoter (<partinfo>BBa_K081005</partinfo>) which also contains RBS so that we save a cloning step in our test constructs.
An experiment was performed to assess the functioning of the Bacteriphage T4 lysis device (<partinfo>BBa_K112808</partinfo>). The culture of pBAD (<partinfo>BBa_K206000</partinfo>) + lysis transformed cells inoculated yesterday was divided into two aliquots of 25 mL each in capped 50 mL plastic tubes. After removing 0.5 mL from both cultures for measurement of OD pre-induction, one aliquot was induced with 240 uL 0.1 M arabinose for a final concentration of approximately 1 mM, and the same amount of distilled water was added to the other culture. After induction, both cultures were incubated at 37 C with shaking (200 rpm). OD 600 was measured with a PerkinElmer Lambda 35 spectrometer shortly before and at 0.5, 1, 2 and 3 h after induction. At 3 h, a precipitate had developed in both cultures, more being visible in the induced culture. At this point, clearing of the induced culture was plainly visible. The precipitate interferred with pipetting during the last sampling, and a small amount was transferred to the cuvettes when measuring OD of the induced sample. This may have affected the last measurements slightly.
The results of the OD measurements are shown below.
The plates inoculated with lysis induced and control culture yesterday were inspected. The lysis induced plates appeared to show less growth, but the number of colonies was very high on all plates and it was not possible to get an accurate count.
Designed the LuxR+HSL promoter testing circuit in J5. Designed and ordered primers for amplification of the desired genes from the colicin E1 operon in E. coli.
As the restriction cutting of RFP, YFP, GFP and CFP yesterday turned out to be a sucsess, the rest of the samples were run on gel, and the bands containing the fluorescent proteins were cut out and purified using the QIAquick Gel Extraction Kit. Concentrations are given below:
| Biobrick | Concentration [ng/µl] |
|---|---|
| RFP | 2,8 |
| YFP | 2,7 |
| GFP | 2,0 |
| CFP | 1,4 |
The two parallels of the terminator cut yesterday with E+X was purified using the QIAquick PCR purification kit. Concentrations are given below:
| Parallel | Concentration [ng/µl] |
|---|---|
| A | 2.1 |
| B | 1.5 |
Test cutting of the fluorescent protein parts (RFP, YFP, GFP and CFP) was performed. Results are shown below:
We confirmed that the lysis device part (<partinfo>BBa_K112808</partinfo>) we have extracted from the distribution kit is functional, by testing the construct with the pBAD strong promoter (<partinfo>Bba_K206000</partinfo>) and lysis device assemmbled together. The device was activated by inducing the pBAD promoter with arabinose. Liquid culture of cells transformed with the construct was grown overnight, and 1 mM arabinose added to a 1 mL sample of the culture. After incubation at 37 C for 3 h, the induced sample was significantly clearer compared to a non-induced negative control sample, indicating lysis.
The absorbance of the samples at 600 nm were measured with a Lambda 35 spectrometer, using LB medium as reference. The measured values for undiluted samples were:
Note that the measured absorbance of the control sample is outside of the range of 0.1-0.9 that is considered to not require dilution. Above this range, samples should be diluted to ensure that Beer's law applies. As measured, this absorbance is therefore probably too low.
In order to make a more quantitative assesment of the extent of lysis, cells were plated out from both the induced and control samples, as follows: 2, 20 and 200 uL of each on LA + Amp plates, for a total of six plates.
0.5 mL of culture inoculated yesterday (sample A) was transferred to 50 mL fresh LB + Amp in an sterile Erlenmeyer flask and incubated at 37 C with shaking.
The constructs dld+RBS, Jen1+RBS, VGB+RBS and VHB+RBS where all cut once with XbaI and SpeI, and once with an enzyme that has two seats where they digest. Which enzyme used for which construct can be found in the table below.
| Construct | Double digest enzyme |
|---|---|
| dld+RBS | Eco57I (AcuI) |
| jen1+RBS | ApaLI |
| VGB+RBS | ApaLI |
| VHB+RBS | ApaLI |
The Figure below shows the gel electrophoresis for the test cutting. Green circles indicate bands that were expected, red circles indicate unexpected bands or expected bands that were missing. The yellow circles indicate bands that might be correct, but not conclusive.
Miniprepped pBAD+lysis, VHB+RBS, VGB+RBS, JEN1+RBS and DLD+RBS. Concentrations were measured using NanoDrop and were as follows:
All the segments mentioned above except pBAD+lysis were subsequently tested by digestion with restriction enzymes followed by gel electrophoresis. All plasmids were cut using XbaI and SpeI as well as one other enzyme having exactly two restriction sites on the plasmid. BciVI was used on VGB+RBS, ApaLI on JEN1+RBS and Eco57I on the remaining two plasmids, DLD+RBS and VHB+RBS.
After cutting, gel electrophoresis was performed. After running for 45 minutes, the results were as follows:
Inoculated one colony of the pBAD + lysis transformants into two tubes with 10 mL LB + Amp each, using an inoculating needle.
Performed restriction digestion with EcoRI and SpeI using the standard protocol on the following DNA samples:
DNA from the following samples were digested with EcoRI and XbaI:
After digestion, the results were visualized by gel electrophoresis, using 4 µL from each digestion mixture. Based on the gel visualization, all the digestions appear to have been sucessful.
We performed restriction digest [1] on a constitutive promoter <partinfo>BBa_J23119</partinfo> an Lux I <partinfo>BBa_C0061</partinfo>. The constitutive promoter was cut with the restriction enzymes SpeI and PstI. Lux I was cut with the restriction enzymes EcoRI and XbaI.
The samples were run on gel, and the correct bands were cut out and extracted.Consentrations are given in the table below:
| Parallel | Concentration [ng/µl] |
|---|---|
| BBa_J23119 | 2,6 |
| BBa_C0061 | 0,9 |
The ligated constructs of Jen1 (<partinfo>BBa_K284002</partinfo>) + RBS (<partinfo>BBa_B0034</partinfo>), Dld (<partinfo>BBa_K284003</partinfo>) + RBS (<partinfo>BBa_B0034</partinfo>), VHb (<partinfo>BBa_K258005</partinfo>) + RBS (<partinfo>BBa_B0034</partinfo>) VGB (<partinfo>BBa_K561001</partinfo>)+ RBS (<partinfo>BBa_B0034</partinfo>)and pBAD (<partinfo>BBa_K206000</partinfo>) + lysis <partinfo>BBa_K112808</partinfo> were transferred from plates to liquid media and placed in cabinet for incubation.
The the religation plate with only the backbone plasmid did also have som growth which is not what we want. We still decided to continue on with the promoter constructs. The religation of the pBad plasmid did not show any growth.
Transformed pBAD-lysis and pBAD religated.
A gel electrophoresis was run on the BioBricks digested yesterday (Jen1 <partinfo>BBa_K284002</partinfo>, Dld <partinfo>BBa_K284003</partinfo> and VHb <partinfo>BBa_K258005</partinfo>). The results were the same as the first gel electrophoresis, so no gel extraction was performed. The purified DNA from Thursday 05.07.12 was used further on.
Jen1, Dld, Vgb, and Vhb cut with EcoRI and SpeI were ligated together with RBS cut with EcoRI and XbaI, and the ligated plasmids were transformed to competent Dh5α cells.
The gel electrophoresis of Jen1 (<partinfo>BBa_K284002</partinfo>), Dld (<partinfo>BBa_K284003</partinfo>) and VHb (<partinfo>BBa_K258005</partinfo>) was analyzed. Only two bands per column were expected, insert and backbone, but there was at least one extra at each column. The length of the genes Jen1, Dld and VHb are 998 bp, 463 bp and 137 bp, respectively, so the bands closest to the given sizes were cut out of the gel and purified using a QIAquick Gel Extraction kit. The concentrations of the purified genes are listed below:
Since there were so many bands per column in the gel electrophoresis for Jen1 (<partinfo>BBa_K284002</partinfo>), Dld (<partinfo>BBa_K284003</partinfo>) and VHb (<partinfo>BBa_K258005</partinfo>), the procedure will be done one more time. They were cut, as described in the protocols, but with half the concentration of DNA.
Gel electrophoresis was also performed on the lysis device and pBAD promoter. The expected sizes of the DNA sequences were 2079 bp for the lysis plasmid, 1785 bp for the lysis device and about 2000 bp for the pBAD promoter with backbone. This corresponds well with the observed bands. Pictures of the gels obtained from the two electrophoresis runs are included below. On both gels, the far left and far right wells contain GeneRuler 1kb DNA ladder.
 |  |
The DNA segment containing the VGB promoter was extracted from another gel according to protocols. The resulting DNA concentration was measured twice, once to 17.4 ng/µL and once to 19.6 ng/µL.
The BioBricks colicin (<partinfo>BBa_K150009</partinfo>), dld-promoter (<partinfo>BBa_K284003</partinfo>), jen1 (<partinfo>BBa_K284002</partinfo>) and VHb-promoter (<partinfo>BBa_K258005</partinfo>) were miniprepped as described in the protocol. The concentration results are listed below:
The luxI BioBrick <partinfo>BBa_C0061</partinfo> was transformed. Continued work on circuit assembly using J5.
Restriction digestion was performed on dld-promoter (<partinfo>BBa_K284003</partinfo>), jen1-promoter (<partinfo>BBa_K284002</partinfo>) and VHb-promoter (<partinfo>BBa_K258005</partinfo>) as described in the protocol. All of them cut with E and S.
Restriction digest were also performed for the vgb-promoter (E + S) and RBS (E + X), and gel electrophoresis was performed to verify that the correct DNA fragment were made during digestion. The RBS digestion sample was purified using a QIAquick PCR Purification kit. Using this kit will cause small DNA fragments, like the prefix fragment between the EcoRI and XbaI sites, to be lost. All of the vgb sample was run on gel, to separate the insert to be further used, from the backbone.
Performed restriction digest on the pBAD (<partinfo>BBa_K206000</partinfo>) and lysis <partinfo>BBa_K112808</partinfo> parts, cutting pBAD with SpeI and PstI, and the lysis part with XbaI and PstI.
Wiki design updated. [http://j5.jbei.org/ J5] was used to determine how to assemble the genetic circuit. The total size of the complete plasmid containg all the parts of our system will probably be 8000-9000 bp ((depending on the size of the backbone), of which the BioBricks make up about 6500 bp.
Also, it was discovered that the colicin BioBrick (<partinfo>BBa_K150009</partinfo>) consists of a number of DNA segments, not only genes for the necessary colE1 proteins. Among these are the luxR gene and the LuxR-HSL promoter as well as a lysis-inducing component. This means that inserting the entire BioBrick into our circuit will be problematic, as the LuxR production and LuxR-HSL sensitivity of the construct will interfere with the oxygen promoter and the rest of the luxR components in our circuit. The problem can probably be circumvented if we amplify the genes coding for the two colE1 proteins and connect them to a constitutive promoter.
Dld (<partinfo>BBa_K284003</partinfo>), Jen1 (<partinfo>BBa_K284002</partinfo>) and VHB (<partinfo>BBa_K258005</partinfo>) were transferred to liquid medium.
Restriction digestion was performed on isolated DNA from the VGB and RBS biobricks (<partinfo>BBa_k561001</partinfo> and <partinfo>BBa_B0034</partinfo>) according to protocols. Gel electrophoresis was used to determine the size of the resulting fragments. The RBS restriction digest was filtered using the QIAquick PCR purificat kit. The results for VGB were not as expected, and restriction digest of this part was therefore performed again, this time with addition of [http://en.wikipedia.org/wiki/Calf-intestinal_alkaline_phosphatase CIP] to the digest solution at the end of the procedure.
Dld (<partinfo>BBa_K284003</partinfo>), Jen1 (<partinfo>BBa_K284002</partinfo>) and VHB (<partinfo>BBa_K258005</partinfo>) were transformed as described in protocols.
Miniprepped all three tubes with pBAD inoculated yesterday. Tube 3 contained 10 mL culture and was divided into two tubes, so that all processed tubes contained ~5 mL culture. Results of DNA measurements were as follows (ng/uL):
Discarded B3-1 and B3-2, placed B1 and B2 in -20 C freezer.
In order to make a new plate of Lysis 1, transferred 20 uL from one of the tubes with liquid culture inoculated yesterday to one LA + Amp plate, and 50 uL to another. Placed the plates in the 37 C incubator cabinet. Also transferred 50 uL as inoculate to the tube used as negative control yesterday and placed it in the shaking incubator. Then combined all three tubes into one and placed in refrigerator to limit cell death before miniprep tomorrow.
Removed pBAD plates from 37 C incubator. Good growth on all transformed plates, Negative control showed no growth. Inoculated three colonies from plate B in liquid LB + Amp. Discarded the "mixed" plate. Placed plates A and B in refrigerator. Also inoculated three colonies from the lysis biobrick <partinfo>BBa_K112808</partinfo> using the plate from 22/6. Used an inoculating needle for all inoculations today.
LuxI (<partinfo>BBa_K092400</partinfo>) was transferred to petri dishes with Chloramphenicol and Kanamycin, to test if LuxI has a different resistance than given. A new batch of LA-medium with Ampicilin was prepared and poured on to petri dishes.
Researched the ArcA protein and its binding sequence(s) to investigate whether the lldPRD operon promoter can be modified to eliminate repression by ArcA-P in the anaerobic state. Located a putative ArcA-P binding site in the promoter sequence: The sequence GTTAACTAAATGTTA is the reverse complement of the minus strand of the 85 bp promoter sequence from position 38 to 52. This sequence is identified by [http://onlinelibrary.wiley.com/doi/10.1046/j.1365-2958.1999.01347.x/full#t1 McGuire et al (1999)] (see [http://arep.med.harvard.edu/ecoli_matrices/dat/arcA.dat this] list). In the GenBank entry this part of the sequence reads TAACATTTAGTTAAC
Favorov et al. have made a newer suggestion for a general motif for ArcA binding sites - see [http://bioinformatics.oxfordjournals.org/content/21/10/2240.full#sec-5 this article] and the computational result [http://favorov.bioinfolab.net/SeSiMCMC/examples/arcA/result.html here]. According to Favorov, the crucial features of the site is a direct repeat, as shown below:
atacaTAACatttagtTAACcattc
Extracted the pBAD strong promoter biobrick <partinfo>BBa_K206000</partinfo> and transformed it in two samples. Plated out on three Amp plates as follows: 200 uL from sample A, 200 uL from sample B, 20 uL each from sample A and B.
A colony of LuxR (<partinfo>BBa_R0062</partinfo>) was transferred to liquid medium, but there were no colonies of LuxI (<partinfo>BBa_K092400</partinfo>). A new agar plate with LuxI was prepped.
Performed isolation of plasmid DNA from RBS (<partinfo>BBa_B0034</partinfo>), C78, C79 and VGF promoter (<partinfo>BBa_K561001</partinfo>). The parts coding for the LuxR and LuxI genes, <partinfo>BBa_R0062</partinfo> and <partinfo>BBa_K092400</partinfo> respectively, were transformed again.
Colonies from <partinfo>BBa_C0078</partinfo>, <partinfo>BBa_C0079</partinfo> and <partinfo>BBa_K561001</partinfo> were transferred from agar plates to liquid medium.
Performed isolation of plasmid DNA from the ribosome binding site (RBS) part <partinfo>BBa_B0034</partinfo>, and the double transcriptional terminator (DTT) part <partinfo>BBa_B0015</partinfo> grown on ampicillin and on kanamycin. The yield was quite poor, especially for RBS. We then decided to run the spin columns one more time to see if we could get a higher yield the second time. Since we are going to use a lot of RBS, we made a liquid culture right away, so we can perform a new DNA isolation on RBS tomorrow.
Wiki design and contents was revised. Front page layout done and general layout underway.
Research was done on hybrid promoters in the kit and two interesting ones were found. The genes coding for the necessary activators and repressors were also included in the distribution. The resulting three biobricks of interest <partinfo>BBa_K092400</partinfo> (LuxI), <partinfo>BBa_C0078</partinfo> (C78) and <partinfo>BBa_C0079</partinfo> (C79), were transformed using the standard protocol.
The BioBrick part <partinfo>BBa_K561001</partinfo> (vgb promoter, microaerobic) was extracted from the kit, transformed into E. coli, and the transformed cells plated out on Chloramphenicol (Cm) plates.
A transformed colony containing the RBS part extracted yesterday, was transferred to liquid medium (5 mL LB)
Two transformed colonies containing the DTT part on a plasmid backbone with Ampicillin and Kanamycin reistance, which was extracted yesterday, was transferred to liquid medium as follows:
One colony grown on agar plate with ampicillin, was transferred to a tube with LB (5 mL) + Kanamycin (100 ug/mL One colony grown on agar plate with kanamycin, was transferred to a tube with LB (5 mL) + Ampicillin (100 ug/mL)
DNA was isolated from the liquid culture of LuxR+HSL transformed cells inoculated yesterday by miniprep. The DNA concentration in the product was measured as 13,3 ng/uL.
The biobricks <partinfo>BBa_B0034</partinfo> (RBS) and <partinfo>BBa_B0015</partinfo> (Double terminator, DTT) were extracted from the distribution kit and transformed into E. coli which were plated out. The liquid culture left after the plating was stored at 5 C.
Plasmid DNA was isolated from liquid cultures, inoculated on 22.06 and 23.06 respectively, of E. coli transformed with <partinfo>BBa_R0062</partinfo> (LuxR & HSL promoter) and <partinfo>BBa_K112808</partinfo> (T4 lysis device, no promoter), using Promega miniprep. The concentration of isolated <partinfo>BBa_R0062</partinfo> DNA was measured to 15,7 ng/uL. Due to the low yield, this brick may have to be regrown. Suspecting too long incubation time as the cause. The concentration of isolated <partinfo>BBa_K112808</partinfo> DNA was measured to 111,0 ng/uL. Both samples were stored in the freezer at -20 C.
To make a new liquid culture of <partinfo>BBa_R0062</partinfo> transformed E. coli, a colony from the plate made on 21.06 (stored in refrigerator at 5 C since then) was inoculated in aproximately 4.5 mL LB medium with 4.5 uL of Amp stock solution (100 mg/mL) added, and incubated with shaking at 37 C.
Of two LA + Amp plates with <partinfo>BBaK112808</partinfo> transformants (20 and 200 uL) incubated since yesterday, only the 200 uL plate showed growth (10+ colonies). Negative control plate (untransformed cells) showed no growth. One colony was transferred to liquid culture.
On the 20 uL plate, a water bubble below the agar was mistaken for a colony, and a liquid culture was inoculated with a toothpick after scratching the plate. The mistake was realized, but the tube was still left to incubate, as it was thought it could act as a (weak) negative control.
The [http://partsregistry.org/Part:BBa_R0062 BBa_R0062] transformant from yesterday yielded several colonies on its plate, and one colony was inoculated into liquid medium and incubated at 37 C with shaking. After adding antibiotic to the liquid medium in the growth tube, some of the medium was spilled, so the growth volume was about 2 mL.
Isolation of plasmid DNA from all 7 initial transformants (see 20.06.12) was performed with the Promega Wizard Plus SV Minipreps DNA Purification System A1460.
The biobrick <partinfo>BBa_K112808</partinfo> (Enterobacteria phage T4 Lysis Device - no promoter, called Lysis1) was extracted from the distribution kit and transformed into E. coli.
We started the day with a lecture on genetic circuit modelling by Ph.d student and iGEM team instructor Marius Eidsaa, followed by a discussion of the options available in designing our system.
All 7 transformants from yesterday yielded 1 or more colonies. Negative controls (untransformed cells) plated out on Kanamycin and Ampicillin plates showed no growth, indicating that the antibiotics were effective in selecting transformants for growth. 1 colony from each of the transformants was inoculated in liquid LB medium and incubated at 37 C with shaking.
The biobrick [http://partsregistry.org/Part:BBa_R0062 BBa_R0062] (Promoter (luxR & HSL regulated -- lux pR)) was extracted from the distribution kit and transformed using our modified version of the official iGEM transformation protocol (see Protocols).
We started the day with an introduction to computer modeling of biological sytems, and use of the Cain chemical kinetics simulation program. We then researched and discussed various biobricks, and transformed several biobricks from the iGEM DNA distribution plates into E coli.
The following biobricks (with nicknames) were extracted from the iGEM 2012 DNA distribution kit and transformed according to protocol:
We started the day preparing lab equipment. We sterilized pipette tips, toothpicks, water and LA and LB medium. We also prepared stock solutions of ampicillin and kanamycin, and made petri dishes containing LA + Amp (100 ug/mL) and LA + Kan (100 ug/mL). Equipment and solutions were autoclaved at 120 C for 20 minutes.
We prepared LB medium (1 L) and LA medium (2 L). After mixing, each batch was divided into two bottles for autoclaving.
Stock solutions of Ampicillin and Kanamycin (both 100 mg/mL) were prepared from dry powders. After preparation and between use, the solutions were stored at -20.
After autoclaving, LA media bottles were left to cool. After reaching a temperature where they could be comfortably handled, the desired antibiotic was added using sterile technique. (500 uL stock solution to each bottle containing aproximiately 0.5 L, to a final antibiotic concentration of 100 ug/mL). The medium was then stirred and poured into petri dishes. The petri dished were left to cool down and placed cool for storage.
The team visited the lab and was given a EHS run-through by Merethe Christensen. We also risk evaluated the project and handed in the risk assessment, so now we are ready to start working in the lab:-)
Today, we tried to come up with a preliminary genetic circuit. We decided that using HGF as a signal molecule could be difficult, since we don't even know if a protein this size could penetrate the outer membrane and the peptidoglycan layer of E.coli. But we have found out that cancer cells excrete more lactate than healthy cells, so we decided to go for lactate, which is a small molecule. If the construct works, it could be modified to respond to other signal molecules.
Preliminary genetic construct:
We talked about what we had found out since last week. Rolf and Jarle had since last week investigated different ways of making a cell lyse, and they found out that genes for lysis are already in this years iGEM kit. Ove and Nina had been investigating toxins, but didn't find as much as they hoped for, but they have however found some toxins. Colisin E1 should be possible to use. They have also sent an email to Pål Fallnes, who Marit Otterlei suggested we could try to get in touch with. Apparently, he has been working quite a lot with expression of toxins in bacteria. Gunvor and Eirin have since last week been trying to find a suitable signal molecule we could detect. Marit Otterlei suggested that we could use HGF, so Eirin and Gunvor did some reasearch around this growth factor. They found out that HGF is the only known lignad to the receptor c-Met, which is a tyrosin kinase. The idea so far is to use this, find out what signaling pathways this receptor is connected to, and find the endpoint of the signaling pathway. We assume that the endpoint is a growth factor possibly regulating a promoter, and if we find such a promoter, this could be set to control the lysis genes. The problem is that we don't know how signals are transducted to bacteria from the exterior, and this proved to be hard to find any information about. But we know that proteins resembling tyrosin kinases called BY kinases exists in bacteria, and also that proteins from eucaryotic cells have sometimes been working in bacteria when introns are removed by using mRNA and reverse transcriptase.
Both in the case of toxins we can express, and a signal molecule we could get our cells to respond to; we need more time. So we decided that Ove and Nina will continue looking for toxins for another week, and Eirin and Gunvor will investigate signal molecules more in depth.
Rahmi have found some possibly useful biobricks, and will be sending references to the biobricks in question to the team by email. Rahmi had also baked a cake for today's meeting:-)
In the case of sponsors, many of the companies we have asked request a budget. Gunvor will try to get hold of this from Eivind, and she will also talk to Merethe Christensen, who is an engineer at dept. of biotechnology, to arrange a safety excursion in the lab, which is necessary before we're allowed to work there.
We also elected Nina as our photo chief:-)
We started continuing our dicussion on which toxins we should make our cells produce. If we manage to make the cells lyse only in the presence of the signaling molecule we chose to go with, it shouldn't mather what the cells produce, but if the system turns out to be leaky, it will be a problem if the toxins we prodce is too toxic. That way we would also kill healthy cells. Also, another problem with too toxic molecules is that we will need a special lab to work with them. So we decided to go for the happy mean. We also discussed the posiibility of making the intracellular concentration of toxins a checkpoint for lysis, so that even if a signal molecule is present, or the cells is experiencing an oxygen deficient environment, they would still not lyse until the concentration of anti cancer molecules is high enough.
We now have three different modules involved in our project; a production part, a detection part and a lysis part. We decided to split in three groups and investigate these modules in depth;
We also decided that we need a PR chief. Rolf volunteered!
We had our first meeting with our new advisor, Marit Otterlei, and we discussed which signal molecule we could use to detect the cancer cells in addition to using the O2 promoter to detect oxygen deficient areas. Prof. Otterlei suggested that we could use the Hepatocyte Growth Factor (abbreviated HGF), which is a growth factor regulating cell growth, cell motility and morphogenesis, that has the ability to bind to a tyrosine kinase. Prof. Otterlei also told us that many toxins can be produced by cells, so we decided to look more at making the cells produce toxins in addition to the ones we've already talked about.
We began this weeks meeting with going through the to-do-list from last meeting.
We discussed the possibility of using adenosine as a signal molecule, but Rhami was sceptical, as he thinks adenosine and ATP are taken up by the cells through passive transport. So that means we might have to look for another signal molecule. Since we have few ideas ourself, we decided to have a meeting early next week instead, and try to get our new advisor Marit Ottelei to attend the meeting, since she might have some ideas.
In the time leading up to the next meeting, Rolf will continue looking for sponsors, and the ones who has time should start looking at different ways to lyse a cell.
We had our weekly meeting. We started by going through what we have done since last week:
We also decided that we should start looking for sponsors. We will submit an application for funds to Programme of Bioinformatics (PBI), and Rolf and Jarle is going to contact VWR, Sigma-Aldrich, and Fisher Scientific.
Eivind reminded us that it is important to come up with an idea for what our genetic construct will actually look like as soon as possible, so we can start the modelling. We decided that we will decide on an idea for a genetic circuit on next meeting, which will be on friday 18.05, at 13:30.
Have a nice weekend:-)
I have been playing around with a wiki design scheme today which can be found here. I hope we can discuss the wiki design a little bit this friday. Also I have been trying to make a calendar solution, but I haven't found any easier or more user-friendly way to implent this than to simply use the default wiki setup. So, at least for now, I think we should just keep using this site the way it is and add updates the way Gunvor did below (and I am doing now) ;) When you have added a new post to a day, you can click the button "Your signature with timestamp" in the editing menu to add your username along with the current time and date.
We had a meeting, and we discussed several things we would like to look more into before we start planning what our genetic circuit will actually look like.
Here is a list of what we decided to do, and who will do it:
- We also decided to have our next meeting at 13:30 next friday, and we decided to eat lunch together on wednesdays
- Rahmi came with a suggestion for characterization of the O2-sensitive promoter:
Gunvor and Rahmi held an introductory lecture to cloning techniques. Gunvor held a crash course in molecular biology, the biobrick concept, and the most common molecular biology techniques, while Rahmi covered more advanced cloning techniques like SLIC and Gibson. If anyone wants more information on for example SLIC and Gibson, google j5 assembly;-)
Today, all the groups from last time started with giving an overview of possible project within their topic. Then we discussed for quite a long time, and in the end we decided we wanted to work with cancer. But we also decided to keep the biosynthesis of fatty acids as a side project. The electricity project turned out to be quite hard to complete in only two months, so we decided to drop it.
Our final project idea is then to make bacteria, for example E.coli cells, produce anti cancer drugs; preferably as many different molecules as possible. We have read about both enzymes and endpoints of metabolic pathways that are disadvantageous for cancer cells. Our engineered cells should also be able to respond to a signal molecule secreted in larger amounts from cancer cells than from normal cells, for example a signaling molecule that promotes angiogenesis. When the cells detect the signal molecule from the cancer cells, they should lyse, releasing the anti cancer molecule close to the tumour. Another approach to reach the tumour could be to take advantage of the fact that the environment inside tumours normally is oxygen deficient. And as E.coli cells naturally migrate towards areas low in oxygen, a possible solution is also to activate the lysis gene when the cells are in an are with little oxygen. Rahmi told us about a promoter that gets activated by low concentration of O2. This could regulate the lysis genes.
For the main project, we have to make the cells lyse at a certain concentration of an outer stimuli. For our side project it could be interresting to do the oposite; making the cells lyse when they have produced a certain amount of fatty acids.
Today, we decided on the overall top three projects for the team. We added the points all the team members have given to the different projects, and the list then becomes as follows:
| Project | Number of points |
|---|---|
| Cancer (search and destroy) | 14 points |
| Biosynthesis of fatty acids | 10 points |
| Bacteria as electrical switch | 6 points |
| Water purification - hormones | 3 points |
| Water purification - sucralose | 1 point |
| Oil spill removing bacteria | 1 point |
| Biomining | 1 point |
We decided to look deeper into the overall top three projects. We formed three groups of two and two, and decided to look at the following things for the next meeting:
The groups:
We also elected Ove as wiki chief:-)
Since we have quite a few project ideas to choose between now, we decided that for next meeting, all team members should pick their three favourite projects. We decided to give our favourite project three points, the project on second place two points, and our third favourite project one point. Before the next meeting we will add all the points together, and se which projects we should look at more in depth. At this meeting, we also discussed activities for Researchers Night. So far we have thought about making a construction kit to make the attendants on RN understand how we can combine different biobricks. We also discussed bringing pipettes, letting the attendants make alginate beads with different colours that they could bring home, and bringing a microscope and coloured cells (harmless, of course).
We kept discussing possible projects, and we now have several projects that would be interresting to work with. Here are the topics we have discussed so far:
We had a meeting, where we started discussing ideas for this year's iGEM project. We also decided to eat lunch together once a week, to get to know one another. For the outreach part of the project, Gunvor suggested that we could collaborate with Studentersamfundet to make a "lørdagsmøte" about synthetic biology.
We had our first meeting, and the team members met each other for the first time!
We recieved emails from Eivind letting us know that we are the ones that have been selected to represent NTNU in iGEM 2012. Everybody is happy!
</div>
"
