Team:Stanford-Brown/Biomining/Harvesting

From 2012.igem.org

Revision as of 02:12, 3 October 2012 by Michelleyu (Talk | contribs)


Harvesting

The FliC gene codes for flagellin, a protein that arranges itself in a hollow cylinder to form the filament of a bacterial flagellum. The N and C termini of flagellin and alpha-helices flanking the termini form the inner core of the filament cylinder (Bergman). The central portion, or “dispensable region,” forms the outer surface of the filament, and is highly variable.

iGEM Team Sloveina 2008 used the FliC gene to design a chimeric fusion protein expressing the antigenic segment of H. pylori on E. coli flagella ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K133038 BBa_K133038]). Our team wanted to use the same flagellar expression mechanism to express metal binding sequences, and our part is an improvement on the Slovenian biobrick. In the process, we designed the FliC gene with a multiple cloning site (MCS) in the dispensable region so that any iGEM team can insert a protein to be expressed in the dispensable region.


Engineered MCS FliC:

FliC construct.001.jpg


BB prefix--[http://partsregistry.org/Part:BBa_J23100 Promoter J23100]--[http://partsregistry.org/Part:BBa_B0030 RBS B0030]--FliC N terminus (528 bp) --[BamHI--AvaII--BglII--HindIII--NdeI--PvuI--SphI--Xmal--SalI]--FliC C terminus (297 bp)--[http://partsregistry.org/Part:BBa_B0015 terminator B0015]--BB suffix


We inserted the following metal-binding sequences into the FliC disposable region: "HTTC" (Cu+2) HNLGMNHDLQGERPYVTEGC -->CATAACCTGGGCATGAACCATGATCTGCAGGGCGAACGCCCGTATGTGACCGAAGGCTGC

"HypB1" (Cu+1) CTTCGCG -->TGCACCACCTGCGGCTGCGGC


"HypB2" (Cu+1) MCTTCGCGEG -->ATGTGCACCACCTGCGGCTGCGGCGAAGGC

HTTC4 - inserted fully HTTC6 - close to perfect insertion (couple of bases off) HTTC8 - inserted fully HTTC9 - inserted fully HTTC10 - close to perfect insertion HypB14 - inserted fully HypB24 - inserted fully HypB24 - inserted fully

Undergoing metal-binding assays now and flagella imaging on SEM.