"
Team:Ehime-Japan/Project
From 2012.igem.org
Principles
Light sensor genes
We utilized the light sensor mechanism in our project. In this page, we explain the mechanism of the original green, red, and green+red light sensor. ・Green light sensor :pJT118, pPLPCB(S)
Ho1 and PcyA synthesize 3z-phycocyanobirin (PCB) depending on ferredoxin (Fd).
When PCB binds to Ccas, It catches light and affects the function of CcaS depending on the wavelength of the light. When the light is green, autophosphorylation of CcaS and phosphate transfer to CcaR increase. When CcaR is phosphorylated, it promotes the transcription from the PcpcG2 promoter. On the other hand, when the receive light is red, it CcaS responds reversely, to cause depression of the PcpcG2 promoter.
In the original system, pPLPCB(S) provide Ho1 and PcyA, and pJT118 provides Ccas and CcaR in addition to the reporter lacZ gene under the control of PcpcG2.We replaced the LacZ gene in pJT118 with the gene coding for a fluorescent protein.
・Red light sensor :pCph8, pJT106b, pPLPCB(S)
Cph8 (a Cph1-EnvZ chimaeras) is expressed from P(LTetO-1) promoter in the phosphorylated ground state.
The Cph1 part of Cph8 is synthesized as the apo from, and holo Cph1 is formed when apo Cph1 ligates PCB.
Holo Cph1 can absorb light. When far red light (705 nm) is absorbed, the rate of phosphotransfer from the EnvZ
domain of Cph8 to OmpR and the affinity of the phosphorylated OmpR (OmpR-P) to the OmpC promoter is increased.
This raises transcription of the cI gene downstream an OmpC promoter. The cI repressor represses transcription of
a lacZ ORF under the control of the Pλ promoter. On the contrary, when red light (650 nm) is absorbed, the rate
of phosphotransfer of the EnvZ part of Cph8 is decreased and less cI is expressed. As a result, the amount of transcription from Pλ promoter is increased.
In most bacteria, ssrA-tagged proteins are degraded by protease. In E.coli, the ssrA t tag has 11-amino acid sequence that is recognized mainly by the ClpXP protease. The tag has been minimized into the three amino acid LVA tag, and this minimum tag is utilized widely in synthetic biology and in iGEM for temporal expression and degradation of stable protein, such as GFP and repressors.
Mycoplasamas, however, do not have the ClpXP protease. The ssrA tag sequences are quite different from those of the other bacteria. It was found that the tag is degraded mainly by the Lon protease in Mesoplasma florum, a Mycoplasma species [1].So, we call the tag “Lon-tag”.
The Lon-tagged proteins of M. florum are efficiently recognized and degraded by the M. florum Lon protease. M. florum Lon does not degrade proteins bearing the E.coli-ssrA tag, and E.coli Lon does not efficiently degrade proteins bearing the M. florum ssrA tag .
In principle, Lon-tagged proteins in E.coli cells should be degraded more rapidly upon induction of the M.florum Lon protease.
Projects
E.co-mail
In order to make a circulatable communication system, we used the green and red light sensor
plasmids: pJT122, pJT106b, and pPLPCB(S). The E.coli having those plasmids expresses lacZ
when the E.coli absorbs the green or red light. First, we constructed the plasmids below.
（ここにplasmid map）
1. Expose one of the E.coli (pJT122, pJT106b, and pPLPCB(S)) in two test tubes to green light.
2. GFP emits by UV (364 nm) and the light is transferred to the other test tube through an
optical fiber.
3. Expose the E.coli to red light.
mf.Lon+LVA tag is expressed and GFP is degraded by the Lon protease.
4. mf.Lon+LVA tag is degraded by ClpX from E.coli
Return to No.1
Finally, we can make an E-mail system by getting this system small!!
E.co-Domino
This project is based on an idea that, if E.coli transformants that emit green light when they catch green light are placed along a line on an agar plate, and if the end is activated with UV or blue light so that it emit green light, it would look like domino toppling with the green light moving along the line toward the other end. We planned to construct this light transfer system by using the red and green light sensor systems, the light receptor PCB catches light and activate transcription of a specific promoter upstream the lacZ reporter gene. So, we replaced the lacZ gene with the sequences coding for GFP and RFP. We are trving to draw a movie of a firework that goes upward and bursts scattering light-emitting pieces.
The basic green light sensor needs two plasmids.pPLPCB provides a light-sensing molecule that binds to CcaS molecule. pJT118 harbors the genes for CcaS and CcaR and the reporter lacZ gene under the control of the PcpcG2 promoter. CcaS activates PcpcG2,when the light-sensing molecule catches green light, by activating phosphorylation of CcaR. We will substitute the lacZ gene with the GFP gene. Therefore, our green sensor should produce GFP in reaponse to green light. We will draw, with E coli harboring pPLPCB and the GFP-substituted pJT118,a picture of a trajectory of a rising firework on an ager plate, and will “fire”with a pilot light at the bottom. Under the blue LED light(or weak UV light),the bottom part of the picture should begin to emit green light that should activate the neighboring bacteria.
Because the GFP has a degradation tag, the emission will stop soon. It is exposed that, as a result, the green light will move upward along the trajectory until it reaches the top. At the top, we put E.coli with pPLPCB and an RFP-substituted pJT118.This will sense the green light coming from the neighboring bacteria and emit red light. At the last, we put E.coli with pPLPCB and an RFP-substituted pJT106b. This will sense the red light coming from the neighboring bacteria and emit red light.
=== Part 2 ===
pJT118 harbors the lacZ reporter gene in addition to the green sensor components. So, we replaced the lacZ sequence with the DNA coding for GFP.pJT106b contains the sequence for the lacZ reporter for the red light sensor. So, we replaced it with the gene for RFP. We also construct a pJT118 derivative containing the RFP gene. With these plasmids, we believe that we could draw movie pictures on an ager plate canvas. Our first one would be that of a firework in which a ball of green light would go straight upward and burst, scattering lines of red light.
The data for the plasmid construction experiments are shown below.
1.We amplified a sequence in pJT118 spanning almost all of the plasmid except the region of the lacZ ORF, by PCR with KOD Fx Neo. (using the primers GCGGCCGCTCGAGTCTAATTTTTTTG and ATCTATCATAGATAAAGTTAGTAATTAAAC). The 5780bp fragment was obtained and gel-purified. 2.We amplified the sequence of the GFP ORF from BioBrick(BBa-E0040) using the primers CTTTATCTATGATAGATATGCGTAAAGGAGAAGAACTT and GACCTGAGCGGCCGCTTTGTATAGTTCATCCATGCCAT.The 750bp fragment was gel-purified. 3.We put the fragment from 1and2 together by the InFusion svstem (Clontech). The miniprep plasmid sample from acolony was checked by agarose gel electrophoresis (Figure1,the middlelabeled as118+GFP). The other plasmids were constructed in almost the same way, and checked on agarose gels (Figures 1and 2).
Degradation system
[1] Gur, E. and Suer, R. T. (2008) Proc. Natl. Acad. Sci. USA, 105, 16113-16118.
Evolution of the ssrA degradation tag in Mycoplasma: Specificity switch to a different protease.
We replaced the lacZ of pJT122 with GFP＋ssrA tag (mf. lon) and the lacZ of pJT106b with
mf.Lon+LVA. As a result, GFP＋ssrA tag is synthesized when the E.coli is exposed green light
and mf.Lon+LVA is expressed by red light. This mechanism is shown next.
↓
The E.coli exposed to green light expresses GFP＋ssrA tag.
↓
The other E.coli receives the green light and expresses GFP too.
Furthermore, the circulatable system will go well by the two degradation system because those are independent each other. In detail…(ここでDegradation system にとぶ)
Let's make toppling dominoes with E.coli
Firework mechanism (using domino system)
=== The Experiments ===
Eco-Domino
Plasmid construction
figur1
figur4
figur5
fig1:center is 118+GFP right is 118+RFP fig2 thirdline is 106b+RFP fig3 plasmid of 118+GFP fig4 plasmid of 118+RFP fig5 plasmid of 106b+RFP
Results
E.co-Domino
・The function of light sensor
In order to confirm if the light sensor system normally works, the control experiment (shown on
Table1) were carried out.
We transformed the plasmids into JT2 (ΔEnvZ strain) and picked up an individual colony to put into
liquid medium. Shaking incubate on 37℃ was continued for 42 hours. We expected that the E.coli under white light will express GFP or RFP, and on the other hand, the E.coli under Dark will not express them. Unfortunately, we were not able to watch that the E.coli having pJT118 (GFP and RFP) worked.
We wanted to try to find the best condition for GFP or RFP expression (green sensor), but time was running out, so we decided to use the red light sensor only for our project.
Under white light (42 hours)
Dark (42 hours)
pJT118 (GFP), pPLPCB(S)
No change
No change
pJT118 (RFP), pPLPCB(S)
No change
No change
pJT106b (RFP), pCph8, pPLPCB(S)
RFP was expressed
RFP was expressed
Purpose: search condition that expression of RFP by red light sensor
We used JT2 transformde plasmids(106b+RFP,cph8,pPLPCB) shaking incubate on37℃ 16 hours exposing white light. And it centrifuge, sprinkle M9 plate and incubate 24hours by three conditions (room temperature ).
1, red light
2, white light
3, dark
Result→ all condition expressed
Purpose: measure time until activate red light sensor by RFP light.
We use JT2 transformed the plasmids(106b+RFP,cph8,pPLPCB). Shaking incubate on 37℃was constituted for 12 hours. Centrifuge, remove buffer(LB), added 100μℓbuffer(MQ). Put micro plate. And we observed E.coli. We try this experiment two condition.
1,exposing UV
2,Dark
Result
=== The Experiments ===
E.cold-heat Sensing System
・Heat Shock Sensor
This is a sensor that RFP is expressed by particular temperature. We made two plasmids. One produces signaling molecule, the other receives the signaling molecule. The plasmids that produces signaling molecule have heat shock promoter(HSP). Transcription of luxI gene is regulated by a HSP. LuxI produces OHHL(3OC6HSL). The other plasmid has Ptet promoter and transcription of the luxR gene is constitutively regulated by the promoter. The luxR protein binds to OHHL and upregulated the luxpR promoter, causing transcription of the mCherry reporter. ・Cold Shock Sensor
This is a sensor that GFP is expressed by particular temperature. The sensor also consists two plasmids. The plasmids that produces signaling molecule have cold shock promoter(CSP). Transcription of lasI gene is regulated by a CSP. LasR produces 3OC12-HSL. The other plasmid has constitutive promoter, transcription of the lasR gene is regulated by the promoter. The lasR protein binds to 3OC12-HSL and upregulated the laspR promoter, causing transcription of the GFP.
'''Heat Shock Sensor'''
PlasmidⅠ (Fig.1） was made for BBa_K338081 and BBa_C0261 by ligation.
'''Cold Shock Sensor'''
PlasmidⅡ(Fig.1 BBa_K794000) was made for BBa_S03878 and BBa_K328001 by ligation.
And we had to replace origin(rep(pMB1)) of PlasmidⅡ origin(p15A) of pPLPCB(S) by infusion.
PlasmidⅣ (Fig.1) was made for BBa_S03878 and BBa_K328001 by twice infusion (primer list 1～5).
