"
Team:Ehime-Japan/Project
From 2012.igem.org
| Home | Team | Official Team Profile | Project | Parts Submitted to the Registry | Modeling | Notebook | Safety | Attributions |
|---|
Contents |
Principles
・Light sensor genes Light sensor We utilized the light sensor mechanism in our project. In this page, we explain the mechanism of the original green light sensor.
Hol1 and PcyA synthesize 3z-phycocyanobirin(PCB) depending on ferredoxin(Fd).
When PCP binds to Ccas, It catches light and affects the function of CcaS depending on the wavelength of the light. When the light is green, autophosphorylation of CcaS and phosphate transfer to CcaR increase. When CcaR is phosphorylated, it promotes the transcription from the PcpcG2 promoter. On the other hand, when the receive light is red, it CcaS respondsreversely, to cause depression of the PcpcG2 promoter.
In the original system, pPLPCB(S) provide Ho1 and PcyA, and pJT118 provides Ho1 and pJT118 provides CcaS and CcaR in addition to the reporter lacZ gene in pJT118 with the gene coding for a fluorescent protein.</>
・Degradation system
Project
<p>This project is based on an idea that, if E.coli transformants that emit green light when they catch green light are placed along a line on an agar plate, and if the end is activated with UV or blue light so that it emit green light, it would look like domino toppling with the green light moving along the line toward the other end. We planned to construct this light transfer system by using the red and green light sensor systems, the light receptor PCB catches light and activate transcription of a specific promoter upstream the lacZ reporter gene. So, we replaced the lacZ gene with the sequences coding for GFP and RFP.</p>
Because the GFP has a degradation tag, the emission will stop soon. It is exposed that, as a result, the green light will move upward along the trajectory until it reaches the top.</p>
<p>At the last, we put E.coli with pPLPCB and an RFP-substituted pJT106b. This will sense the red light coming from the neighboring bacteria and emit red light. </p>
<p>Plasmid construction
1,We amplified a sequence in pJT118 spanning almost all of the plasmid except the region of the lacZ ORF, by PCR with KOD Fx Neo. (using the primers GCGGCCGCTCGAGTCTAATTTTTTTGandATCTATCATAGATAAAGTTAGTAATTAAAC ). The 5780bp fragment was obtained and gel-purified. </p>
<p>2,We amplified the sequence of the GFP ORF from BioBrick using the primers CTTTATCTATGATAGATATGCGTAAAGGAGAAGAACTT and GACCTGAGCGGCCGCTTTGTATAGTTCATCCATGCCAT.The 750bp fragment was gel-purified.</p>
<p>3,We put the fragment from 1and2 together by the InFusion svstem(Clontech). The miniprep plasmid sample from acolony was checked by agarose gel electrophoresis(Figure1,the middlelabeled as118+GFP). The other plasmids were constructed in almost the same way, and checked on agarose gels (Figures 1and 2).</p>
</p>
== Results == Project Details
Let's make toppling dominoes with E.coli
Firework mechanism(using domino system)
<p>We are trving to draw a movie of a firework that goes upward and bursts scattering light-emitting pieces.
The basic green light sensor needs two plasmids.pPLPCB provides a light-sensing molecule that binds to CcaS molecule. pJT118 harbors the genes for CcaS and CcaR and the reporter lacZ gene under the control of the PcpcG2 promoter. CcaS activates PcpcG2,when the light-sensing molecule catches green light, by activating phosphorylation of CcaR. We will substitute the lacZ gene with the GFP gene. Therefore, our green sensor should produce GFP in reaponse to green light.</p>
<p>We will draw, with E coli harboring pPLPCB and the GFP-substituted pJT118,a picture of a trajectory of a rising firework on an ager plate, and will “fire”with a pilot light at the bottom. Under the blue LED light(or weak UV light),the bottom part of the picture should begin to emit green light that should activate the neighboring bacteria.
<p>At the top, we put E.coli with pPLPCB and an RFP-substituted pJT118.This will sense the green light coming from the neighboring bacteria and emit red light.</p>
Part 2
The Experiments
Eco-Domino
<p>pJT118 harbors the lacZ reporter gene in addition to the green sensor components. So, we replaced the lacZ sequence with the DNA coding for GFP.pJT106b contains the sequence for the lacZ reporter for the red light sensor. So, we replaced it with the gene for RFP. We also construct a pJT118 derivative containing the RFP gene.</p>
<p>With these plasmids, we believe that we could draw movie pictures on an ager plate canvas. Our first one would be that of a firework in which a ball of green light would go straight upward and burst, scattering lines of red light.
The data for the plasmid construction experiments are shown below.</p>
figur1 https://2012.igem.org/File:P1000457.JPG
figur2 https://2012.igem.org/File:9.7_EP.JPG
<p>Primer List
106b
TTCGGAGGAAGCCATCTCTAGTATTTCTCCTCTTTCTCCA
ACCGGTGCTTAATAAGCGGCCGCTCGAGTCTAATACTAGAGCC
RFP
CTTTATCTATGATAGATATGGCTTCCTCCGAAGACGTTATCA
GACCTGAGCGGCCGCTTATTAAGCACCGGTGGAGTGACTGACGA
GFP
CTTTATCTATGATAGATATGCGTAAAGGAGAAGAACTT
GACCTGAGCGGCCGCTTTGTATAGTTCATCCATGCCAT
pJT118
GCGGCCGCTCGAGTCTAATTTTTTTG
ATCTATCATAGATAAAGTTAGTAATTAAA
Part 3
