|
|
Line 33: |
Line 33: |
| [[Image:TUM12 PCB synthesis.jpg|thumb|right|300px|Biosynthesis of phycocyanobilin and phytochromobilin. Heme oxygenase (HO1) catalyzes the conversion of heme to biliverdin IXα (BV). Subsequently, BV is reduced by phycocyanobilin/ferredoxin oxidoreductase (PcyA) in cyanobacteria or PΦB synthase (HY2) in plants to produce PCB or PΦB, respectively. ApoCph1 is capable of autocatalytically binding either of these chromophores to form a holoCph1 protein in the red-light-absorbing Pr form.[http://www.pnas.org/content/98/19/10566/F1.expansion.html]]] | | [[Image:TUM12 PCB synthesis.jpg|thumb|right|300px|Biosynthesis of phycocyanobilin and phytochromobilin. Heme oxygenase (HO1) catalyzes the conversion of heme to biliverdin IXα (BV). Subsequently, BV is reduced by phycocyanobilin/ferredoxin oxidoreductase (PcyA) in cyanobacteria or PΦB synthase (HY2) in plants to produce PCB or PΦB, respectively. ApoCph1 is capable of autocatalytically binding either of these chromophores to form a holoCph1 protein in the red-light-absorbing Pr form.[http://www.pnas.org/content/98/19/10566/F1.expansion.html]]] |
| As described phycocyanobilin is a essential chromophore for a functional phytochrome B. PCB can be synthesized in two steps from heme. First, heme is converted to biliverdin IXα (BV) and second, BV is converted to 3Z-phycocyanobilin (PCB). | | As described phycocyanobilin is a essential chromophore for a functional phytochrome B. PCB can be synthesized in two steps from heme. First, heme is converted to biliverdin IXα (BV) and second, BV is converted to 3Z-phycocyanobilin (PCB). |
- |
| |
- |
| |
- |
| |
- | ====Converting heme to biliverdin IXα====
| |
- |
| |
- | '''HO1'''[http://partsregistry.org/wiki/index.php?title=Part:BBa_I15008] from Synechocystis oxidizes the heme group using a ferredoxin cofactor, generating biliverdin IXα.
| |
- | <code>
| |
- | 1 atgagtgtca acttagcttc ccagttgcgg gaagggacga aaaaatccca ctccatggcg
| |
- | 61 gagaacgtcg gctttgtcaa atgcttcctc aagggcgttg tcgagaaaaa ttcctaccgt
| |
- | 121 aagctggttg gcaatctcta ctttgtctac agtgccatgg aagaggaaat ggcaaaattt
| |
- | 181 aaggaccatc ccatcctcag ccacatttac ttccccgaac tcaaccgcaa acaaagccta
| |
- | 241 gagcaagacc tgcaattcta ttacggctcc aactggcggc aagaagtgaa aatttctgcc
| |
- | 301 gctggccaag cctatgtgga ccgagtccgg caagtggccg ctacggcccc tgaattgttg
| |
- | 361 gtggcccatt cctacacccg ttacctgggg gatctttccg gcggtcaaat tctcaagaaa
| |
- | 421 attgcccaaa atgccatgaa tctccacgat ggtggcacag ctttctatga atttgccgac
| |
- | 481 attgatgacg aaaaggcttt taaaaatacc taccgtcaag ctatgaatga tctgcccatt
| |
- | 541 gaccaagcca ccgccgaacg gattgtggat gaagccaatg acgcctttgc catgaacatg
| |
- | 601 aaaatgttca acgaacttga aggcaacctg atcaaggcga tcggcattat ggtgttcaac
| |
- | 661 agcctcaccc gtcgccgcag tcaaggcagc accgaagttg gcctcgccac ctccgaaggc
| |
- | 721 taataa
| |
- |
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Heme Oxygenase 1 || 726bp || ok || ok || 1AS<10% || [http://www.ncbi.nlm.nih.gov/nuccore/4105612 AF048758.1]
| |
- | |}
| |
- |
| |
- | <pre style="color:green">Available in Registry: BBa_I15008</pre>
| |
- |
| |
- |
| |
- | '''HMX1'''[http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=S000004195], an endogenous ER localized heme oxygenase, is only expressed under iron starvation and oxidative stress; relocates to the perinuclear region in the presence of oxidants.
| |
- | Forbidded restriction sites: EcoRI (1x)
| |
- | Two possibile solution for introducing silent mutations:
| |
- | * Mutation of GAA (codon usage: 45.6%) to GAG (codon usage: 19.2%), both coding synonymously for gluatmic acid.
| |
- | * Mutation of TTC (codon usage: 28.4%) to TTT (codon usage: 26.1%), both conding synonymousy for phenylalanin.
| |
- | Latter one should be performed as a result of condon usage!
| |
- |
| |
- | Coding sequence:
| |
- | <code>
| |
- | >YLR205C (954 bp)
| |
- | 1 atggaggaca gtagcaatac aatcataccc tcacccactg acgtgggggc gctagcaaac
| |
- | 61 agaatcaact ttcaaaccag agatgcccac aataaaatca ataccttcat gggcataaag
| |
- | 121 atggccatcg ccatgagaca tggctttata tacagacagg gtattctggc gtactattat
| |
- | 181 gtgttcgatg ccatcgagca agagatagat cgcctactga atgaccccgt aacggaggag
| |
- | 241 gagctgcaaa cttcgaccat tctgaagcag ttttggctcg aagattttag aagatctacg
| |
- | 301 cagatctata aggacctgaa gctgctatac tcaaacacgt ttaaaagcac agaatcatta
| |
- | 361 aacgaattcc tggctacgtt ccagaagcca ccgctactac agcagtttat caataacatc
| |
- | 421 cacgaaaaca tacacaagga gccatgcacc attctttctt actgtcacgt tctgtacttg
| |
- | 481 gcgcttttcg ccggcggcaa gctaatacga tcgaatttgt acagaagact ggggctcttc
| |
- | 541 cccaacttcg agaagctatc acagaaggaa ctggtcaaaa agggcacaaa cttcttcacc
| |
- | 601 ttcagcgatc tgggtcccac tgaagaaaca cgcttgaaat gggaatacaa gaagaactat
| |
- | 661 gagctggcca ccaggacgga attgaccgaa gcacaaaagt tgcagatcat tagcgtcgca
| |
- | 721 gaaggcattt ttgattggaa cttcaacatc gttgcagaaa ttggagagtt gaatcgtcgc
| |
- | 781 gagttaatgg gcaagttcag cttcaagtgt attacgtact tgtacgaaga atggatgttc
| |
- | 841 aacaaggatt ctgctactag aagagcactc cacacggtca tgctgctggt gctttctatt
| |
- | 901 atcgcgatct gggttcttta cttcttggta aagagttttc ttagcatagt ataa
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 ||Codon Usage || NCBI
| |
- | |-
| |
- | | Heme-binding protein HMX1 || 954 bp || 1x EcoRI (364-370) || 1x NgoMIV (490-496) ||0AS<10% || [http://www.ncbi.nlm.nih.gov/nuccore/296146742 NM_001182092.1]
| |
- | |}
| |
- |
| |
- | ====Converting biliverdin IXα to phycocyanobilin B====
| |
- |
| |
- | Codon optimized '''PcyA'''[http://partsregistry.org/wiki/index.php?title=Part:BBa_K181000 ] (derived from cyanobacteria) which converts biliverdin IXα (BV) into 3Z-phycocyanobilin B(PCB).
| |
- | <code>
| |
- | >BBa_K181000 Part-only sequence (750 bp)
| |
- | atggccgttaccgatttgagtttgaccaattcctccttgatgccaaccttaaaccctatgattcaacaattggctttggctattgctgcttcctggcaat
| |
- | ctttgcctttgaaaccatatcaattgcctgaagatttgggttatgtcgaaggtagattagaaggtgaaaaattggttatcgaaaacagatgctatcaaac
| |
- | cccacaattcagaaaaatgcacttggaattggctaaagtcggtaaaggtttagacatcttacactgtgtcatgttccctgaaccattgtatggtttacca
| |
- | ttattcggttgtgacatcgttgctggtcctggtggtgtctctgctgccattgccgatttgtctccaacacaatccgatagacaattgcctgctgcctatc
| |
- | aaaaatccttggccgaattgggtcaaccagaatttgaacaacaaagagaattgcctccttggggtgaaattttctccgaatattgtttgttcattagacc
| |
- | atccaacgtcaccgaagaagaaagattcgtccaaagagttgtcgacttcttacaaatccactgccaccaatccatcgtagccgaaccattatccgaagct
| |
- | caaacattggaacacagacaaggtcaaatccattattgccaacaacaacaaaaaaacgacaagactagaagagttttggaaaaggctttcggtgaagctt
| |
- | gggccgaaagatatatgtcccaagttttattcgacgtcattcaatgatga
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Ferredoxin-dependent bilin reductase || 750 bp || ok || ok || 0AS<10% || [http://www.ncbi.nlm.nih.gov/protein/ABW30269.1 ABW30269.1]
| |
- | |}
| |
- |
| |
- | <pre style="color:red">Unverified in Registry</pre>
| |
- |
| |
- | ===PhyB-GAL4BD/PhyB-LexA===
| |
- | ====PhyB-GAL4BD====
| |
- | The chimeric PhyB-GAL4BD[http://partsregistry.org/Part:BBa_K207001] (nuclear localization signal included) contains the light-dependant PhyB part, performing a (far-)red-light induced (Z/E)E/Z-isomerization, and the DNA-binding domain of the transcriptionfactor GAL4. Active conformer of PhyB binds to Pif3 which is fused to the transcription activation domain of GAL4. As a result transcription is started by red-light and stopped by far-red light.
| |
- | <code>
| |
- | >BBa_K207001 Part-only sequence (2303 bp)
| |
- | atggtttccggagtcgggggtagtggcggtggccgtggcggtggccgtggcggagaagaagaaccgtcgtcaagtcacactcctaataaccgaagaggag
| |
- | gagaacaagctcaatcgtcgggaacgaaatctctcagaccaagaagcaacactgaatcaatgagcaaagcaattcaacagtacaccgtcgacgcaagact
| |
- | ccacgccgttttcgaacaatccggcgaatcagggaaatcattcgactactcacaatcactcaaaacgacgacgtacggttcctctgtacctgagcaacag
| |
- | atcacagcttatctctctcgaatccagcgaggtggttacattcagcctttcggatgtatgatcgccgtcgatgaatccagtttccggatcatcggttaca
| |
- | gtgaaaacgccagagaaatgttagggattatgcctcaatctgttcctactcttgagaaacctgagattctagctatgggaactgatgtgagatctttgtt
| |
- | cacttcttcgagctcgattctactcgagcgtgctttcgttgctcgagagattaccttgttaaatccggtttggatccattccaagaatactggtaaaccg
| |
- | ttttacgccattcttcataggattgatgttggtgttgttattgatttagagccagctagaactgaagatcctgcgctttctattgctggtgctgttcaat
| |
- | cgcagaaactcgcggttcgtgcgatttctcagttacaggctcttcctggtggagatattaagcttttgtgtgacactgtcgtggaaagtgtgagggactt
| |
- | gactggttatgatcgtgttatggtttataagtttcatgaagatgagcatggagaagttgtagctgagagtaaacgagacgatttagagccttatattgga
| |
- | ctgcattatcctgctactgatattcctcaagcgtcaaggttcttgtttaagcagaaccgtgtccgaatgatagtagattgcaatgccacacctgttcttg
| |
- | tggtccaggacgataggctaactcagtctatgtgcttggttggttctactcttagggctcctcatggttgtcactctcagtatatggctaacatgggatc
| |
- | tattgcgtctttagcaatggcggttataatcaatggaaatgaagatgatgggagcaatgtagctagtggaagaagctcgatgaggctttggggtttggtt
| |
- | gtttgccatcacacttcttctcgctgcataccgtttccgctaaggtatgcttgtgagtttttgatgcaggctttcggtttacagttaaacatggaattgc
| |
- | agttagctttgcaaatgtcagagaaacgcgttttgagaacgcagacactgttatgtgatatgcttctgcgtgactcgcctgctggaattgttacacagag
| |
- | tcccagtatcatggacttagtgaaatgtgacggtgcagcatttctttaccacgggaagtattacccgttgggtgttgctcctagtgaagttcagataaaa
| |
- | gatgttgtggagtggttgcttgcgaatcatgcggattcaaccggattaagcactgatagtttaggcgatgcggggtatcccggtgcagctgcgttagggg
| |
- | atgctgtgtgcggtatggcagttgcatatatcacaaaaagagactttcttttttggtttcgatctcacactgcgaaagaaatcaaatggggaggcgctaa
| |
- | gcatcatccggaggataaagatgatgggcaacgaatgcatcctcgttcgtcctttcaggcttttcttgaagttgttaagagccggagtcagccatgggaa
| |
- | actgcggaaatggatgcgattcactcgctccagcttattctgagagactcttttaaagaatct
| |
- |
| |
- | end of PhyB match,
| |
- | begin of GAL4 match
| |
- | atgaagctactgtcttctatcgaacaagcatgcgata
| |
- | tttgccgacttaaaaagctcaagtgctccaaagaaaaaccgaagtgcgccaagtgtctgaagaacaactgggagtgtcgctactctcccaaaaccaaaag
| |
- | gtctccgctgactagggcacatctgacagaagtggaatcaaggctagaaagactggaacagctatttctactgatttttcctcgagaagaccttgacatg
| |
- | attttgaaaatggattctttacaggatataaaagcattgttaacaggattatttgtacaagataatgtgaataaagatgccgtcacagatagattggctt
| |
- | cagtggagactgatatgcctctaacattgagacagcatagaataagtgcgacatcatcatcggaagagagtagtaacaaaggtcaaagacagttgactgt
| |
- | atc
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25|| Codon Usage || NCBI
| |
- | |-
| |
- | | PhyB-DBD Fusion || 2303bp || ok || ok || 2AS < 10 % || PhyB:[http://www.ncbi.nlm.nih.gov/nuccore/X17342.1 X17342.1] (partial match) GAL4:[http://www.ncbi.nlm.nih.gov/nuccore/NM_001184062.1 NM_001184062.1] (partial match)
| |
- | |}
| |
- |
| |
- | <pre style="color:red"> Unverified in Registry, '''NOT DIVISIBLE BY 3''' </pre>
| |
- |
| |
- | ====PhyB====
| |
- | It seems that only the ~650 N-terminal amino acids are essential for the function of the light-sensitive phytochrome B.
| |
- |
| |
- | PhyB (First 908 N-terminal residues)[http://partsregistry.org/Part:BBa_K365002]
| |
- | <code>
| |
- | >BBa_K365002 Part-only sequence (2724 bp)
| |
- | atggtttccggagtcgggggtagtggcggtggccgtggcggtggccgtggcggagaagaagaaccgtcgtcaagtcacactcctaataaccgaagaggag
| |
- | gagaacaagctcaatcgtcgggaacgaaatctctcagaccaagaagcaacactgaatcaatgagcaaagcaattcaacagtacaccgtcgacgcaagact
| |
- | ccacgccgttttcgaacaatccggcgaatcagggaaatcattcgactactcacaatcactcaaaacgacgacgtacggttcctctgtacctgagcaacag
| |
- | atcacagcttatctctctcgaatccagcgaggtggttacattcagcctttcggatgtatgatcgccgtcgatgaatccagtttccggatcatcggttaca
| |
- | gtgaaaacgccagagaaatgttagggattatgcctcaatctgttcctactcttgagaaacctgagattctagctatgggaactgatgtgagatctttgtt
| |
- | cacttcttcgagctcgattctactcgagcgtgctttcgttgctcgagagattaccttgttaaatccggtttggatccattccaagaatactggtaaaccg
| |
- | ttttacgccattcttcataggattgatgttggtgttgttattgatttagagccagctagaactgaagatcctgcgctttctattgctggtgctgttcaat
| |
- | cgcagaaactcgcggttcgtgcgatttctcagttacaggctcttcctggtggagatattaagcttttgtgtgacactgtcgtggaaagtgtgagggactt
| |
- | gactggttatgatcgtgttatggtttataagtttcatgaagatgagcatggagaagttgtagctgagagtaaacgagacgatttagagccttatattgga
| |
- | ctgcattatcctgctactgatattcctcaagcgtcaaggttcttgtttaagcagaaccgtgtccgaatgatagtagattgcaatgccacacctgttcttg
| |
- | tggtccaggacgataggctaactcagtctatgtgcttggttggttctactcttagggctcctcatggttgtcactctcagtatatggctaacatgggatc
| |
- | tattgcgtctttagcaatggcggttataatcaatggaaatgaagatgatgggagcaatgtagctagtggaagaagctcgatgaggctttggggtttggtt
| |
- | gtttgccatcacacttcttctcgctgcataccgtttccgctaaggtatgcttgtgagtttttgatgcaggctttcggtttacagttaaacatggaattgc
| |
- | agttagctttgcaaatgtcagagaaacgcgttttgagaacgcagacactgttatgtgatatgcttctgcgtgactcgcctgctggaattgttacacagag
| |
- | tcccagtatcatggacttagtgaaatgtgacggtgcagcatttctttaccacgggaagtattacccgttgggtgttgctcctagtgaagttcagataaaa
| |
- | gatgttgtggagtggttgcttgcgaatcatgcggattcaaccggattaagcactgatagtttaggcgatgcggggtatcccggtgcagctgcgttagggg
| |
- | atgctgtgtgcggtatggcagttgcatatatcacaaaaagagactttcttttttggtttcgatctcacactgcgaaagaaatcaaatggggaggcgctaa
| |
- | gcatcatccggaggataaagatgatgggcaacgaatgcatcctcgttcgtcctttcaggcttttcttgaagttgttaagagccggagtcagccatgggaa
| |
- | actgcggaaatggatgcgattcactcgctccagcttattctgagagactcttttaaagaatctgaggcggctatgaactctaaagttgtggatggtgtgg
| |
- | ttcagccatgtagggatatggcgggggaacaggggattgatgagttaggtgcagttgcaagagagatggttaggctcattgagactgcaactgttcctat
| |
- | attcgctgtggatgccggaggctgcatcaatggatggaacgctaagattgcagagttgacaggtctctcagttgaagaagctatggggaagtctctggtt
| |
- | tctgatttaatatacaaagagaatgaagcaactgtcaataagcttctttctcgtgctttgagaggggacgaggaaaagaatgtggaggttaagctgaaaa
| |
- | ctttcagccccgaactacaagggaaagcagtttttgtggttgtgaatgcttgttccagcaaggactacttgaacaacattgtcggcgtttgttttgttgg
| |
- | acaagacgttacgagtcagaaaatcgtaatggataagttcatcaacatacaaggagattacaaggctattgtacatagcccaaaccctctaatcccgcca
| |
- | atttttgctgctgacgagaacacgtgctgcctggaatggaacatggcgatggaaaagcttacgggttggtctcgcagtgaagtgattgggaaaatgattg
| |
- | tcggggaagtgtttgggagctgttgcatgctaaagggtcctgatgctttaaccaagttcatgattgtattgcataatgcgattggtggccaagatacgga
| |
- | taagttccctttcccattctttgaccgcaatgggaagtttgttcaggctctattgactgcaaacaagcgggttagcctcgagggaaaggttattggggct
| |
- | ttctgtttcttgcaaatcccgagc
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25|| Codon Usage || NCBI
| |
- | |-
| |
- | | PhyB part || 2724bp || ok || ok || 3AS<10% || [http://www.ncbi.nlm.nih.gov/nuccore/X17342.1 X17342.1] (partial match)
| |
- | |}
| |
- |
| |
- | PhyB (First 642 N-terminal residues)[http://partsregistry.org/Part:BBa_K365003]
| |
- | <code>
| |
- | >BBa_K365003 Part-only sequence (1926 bp)
| |
- | atggtttccggagtcgggggtagtggcggtggccgtggcggtggccgtggcggagaagaagaaccgtcgtcaagtcacactcctaataaccgaagaggag
| |
- | gagaacaagctcaatcgtcgggaacgaaatctctcagaccaagaagcaacactgaatcaatgagcaaagcaattcaacagtacaccgtcgacgcaagact
| |
- | ccacgccgttttcgaacaatccggcgaatcagggaaatcattcgactactcacaatcactcaaaacgacgacgtacggttcctctgtacctgagcaacag
| |
- | atcacagcttatctctctcgaatccagcgaggtggttacattcagcctttcggatgtatgatcgccgtcgatgaatccagtttccggatcatcggttaca
| |
- | gtgaaaacgccagagaaatgttagggattatgcctcaatctgttcctactcttgagaaacctgagattctagctatgggaactgatgtgagatctttgtt
| |
- | cacttcttcgagctcgattctactcgagcgtgctttcgttgctcgagagattaccttgttaaatccggtttggatccattccaagaatactggtaaaccg
| |
- | ttttacgccattcttcataggattgatgttggtgttgttattgatttagagccagctagaactgaagatcctgcgctttctattgctggtgctgttcaat
| |
- | cgcagaaactcgcggttcgtgcgatttctcagttacaggctcttcctggtggagatattaagcttttgtgtgacactgtcgtggaaagtgtgagggactt
| |
- | gactggttatgatcgtgttatggtttataagtttcatgaagatgagcatggagaagttgtagctgagagtaaacgagatgatttagagccttatattgga
| |
- | ctgcattatcctgctactgatattcctcaagcgtcaaggttcttgtttaagcagaaccgtgtccgaatgatagtagattgcaatgccacacctgttcttg
| |
- | tggtccaggacgataggctaactcagtctatgtgcttggttggttctactcttagggctcctcatggttgtcactctcagtatatggctaacatgggatc
| |
- | tattgcgtctttagcaatggcggttataatcaatggaaatgaagatgatgggagcaatgtagctagtggaagaagctcgatgaggctttggggtttggtt
| |
- | gtttgccatcacacttcttctcgctgcataccgtttccgctaaggtatgcttgtgagtttttgatgcaggctttcggtttacagttaaacatggaattgc
| |
- | agttagctttgcaaatgtcagagaaacgcgttttgagaacgcagacactgttatgtgatatgcttctgcgtgactcgcctgctggaattgttacacagag
| |
- | tcccagtatcatggacttagtgaaatgtgacggtgcagcatttctttaccacgggaagtattacccgttgggtgttgctcctagtgaagttcagataaaa
| |
- | gatgttgtggagtggttgcttgcgaatcatgcggattcaaccggattaagcactgatagtttaggcgatgcggggtatcccggtgcagctgcgttagggg
| |
- | atgctgtgtgcggtatggcagttgcatatatcacaaaaagagactttcttttttggtttcgatctcacactgcgaaagaaatcaaatggggaggcgctaa
| |
- | gcatcatccggaggataaagatgatgggcaacgaatgcatcctcgttcgtcctttcaggcttttcttgaagttgttaagagccggagtcagccatgggaa
| |
- | actgcggaaatggatgcgattcactcgctccagcttattctgagagactcttttaaagaatctgaggcggctatgaactctaaagttgtggatggtgtgg
| |
- | ttcagccatgtagggatatggcgggg
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | PhyB essential || 1926bp || ok || ok || 2AS<10% || [http://www.ncbi.nlm.nih.gov/nuccore/X17342.1 X17342.1] (partial match)
| |
- | |}
| |
- |
| |
- | ====GAL4BD====
| |
- |
| |
- | The DNA-binding domain of GAL4 (GAL4BD)[http://partsregistry.org/Part:BBa_J176020][http://partsregistry.org/Part:BBa_K364319] recognizes a special upstream activating sequence (UAS). By fusing this protein to Pif3, GAL4BD can be indirectly recruited by PhyB-GAL4BD after red light exposition.
| |
- | <code>
| |
- | >BBa_J176020 Part-only sequence (459 bp)
| |
- | atgaagctactgtcttctatcgaacaagcatgcgatatttgccgacttaaaaagctcaagtgctccaaagaaaaaccgaagtgcgccaagtgtctgaaga
| |
- | acaactgggagtgtcgctactctcccaaaaccaaaaggtctccgctgactagggcacatctgacagaagtggaatcaaggctagaaagactggaacagct
| |
- | atttctactgatttttcctcgagaagaccttgacatgattttgaaaatggattctttacaggatataaaagcattgttaacaggattatttgtacaagat
| |
- | aatgtgaataaagatgccgtcacagatagattggcttcagtggagactgatatgcctctaacattgagacagcatagaataagtgcgacatcatcatcgg
| |
- | aagagagtagtaacaaaggtcaaagacagttgactgtatcgccggaatttccggggatc
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Binding-domain of DNA-binding transcription factor GAL4 || 459bp || ok || ok || 0 AS < 10% || [http://www.ncbi.nlm.nih.gov/nuccore/NM_001184062.1 NM_001184062.1] (partial match)
| |
- | |}
| |
- |
| |
- | <pre style="color:red"> Unavailable in Registry </pre>
| |
- |
| |
- |
| |
- |
| |
- | <code>
| |
- | >BBa_K364319 Part-only sequence (441 bp)
| |
- | gccaagctactgtcttctatcgaacaagcatgcgatatttgccgacttaaaaagctcaagtgctccaaagaaaaaccgaagtgcgccaagtgtctgaaga
| |
- | acaactgggagtgtcgctactctcccaaaaccaaaaggtctccgctgactagggcacatctgacagaagtggaatcaaggctagaaagactggaacagct
| |
- | atttctactgatttttcctcgagaagaccttgacatgattttgaaaatggattctttacaggatataaaagcattgttaacaggattatttgtacaagat
| |
- | aatgtgaataaagatgccgtcacagatagattggcttcagtggagactgatatgcctctaacattgagacagcatagaataagtgcgacatcatcatcgg
| |
- | aagagagtagtaacaaaggtcaaagacagttgactgtatcg
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | GAL4??? || 441bp || ok || ok || 0 AS < 10% || [http://www.ncbi.nlm.nih.gov/nuccore/NM_001184062.1 NM_001184062.1] (partial match)
| |
- | |}
| |
- |
| |
- | <pre style="color:red"> Unverified in Registry </pre>
| |
- |
| |
- | This is majorly confusing ... the difference between the sequences is that BBa_K364319 starts with gcc instead of atg and is shorter. But the one description states its the UAS (=Promoter?) and the other states its the Transcription factor. Is this correct? ([[User:Fabian]])
| |
- |
| |
- | ====LexA====
| |
- |
| |
- | LexA[http://partsregistry.org/Part:BBa_K105005] is a prokaryotic transcription activator which binds a specific lexA recognition site. LexA can be used in fusion proteins as a DNA-binding domain in eukaryotic systems due to the natural lack of prokaryotic transcription factors. So no interferences with other expression systems are expected.
| |
- | <code>
| |
- | >BBa_K105005 Part-only sequence (603 bp)
| |
- | aaagcgttaacggccaggcaacaagaggtgtttgatctcatccgtgatcacatcagccagacaggtatgccgccgacgcgtgcggaaatcgcgcagcgtt
| |
- | tggggttccgttccccaaacgcggctgaagaacatctgaaggcgctggcacgcaaaggcgttattgaaattgtttccggcgcatcacgcgggattcgtct
| |
- | gttgcaggaagaggaagaagggttgccgctggtaggtcgtgtggctgccggtgaaccacttctggcgcaacagcatattgaaggtcattatcaggtcgat
| |
- | ccttccttattcaagccgaatgctgatttcctgctgcgcgtcagcgggatgtcgatgaaagatatcggcattatggatggtgacttgctggcagtgcata
| |
- | aaactcaggatgtacgtaacggtcaggtcgttgtcgcacgtattgatgacgaagttaccgttaagcgcctgaaaaaacagggcaataaagtcgaactgtt
| |
- | gccagaaaatagcgagtttaaaccaattgtcgttgaccttcgtcagcagagcttcaccattgaagggctggcggttggggttattcgcaacggcgactgg
| |
- | ctg
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | LexA Transcription Factor || 603bp || ok || ok || 0 AS < 10% || [http://www.ncbi.nlm.nih.gov/nucleotide/J01643 J01643] (partial match)
| |
- | |}
| |
- |
| |
- | <pre style="color:red"> Inconsistent in Registry </pre>
| |
- |
| |
- | ===Pif3-GAL4AD===
| |
- | ====Pif3====
| |
- |
| |
- | The phytochrome interacting factor 3 (Pif3)[http://partsregistry.org/Part:BBa_K365000] which interacts with the active form of phytochrome B (PhyB). Only the first 100 N-terminal residues seem to be bound by Pfr form of PhyB.
| |
- | <code>
| |
- | >BBa_K365000 Part-only sequence (300 bp)
| |
- | atgcctctgtttgaacttttcaggctcaccaaagctaagcttgaatctgctcaagacaggaacccttctccacctgtagatgaagttgtggagctggtgt
| |
- | gggaaaatggtcagatatcaactcaaagtcagtcaagtagatcgaggaacattcctccaccacaagcaaactcttcaagagctagagagattggaaatgg
| |
- | ctcaaagacgactatggtggacgagatccctatgtcagtgccatcactaatgacgggtttgagtcaagacgatgactttgttccatggttgaatcatcat
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Pif3 Transcription Factor || 300bp || ok || ok || 0 AS < 10% || [http://www.ncbi.nlm.nih.gov/nucleotide/NM_179295.2 NM_179295.2] (partial match)
| |
- | |}
| |
- |
| |
- |
| |
- | <pre style="color:red"> Unverified in Registry </pre>
| |
- |
| |
- | ====GAL4AD====
| |
- | Still missing, but we receive this part from Professor Schwab (please see discussion site).
| |
- |
| |
- | ===Inverters===
| |
- |
| |
- | An inverter is logic gate which implements logical negation. Typical genetic inverter systems are repressors and the genes which are dependant from the repressor, thus if the repressor is active (input = 1) the gene-expression is off (output = 0) and vice versa.
| |
- | ====LacI IS repressor====
| |
- | An inverter could be used in a light-dependant system to negotiate gene-expression of one or more genes. LacI IS (IPTG unresponsive mutant to prevent interference with IPTG inducible systems) [http://partsregistry.org/Part:BBa_K142007][http://partsregistry.org/Part:BBa_K142006][http://partsregistry.org/Part:BBa_K142005][http://partsregistry.org/Part:BBa_K142004][http://partsregistry.org/Part:BBa_K142003][http://partsregistry.org/Part:BBa_K142002][http://partsregistry.org/Part:BBa_K142002][http://partsregistry.org/Part:BBa_K142001] can be used as an inverter because LacI IS is derived from bacteria and doesn't interfere with other yeast expression systems.
| |
- | <code>
| |
- | >BBa_K142007 Part-only sequence (1128 bp)
| |
- | atggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgttt
| |
- | ctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgat
| |
- | tggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcg
| |
- | atggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgacc
| |
- | aggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatga
| |
- | agacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgttt
| |
- | ctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgc
| |
- | aaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgt
| |
- | tggtgcggatatctcggtagtgggatacgacgattttgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctgggg
| |
- | caaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctgg
| |
- | cgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacga
| |
- | cgaaaactacgctttagtagcttaataa
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | lacI Repressor || 1128bp || ok || ok || 2 AS < 10% || ?
| |
- | |}
| |
- |
| |
- |
| |
- | <pre style="color:red"> Unverified in Registry </pre>
| |
- |
| |
- | ====cI repressor====
| |
- | cI[http://partsregistry.org/Part:BBa_C0051] is a repressor from ''Escherichia coli'', which recognize specific DNA sequence to which it binds.
| |
- | <code>
| |
- | >BBa_C0051 Part-only sequence (750 bp)
| |
- | atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatccc
| |
- | aggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgc
| |
- | aaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagt
| |
- | gagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaa
| |
- | ccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaat
| |
- | tctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggt
| |
- | caggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaag
| |
- | agacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataa
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | cI Repressor || 750bp || ok || ok || 0 AS < 10% || ?
| |
- | |}
| |
- |
| |
- | <pre style="color:green"> Confirmed in Registry </pre>
| |
- |
| |
- | ===Promoter sequences===
| |
- |
| |
- | ====Minimal promoter====
| |
- |
| |
- | A minimal promoter is a essential DNA sequence on which the transcription machinery can bind. By adding binding sites upstream the transcription can be enhanced.
| |
- |
| |
- | =====cyc100 minimal promoter=====
| |
- |
| |
- | This sequence[http://partsregistry.org/Part:BBa_K105027] is the core of CYC1 promoter of ''S. cerevisiae''. It has a basal transcription activity. This activity can be modulated by upstream activation sequences or by downstream operator sequences.
| |
- | <code>
| |
- | >BBa_K105027 Part-only sequence (103 bp)
| |
- | gcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttc
| |
- | tat
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Minimal yeast promoter || 103bp || ok || ok || Promoter || ?
| |
- | |}
| |
- |
| |
- | =====cyc70 minimal promoter=====
| |
- |
| |
- | It's a variation[http://partsregistry.org/Part:BBa_K105028] of cyc100 minimal promoter with a point mutation which reduces the basal activity to 70%.
| |
- | <code>
| |
- | >BBa_K105028 Part-only sequence (103 bp)
| |
- | gcatgtgctctgtatgtatataacactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttc
| |
- | tat
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Minimal yeast promoter || 103bp || ok || ok || Promoter || ?
| |
- | |}
| |
- |
| |
- | =====cyc43 minimal promoter=====
| |
- |
| |
- | Another derivative[http://partsregistry.org/Part:BBa%20K105029] of cyc100 minimal promoter. This minimal promoter has a 43% transcription activity of cyc100 minimal promoter.
| |
- | <code>
| |
- | >BBa_K105029 Part-only sequence (103 bp)
| |
- | gcatgtgctctgtatgtatatagaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttc
| |
- | tat
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Minimal yeast promoter || 103bp || ok || ok || Promoter || ?
| |
- | |}
| |
- |
| |
- | =====cyc28 minimal promoter=====
| |
- |
| |
- | Another derivative[http://partsregistry.org/Part:BBa%20K105030] of cyc100 minimal promoter. This minimal promoter has a 28% transcription activity of cyc100 minimal promoter.
| |
- |
| |
- | <code>
| |
- | >BBa_K105030 Part-only sequence (103 bp)
| |
- | gcatgtgctctgtatgtatattaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttc
| |
- | tat
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Minimal yeast promoter || 103bp || ok || ok || Promoter || ?
| |
- | |}
| |
- |
| |
- | =====cyc16 minimal promoter=====
| |
- |
| |
- | Another derivative[http://partsregistry.org/Part:BBa%20K105031] of cyc100 minimal promoter. This minimal promoter has a 16% transcription activity of cyc100 minimal promoter.
| |
- |
| |
- | <code>
| |
- | >BBa_K105031 Part-only sequence (103 bp)
| |
- | gcatgtgctctgtatgtatatgaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttc
| |
- | tat
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Minimal yeast promoter || 103bp || ok || ok || Promoter || ?
| |
- | |}
| |
- |
| |
- | =====mCYC1 minimal promoter=====
| |
- |
| |
- | Another biobrick[http://partsregistry.org/wiki/index.php?title=Part:BBa_K165016] for a minimal yeast promoter for designing new promoters.
| |
- | <code>
| |
- | >BBa_K165016 Part-only sequence (245 bp)
| |
- | cagatccgccaggcgtgtatatatagcgtggatggccaggcaactttagtgctgacacatacaggcatatatatatgtgtgcgacgacacatgatcatat
| |
- | ggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactat
| |
- | acttctatagacacgcaaacacaaatacacacactaaattaataa
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Minimal yeast promoter || 245bp || ok || ok || Promoter || ?
| |
- | |}
| |
- |
| |
- | ====Gal1 promoter sequence/GAL4 target sequence====
| |
- |
| |
- | These promoters[http://partsregistry.org/wiki/index.php/Part:BBa_K517000][http://partsregistry.org/wiki/index.php?title=Part:BBa_J63006] can be induced by galactose. Does this means that the sequence contains a upstream activating region (UAS) to which GAL4BD can bind?
| |
- | <code>
| |
- | >BBa_K517000 Part-only sequence (340 bp)
| |
- | gcgccgcactgctccgaacaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaaccgggccccacaaaccttcaaatg
| |
- | aacgaatcaaattaacaaccataggatgataatgcgattagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaa
| |
- | cagatatataaatgcaaaaactgcataaccactttaactaatactttcaacattttcggtttgtattacttcttattcaaatgtaataaaagtatcaaca
| |
- | aaaaattgttaatatacctctatactttaacgtcaaggag
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Galactose inducible Promoter || 340bp || ok || ok || Promoter || ?
| |
- | |}
| |
- |
| |
- | <pre style="color:green"> Confirmed in Registry </pre>
| |
- |
| |
- | <code>
| |
- | >BBa_J63006 Part-only sequence (549 bp)
| |
- | ccccattatcttagcctaaaaaaaccttctctttggaactttcagtaatacgcttaactgctcattgctatattgaagtacggattagaagccgccgagc
| |
- | gggtgacagccctccgaaggaagactctcctccgtgcgtcctcgtcttcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccgaa
| |
- | caataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaacctggccccacaaaccttcaaatgaacgaatcaaattaacaa
| |
- | ccataggatgataatgcgattagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatgcaaa
| |
- | aactgcataaccactttaactaatactttcaacattttcggtttgtattacttcttattcaaatgtaataaaagtatcaacaaaaaattgttaatatacc
| |
- | tctatactttaacgtcaaggaggaaactagacccgccgccaccatggag
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Galactose inducible Promoter || 549bp || ok || ok || Promoter || ?
| |
- | |}
| |
- |
| |
- | <pre style="color:green"> Confirmed in Registry </pre>
| |
- |
| |
- | Target sequence for the GAL4 DNA binding domain [http://partsregistry.org/Part:BBa_J176019].
| |
- | <code>
| |
- | >BBa_J176019 Part-only sequence (93 bp)
| |
- | cggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccg
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | 5x GAL target sequence || 93bp || ok || ok || Target Sequence || ?
| |
- | |}
| |
- |
| |
- | <pre style="color:red"> Unavailable in Registry </pre>
| |
- |
| |
- | ====LexA operator====
| |
- |
| |
- | DNA recognition site[http://partsregistry.org/Part:BBa_K105022][http://partsregistry.org/Part:BBa_K079048][http://partsregistry.org/wiki/index.php?title=Part:BBa_K079039][http://partsregistry.org/wiki/index.php?title=Part:BBa_K079040][http://partsregistry.org/Part:BBa_K106686] which can be bound by LexA and can be used for recruiting transcription activators/repressors by fusing it to them.
| |
- | <code>
| |
- | >BBa_K105022 Part-only sequence (31 bp)
| |
- | tttacactggttttatatacagcagtacgta
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | lexA Binding Domain || 31bp || ok || ok || Binding Domain || ?
| |
- | |}
| |
- |
| |
- | <pre style="color:orange"> Partially Confirmed in Registry </pre>
| |
- |
| |
- | <code>
| |
- | >BBa_K079048 Part-only sequence (40 bp)
| |
- | ctgtatatatatacagtactagagctgtatgagcatacag
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | 2 lexA Binding Domains || 40 bp || ok || ok || Binding Domain || ?
| |
- | |}
| |
- |
| |
- | <pre style="color:red"> Unavailable in Registry </pre>
| |
- |
| |
- | ====LacI regulated promoter/operator====
| |
- |
| |
- | A promoter sequence[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0011][http://partsregistry.org/wiki/index.php?title=Part:BBa_K079017][http://partsregistry.org/wiki/index.php?title=Part:BBa_K079018][http://partsregistry.org/wiki/index.php?title=Part:BBa_K079019]which is recognized by LacI. LacI prevents RNA-polymerase from transcription of downstream regulated genes.
| |
- | <code>
| |
- | >BBa_R0011 Part-only sequence (55 bp)
| |
- | aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | lacI repressible Promoter || 55 bp || ok || ok || Promoter || ?
| |
- | |}
| |
- |
| |
- | <pre style="color:green"> Confirmed in Registry </pre>
| |
- |
| |
- | ====cI operator====
| |
- | DNA motif recognized by cI repressor.[http://partsregistry.org/wiki/index.php?title=Part:BBa_K079047][http://partsregistry.org/wiki/index.php?title=Part:BBa_K079041][http://partsregistry.org/wiki/index.php?title=Part:BBa_K079042][http://partsregistry.org/wiki/index.php?title=Part:BBa_K079043]
| |
- |
| |
- | <code>
| |
- | >BBa_K079047 Part-only sequence (67 bp)
| |
- | tatcaccgccagaggtatactagagtaacaccgtgcgtgttgtactagagtatcaccgcaagggata
| |
- | </code>
| |
- |
| |
- | ===Protein-protein-interaction based FRET-sensor===
| |
- | ====FRET-fluorophores====
| |
- | =====EYFP=====
| |
- |
| |
- | [http://partsregistry.org/Part:BBa_E2030] This is an enhanced version of EYFP. It is yeast codon-optimized, it is more chloride- and pH-resistant than EYFP and has a faster chromophore maturation than EYFP and YFP Citrine
| |
- |
| |
- | <code>
| |
- | >BBa_E2030 Part-only sequence (753 bp)
| |
- | atggcaactagcggcatggttagtaaaggagaagaacttttcactggagttgtcccaattttagttgaactagatggcgacgtgaacggtcataagttca
| |
- | gtgtctccggcgaaggtgagggtgatgcaacgtacggtaagttaactttgaagttaatatgtacaaccggcaagctgcctgttccctggcctaccctggt
| |
- | gacaacgttaggttatgggttgatgtgctttgctagatacccagatcacatgaaaaggcatgacttctttaaatctgcaatgccagaaggttacgtccaa
| |
- | gaacgtactattttctttaaagatgacggtaattataaaactagggctgaagttaaattcgaaggtgacacacttgtaaatcgaatagagttaaagggga
| |
- | ttgatttcaaagaggatggtaatattctaggccataaacttgaatataactataattcacacaacgtttacattaccgccgacaagcagaagaatggaat
| |
- | caaagccaattttaagattagacacaatattgaggatggtggagtacagcttgctgatcattaccaacaaaataccccgatcggtgatggaccagttttg
| |
- | ctacccgataaccattatctgtcctatcaaagcaaattgtcaaaagatcctaacgaaaaaagagaccacatggtactcttggaatttgtaacagctgctg
| |
- | ggattacacatggcatggatgaactatacaaaggttctggtaccgcataataa
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | Venus EYFP || 753 bp || ok || ok || 0AS<10% || [http://www.ncbi.nlm.nih.gov/nucleotide/AB634497.1 AB634497.1]
| |
- | |}
| |
- |
| |
- | <pre style="color:green"> Confirmed in Registry </pre>
| |
- |
| |
- | =====ECFP=====
| |
- |
| |
- | Enhanced version of ECFP[http://partsregistry.org/Part:BBa_E2020], yeast-optimized CFP, codon-optimized for yeast. Derived from ECFP. Has single exponential decay kinetics, is at least 2X brighter than ECFP, and is more resistant to photobleaching.
| |
- |
| |
- | <code>
| |
- | >BBa_E2020 Part-only sequence (753 bp)
| |
- | atggcaactagcggcatggttagtaaaggagaagaacttttcactggagttgtcccaattctggttgaattggatggcgatgtcaatggccataagtttt
| |
- | cggttagtggtgaaggagagggcgacgctacctatgggaagttaactttaaagttcatttgtactaccggtaagttaccagttccttggcctactttggt
| |
- | cacaacccttacatggggggtgcagtgctttgccagatatccggatcacatgaaacaacacgattttttcaaatccgctatgcctgaaggatatgtacaa
| |
- | gaaagaaccatatttttcaaggatgacggcaactacaaaactagagccgaagttaaattcgaaggtgacacattggtaaatcgaattgagctcaaaggaa
| |
- | tagattttaaggaagatggtaacatccttggtcataagttagagtataatgcaatttctgataacgtctacataactgcggataaacagaaaaatggtat
| |
- | taaagccaattttaaaattaggcataacatcgaagatgggagtgttcaacttgcagaccactaccaacaaaatacacccataggagacggtcccgtactg
| |
- | ttgccagataaccattatctgtctacacaatctaaattaagcaaagatccaaatgaaaagcgtgaccacatggtgttgctagagtttgtaacagctgctg
| |
- | ggattacacatggcatggatgaactatacaaaggttctggtaccgcataataa
| |
- |
| |
- | </code>
| |
- | {| class="wikitable" cellpadding="10" border=1px
| |
- | | Name || Length || RFC10 || RFC25 || Codon Usage || NCBI
| |
- | |-
| |
- | | ECFP || 753 bp || ok || 1 x AgeI (Position 166) || 0AS<10% || several
| |
- | |}
| |
- |
| |
- | <pre style="color:green"> Confirmed in Registry </pre>
| |
- |
| |
- | ====Protein-protein-interaction partners====
| |
| | | |
| ==References== | | ==References== |
| To whom it may concern: Please add the cite extension [https://www.mediawiki.org/wiki/Extension:Cite/Cite.php] for MediaWiki! | | To whom it may concern: Please add the cite extension [https://www.mediawiki.org/wiki/Extension:Cite/Cite.php] for MediaWiki! |
A light-switchable promoter system for switching on/off gene expression or switching gene-expression of product A to product B and back.
This system bases on the yeast two-hybrid system which was originally created for exploring protein-protein interactions. One candidate of a potential protein-interaction pair is fused to the DNA-binding domain of a transcription factor and the other candidate to the activation domain of the transcription factor. If the proteins candidates are really physically interacting with each other, this event will starts the transcription of downstream reporter genes.
This light-inducible system contains two proteins, phytochrome B (PhyB) and phytochrome interacting factor 3 (Pif3), which only interacts together when the PhyB is in it's active conformer (Pfr-form). PhyB, a phytochrome containing a essential chromophore phycocyanobilin B (PCB), is naturally synthesized in it's inactive form (Pr; r stand for red-light sensitive form). So it cannot bound to Pif3 once synthesized. PhyB first has to be activated by red light (λ = 660 nm) which causes a Z-E conformer isomerization to the active form Pfr (fr stands for far-red light senstive form). Relaxation (E-Z conformation change) is induced by far-red light (λ = 750 nm); the high energy form Pfr has a half-life of 30–60 min resulting that after this time half of the Pfr species is spontanously relaxed into the low-energy form Pr. This allows us to generate time-stable light-switchable promoter systems. It is also possible not only have a discret genetic switch. By varying freqrency of red/far-red light pulses one should be able to control the strength of gene-expression or the strength-ratio between two expressed genes.
As described phycocyanobilin is a essential chromophore for a functional phytochrome B. PCB can be synthesized in two steps from heme. First, heme is converted to biliverdin IXα (BV) and second, BV is converted to 3Z-phycocyanobilin (PCB).