Team:TU Munich/Project/Limonene

From 2012.igem.org

(Difference between revisions)
Line 1: Line 1:
{{Team:TU_Munich/Header}}
{{Team:TU_Munich/Header}}
 +
 +
=Limonene=
==Background and principles==
==Background and principles==
-
'''Limonene''' is a cyclic terpene and a major constituent of several citrus oils (orange, lemon, mandarin, lime and grapefruit). It is a chiral molecule; citrus fruits contain the (R)-enantiomer. The (R)-enantiomer smells like oranges, while the (S)-enantionmer has a piney, turpentine-like odor. D-Limonene is used as a component of flavorings and fragrances. It has been shown to inhibit rat mammary and other tumor development (Tsuda et al. 2004). Being an excellent solvent of cholesterol, d-limonene also has been used clinically to dissolve cholesterol-containing gallstones. Because of its gastric acid neutralizing effect and its support of normal peristalsis, it has also been used for relief of heartburn (Sun 2007).
+
===Limonene=== is a cyclic terpene and a major constituent of several citrus oils (orange, lemon, mandarin, lime and grapefruit). It is a chiral molecule; citrus fruits contain the (R)-enantiomer. The (R)-enantiomer smells like oranges, while the (S)-enantionmer has a piney, turpentine-like odor. D-Limonene is used as a component of flavorings and fragrances. It has been shown to inhibit rat mammary and other tumor development (Tsuda et al. 2004). Being an excellent solvent of cholesterol, d-limonene also has been used clinically to dissolve cholesterol-containing gallstones. Because of its gastric acid neutralizing effect and its support of normal peristalsis, it has also been used for relief of heartburn (Sun 2007).
-
'''Biosynthesis'''
+
===Biosynthesis===
Limonene is formed from geranyl pyrophosphat by limonene synthase. (R)-limonene synthase 1 consists of 606 aminoacids (sequence shown below, EC=4.2.3.20). (R)-limonene synthase needs magnesium or manganese as cofactor and catalyzes the following reaction: Geranyl pyrophosphate = (+)-(4R)-limonene + diphosphate.
Limonene is formed from geranyl pyrophosphat by limonene synthase. (R)-limonene synthase 1 consists of 606 aminoacids (sequence shown below, EC=4.2.3.20). (R)-limonene synthase needs magnesium or manganese as cofactor and catalyzes the following reaction: Geranyl pyrophosphate = (+)-(4R)-limonene + diphosphate.

Revision as of 12:21, 15 August 2012


Contents

Limonene

Background and principles

===Limonene=== is a cyclic terpene and a major constituent of several citrus oils (orange, lemon, mandarin, lime and grapefruit). It is a chiral molecule; citrus fruits contain the (R)-enantiomer. The (R)-enantiomer smells like oranges, while the (S)-enantionmer has a piney, turpentine-like odor. D-Limonene is used as a component of flavorings and fragrances. It has been shown to inhibit rat mammary and other tumor development (Tsuda et al. 2004). Being an excellent solvent of cholesterol, d-limonene also has been used clinically to dissolve cholesterol-containing gallstones. Because of its gastric acid neutralizing effect and its support of normal peristalsis, it has also been used for relief of heartburn (Sun 2007).

Biosynthesis

Limonene is formed from geranyl pyrophosphat by limonene synthase. (R)-limonene synthase 1 consists of 606 aminoacids (sequence shown below, EC=4.2.3.20). (R)-limonene synthase needs magnesium or manganese as cofactor and catalyzes the following reaction: Geranyl pyrophosphate = (+)-(4R)-limonene + diphosphate.

File:ReactionLimoneneSynthase.jpg

Idea

Producing the flavoring substance limonene in our beer might result in a fresh, lemon-like taste on the one hand. On the other hand, we might have health beneficial effects like preventive activity against cancer, dissolution of gallstones and relief of heartburn.

Limonene can be produced by (R)-limonene synthase.

General remarks and issues

We should ask professor Schwab whether he has suitable plasmids for us or not.

Biobricks and sequences

File:SequenceLimoneneSynthase.jpg


Citrus limon (+)-limonene synthase 1 mRNA, complete cds

       1 ggccaagtat aactgtaagc tagcttacac tacatctgta tatccaatgt cttcttgcat
      61 taatccctca accttggtta cctctgtaaa tgctttcaaa tgtcttcctc ttgcaacaaa
     121 taaagcagcc atcagaatca tggccaaata taagccagtc caatgcctta tcagcgccaa
     181 atatgataat ttgacagttg ataggagatc agcaaactac caaccttcaa tttgggacca
     241 cgattttttg cagtcattga atagcaacta tacggatgaa gcatacaaaa gacgagcaga
     301 agagctgagg ggaaaagtga agatagcgat taaggatgta atcgagcctc tggatcagtt
     361 ggagctgatt gataacttgc aaagacttgg attggctcat cgttttgaga ctgagattag
     421 gaacatattg aataatatct acaacaataa taaagattat aattggagaa aagaaaatct
     481 gtatgcaacc tcccttgaat tcagactact tagacaacat ggctatcctg tttctcaaga
     541 ggttttcaat ggttttaaag acgaccaggg aggcttcatt tgtgatgatt tcaagggaat
     601 actgagcttg catgaagctt cgtattacag cttagaagga gaaagcatca tggaggaggc
     661 ctggcaattt actagtaaac atcttaaaga agtgatgatc agcaagaaca tggaagagga
     721 tgtatttgta gcagaacaag cgaagcgtgc actggagctc cctctgcatt ggaaagtgcc
     781 aatgttagag gcaaggtggt tcatacacat ttatgagaga agagaggaca agaaccacct
     841 tttacttgag ctcgctaaga tggagtttaa cactttgcag gcaatttacc aggaagaact
     901 aaaagaaatt tcagggtggt ggaaggatac aggtcttgga gagaaattga gctttgcgag
     961 gaacaggttg gtagcgtcct tcttatggag catggggatc gcgtttgagc ctcaattcgc
    1021 ctactgcagg agagtgctca caatctcgat agccctaatt acagtgattg atgacattta
    1081 tgatgtctat ggaacattgg atgaacttga gatattcact gatgctgttg agaggtggga
    1141 catcaattat gctttgaagc accttccggg ctatatgaaa atgtgttttc ttgcgcttta
    1201 caactttgtt aatgaatttg cttattacgt tctcaaacaa caggattttg atttgcttct
    1261 gagcataaaa aatgcatggc ttggcttaat acaagcctac ttggtggagg cgaaatggta
    1321 ccatagcaag tacacaccga aactggaaga atacttggaa aatggattgg tatcaataac
    1381 gggcccttta attataacga tttcatatct ttctggtaca aatccaatca ttaagaagga
    1441 actggaattt ctagaaagta atccagatat agttcactgg tcatccaaga ttttccgtct
    1501 gcaagatgat ttgggaactt catcggacga gatacagaga ggggatgttc cgaaatcaat
    1561 ccagtgttac atgcatgaaa ctggtgcctc agaggaagtt gctcgtcaac acatcaagga
    1621 tatgatgaga cagatgtgga agaaggtgaa tgcatacaca gccgataaag actctccctt
    1681 gactggaaca actactgagt tcctcttgaa tcttgtgaga atgtcccatt ttatgtatct
    1741 acatggagat gggcatggtg ttcaaaacca agagactatc gatgtcggtt ttacattgct
    1801 ttttcagccc attcccttgg aggacaaaca catggctttc acagcatctc ctggcaccaa
    1861 aggctgatga tgaattataa tgcatgatgc gttgcgaatt cccagagagt gcagtttcag
    1921 ttgatgttgg cctccacttt tctttcttct gagggatctc ttttcgataa taaaataaat
    1981 tccctcattc aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
    2041 aaa
Name Length RFC10 RFC25 Codon Usage NCBI
(+)-Limonene Synthase 1 2043bp 2x EcoRI (497-503/1896-1902) 1x SpeI (671-677) 1x PstI(1024-1030) 1x XbaI (1450-1456) ok after RFC10 1 AS < 10% [http://www.ncbi.nlm.nih.gov/nuccore/21435702 AF514287.1]


Lavandula limonene synthase, plasmid provided by Prof. Schwab

 GAAACCCGACGCTCCGGAAACTACAACCCTACCGCTTGGGATTT
 CAACTACATCCAATCCCTCGACAATCAGTATAAGAAAGAGAGGTACTCGA
 CAAGACACGCTGAGCTGACTGTGCAAGTGAAGAAGCTGCTGGAGGAAGAA
 ATGGAAGCGGTTCAAAAGTTGGAATTGATTGAGGATTTGAAGAACCTGGG
 AATATCTTACCCATTTAAGGACAATATCCAACAGATTTTAAATCAAATAT
 ATAATGAGCACAAATGTTGCCACAACAGTGAAGTGGAAGAAAAGGATTTG
 TATTTCACGGCTCTTCGATTCCGACTCCTTAGACAACAGGGTTTTGAAGT
 CTCTCAAGAAGTATTTGATCATTTCAAGAACGAGAAGGGTACAGATTTCA
 AGCCAAACCTTGCTGACGATACTAAAGGACTATTGCAACTTTACGAAGCA
 TCTTTCCTATTAAGAGAAGCTGAAGATACACTTGAGTTAGCTCGACAATT
 TTCAACCAAATTACTGCAGAAAAAAGTCGATGAGAATGGTGATGATAAAA
 TAGAGGATAATCTATTATTATGGATTCGCCGTTCTTTGGAGCTCCCGCTT
 CATTGGAGGGTGCAAAGGCTAGAAGCAAGAGGGTTCTTGGATGCTTACGT
 TAGAAGGCCCGACATGAATCCAATTGTTTTTGAGCTCGCCAAACTCGACT
 TCAATATTACCCAAGCAACACAACAAGAAGAACTGAAAGATCTCTCGAGG
 TGGTGGAATAGTACAGGCCTTGCCGAAAAACTCCCATTCGCGAGGGATCG
 GGTTGTTGAGTCCTACTTCTGGGCAATGGGAACCTTTGAGCCTCATCAAT
 ATGGTTATCAGAGAGAACTTGTCGCCAAGATTATTGCTCTAGCAACAGTT
 GTAGATGATGTTTACGATGTATATGGTACGTTAGAGGAACTGGAACTATT
 TACAGATGCCATTCGGAGATGGGATCGTGAATCAATCGACCAACTTCCTT
 ACTACATGCAGCTATGCTTTTTGACTGTCAACAACTTTGTTTTCGAGCTT
 GCTCATGATGTTCTTAAGGATAAGAGTTTCAACTGCTTACCACATTTACA
 GAGATCGTGGCTAGACTTGGCTGAAGCATATCTTGTCGAGGCTAAGTGGT
 ACCACAGTAGATATACACCGAGCCTCGAGGAATATCTCAATATTGCAAGA
 GTTTCAGTTACGTGTCCCACTATAGTTTCACAAATGTACTTTGCATTACC
 AATTCCGATAGAGAAACCGGTCATCGAGATCATGTACAAATACCACGACA
 TACTTTACCTCTCAGGAATGCTTCTAAGGCTTCCTGATGATCTAGGAACA
 GCATCGTTTGAGTTGAAGAGAGGTGATGTGCAAAAAGCAGTCCAGTGTTA
 TATGAAGGAAAGAAATGTTCCTGAAAATGAGGCACGAGAACATGTGAAGT
 TTCTGATTCGGGAGGCGTCGAAGCAGATAAACACCGCGATGGCGACCGAT
 TGTCCATTTACTGAAGATTTTGCTGTGGCTGCAGCGAATCTTGGAAGAGT
 GGCGAATTTTGTGTACGTCGACGGAGATGGTTTTGGCGTGCAACACTCAA
 AAATATATGAACAGATTGGAACCCTGATGTTCGAGCCATATCCCTAA
Name Length RFC10 RFC25 Codon Usage NCBI
lavendula angustifolia limonene synthase 1641 bp 2x PstI ok after RFC10 4 AS < 10% [http://www.ncbi.nlm.nih.gov/nucleotide/82408410?report=genbank&log$=nucltop&blast_rank=1&RID=TXMYMNC0012]


(pET29a and pGEX4T1 plasmids contain synthase gene) Note: The posted sequence above still contains an N- terminal signal sequence for transport in plastids (of plants), which we do not need. The plasmids from Prof. Schwab do not have these signal sequences and therfore they do not have any start codons, either. We will have to generate the ATG start- codon by adequate primer- design. (Roman)

References

Herrero O, Ramón D, Orejas M: Engineering the Saccharomyces cerevisiae isoprenoid pathway for de novo production of aromatic monoterpenes in wine. Metab Eng 2008 10:78-86.

Lücker J, Tamer M, Schwab W, Verstappen F, Van der Plas L, Bouwmeester H and Verhoeven H: Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases. Eur J Biochem 2002 269:3160-3171.

Sun J: D-Limonene: Safety and Clinical Applications. Altern Med Rev 2007 12(3):259-264.

Tsuda H, Ohshim Y, Nomoto H, Fujita K, Matsuda E, Iigo M, Takasuka N, Moore M: Cancer Prevention by Natural Compounds. Drug Metab Pharmacokin 2004 19(4):245-263.