|
|
Line 1: |
Line 1: |
| + | {{tempalte:sustc_shenzhen_b/1}} |
| <html> | | <html> |
| <head> | | <head> |
- | <meta charset="utf-8" />
| + | <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> |
- | <meta name="description" content="" />
| + | <title>SUSTC iGEM Theme - Free CSS Template</title> |
- | <meta name="author" content="tengattack" />
| + | <meta name="keywords" content="beauty class, free theme, website design, bokehs, pink, orange, templatemo, CSS, HTML" /> |
- | <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
| + | <meta name="description" content="Beauty Class Theme, pinky background gradient with bokehs, free CSS template provided by templatemo.com" /> |
- | <title>Title</title>
| + | |
| | | |
| <style type="text/css"> | | <style type="text/css"> |
- | #globalWrapper {width: 100%; }
| + | <!-- |
- | #top-section {width: 100%; height:100%; border:none;}
| + | .STYLE1 { |
- | #p-logo {display:none;}
| + | color: #2A0000; |
- | #search-controls {display:none;}
| + | font-weight: bold; |
- | .printfooter {display:none;} | + | |
- | #footer-box {border:none;}
| + | |
- | .firstHeading {display:none;}
| + | |
- | #content { border:none !important; width:1024px !important; background: url('') !important;} | + | |
- | #bodyContent {bo<html>
| + | |
- | <head>
| + | |
- | <meta charset="utf-8" /> | + | |
- | <meta name="description" content="" />
| + | |
- | <meta name="author" content="tengattack" />
| + | |
- | <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
| + | |
- | <title>Title</title>
| + | |
- | | + | |
- | <style type="text/css">
| + | |
- | #globalWrapper {width: 100%; }
| + | |
- | #top-section {width: 100%; height:100%; border:none;}
| + | |
- | #p-logo {display:none;}
| + | |
- | #search-controls {display:none;}
| + | |
- | .printfooter {display:none;}
| + | |
- | #footer-box {border:none;}
| + | |
- | .firstHeading {display:none;}
| + | |
- | #content { border:none !important; width:1024px !important; background: url('') !important;}
| + | |
- | #bodyContent {border:none; }
| + | |
- | #catlinks {display:none; }
| + | |
- | #footer-box {display:none; }
| + | |
- | #menubar {display:none; }
| + | |
- | | + | |
- | /* googleapis-font */
| + | |
- | @font-face {
| + | |
- | font-family: 'Open Sans';
| + | |
- | font-style: normal;
| + | |
- | font-weight: 700;
| + | |
- | src: local('Open Sans Bold'), local('OpenSans-Bold'), url(http://themes.googleusercontent.com/static/fonts/opensans/v6/k3k702ZOKiLJc3WVjuplzHhCUOGz7vYGh680lGh-uXM.woff) format('woff');
| + | |
| } | | } |
- | @font-face {
| + | .STYLE2 {color: #0000FF} |
- | font-family: 'Open Sans';
| + | --> |
- | font-style: normal;
| + | |
- | font-weight: 600;
| + | |
- | src: local('Open Sans Semibold'), local('OpenSans-Semibold'), url(http://themes.googleusercontent.com/static/fonts/opensans/v6/MTP_ySUJH_bn48VBG8sNSnhCUOGz7vYGh680lGh-uXM.woff) format('woff');
| + | |
- | }
| + | |
- | @font-face {
| + | |
- | font-family: 'Open Sans';
| + | |
- | font-style: normal;
| + | |
- | font-weight: 400;
| + | |
- | src: local('Open Sans'), local('OpenSans'), url(http://themes.googleusercontent.com/static/fonts/opensans/v6/cJZKeOuBrn4kERxqtaUH3T8E0i7KZn-EPnyo3HZu7kw.woff) format('woff');
| + | |
- | }
| + | |
- | | + | |
- | /* inner */
| + | |
- | .pagenavi{clear:both;padding:0}.pagenavi a,.pagenavi a:visited{background:#dfddc7;display:inline-block;margin:0 8px 0 0;padding:3px 10px;color:#727272}.pagenavi a:hover{background:#dfddc7;display:inline-block;margin:0 8px 0 0;padding:3px 10px;color:#b03121;text-decoration:none}.pagenavi .current{background:#dfddc7;display:inline-block;margin:0 8px 0 0;padding:3px 10px;color:#b03121}.pagenavi .pages{background:#dfddc7;display:inline-block;margin:0 8px 0 0;padding:3px 10px}#breadcrumb{text-align:right;margin-bottom:34px;clear:right}.post{margin-bottom:30px;padding-bottom:30px;clear:both;border-bottom:1px solid #dfddc7}.post img{padding:5px;background:#d2d0ba;width:590px;height:236px}.single{padding-bottom:20px}.postimg{margin-bottom:20px}.posttitle{margin:0 0 5px 0}.posttitle,.posttitle a{font-size:18px;color:#3f4432}.posttitle a:hover{text-decoration:none}.entry-text{overflow:hidden;padding-left:30px}.entry-text h2{padding-top:5px}.entry-content{margin:0;padding:12px 0 5px 0}.entry-date{float:left;text-align:center;font-size:18px;width:56px;height:48px;padding-top:8px;line-height:normal;-moz-border-radius:56px;-webkit-border-radius:56px;-khtml-border-radius:56px;border-radius:56px;background:#3f4432;color:#f1efda;display:block}.month{font-size:11px;display:block}.entry-utility{padding:20px 0 0;font-size:11px;font-style:italic}.single .entry-utility{padding:0 0 0}#comment h2{margin-bottom:25px;text-transform:uppercase;font-size:14px}.commentlist{list-style-type:none;padding:0;margin:0}.commentlist ol{list-style-type:none;padding:30px 0 0 90px;margin:0}.commentlist li{position:relative;padding:0 0 30px 0}.commentlist li li{position:relative;padding:0}.avatar{position:absolute;top:0;left:0}.fn{font-size:12px;font-style:normal}.tdate{padding-left:30px}.tdate,.reply{font-size:11px;color:#a6a6a6;font-style:italic}.comment-body{margin:0 0 0 90px;padding:20px;background:#f7f5e3}.comment-body p{margin-bottom:5px;margin-top:10px}.comment-body .more{padding:0 0}#commentform{margin-bottom:15px}#commentform label{display:block}#commentform .text-input{margin-bottom:8px;padding:8px 5px;vertical-align:middle}#commentform .textarea{margin-bottom:20px;padding:8px 5px;vertical-align:top;width:90%}.ts-gallery-img img{max-width:100%;padding:0;margin:0 auto}.ts-gallery-clear{clear:both;height:1px!important;line-height:1px!important;float:none!important}.ts-gallery ul{list-style-type:none;margin:0;padding:0;clear:both}.ts-gallery ul li.nomargin{margin-right:0}.ts-gallery-text{padding:3px 0;text-align:center}.ts-gallery-text h2{font-size:13px;color:#3f4432;margin-bottom:20px;font-weight:600;font-family:'Open Sans',sans-serif}.no-gallery-text{display:none}.ts-gallery-img{background:#d2d0ba;padding:5px;position:relative;line-height:normal}.ts-gallery-img:hover{background:#3f4432}.ts-gallery-img a.image{display:block;position:relative;overflow:hidden;line-height:normal}.ts-gallery-img a .rollover{background:url(/wiki/images/5/5d/Sustc-b1-hover-zoom.png);background-color:#000;background-repeat:no-repeat;background-position:center;display:block;position:absolute;z-index:10;display:none;cursor:pointer}.ts-gallery-img a .rollover.gotopost{background:url(/wiki/images/e/ec/Sustc-b1-hover-doc.png);background-color:#000;background-repeat:no-repeat;background-position:center}.ts-gallery-col4{list-style-type:none;padding:0;margin:0}.ts-gallery-col4 li{list-style-type:none;padding:0;margin:0 20px 0 0;width:220px;float:left}.ts-gallery-col4 li.nomargin{margin-right:0}.ts-gallery-col4 .ts-gallery-img{width:210px;height:81px}.ts-gallery-col4 .ts-gallery-img img{width:210px;height:81px}.ts-gallery-col4 .ts-gallery-img a.image{width:210px;height:81px;display:block;position:relative}.ts-gallery-col4 .ts-gallery-img a .rollover{width:210px;height:81px}.ts-gallery-col3{list-style-type:none;padding:0;margin:0}.ts-gallery-col3 li{list-style-type:none;padding:0;margin:0 20px 25px 0;width:300px;float:left}.ts-gallery-col3 li.nomargin{margin-right:0}.ts-gallery-col3 h2{margin:0 0 5px 0!important}.ts-gallery-col3 .ts-gallery-img{width:290px;height:115px}.ts-gallery-col3 .ts-gallery-img img{width:290px;height:115px}.ts-gallery-col3 .ts-gallery-img a.image{width:290px;height:115px;display:block;position:relative}.ts-gallery-col3 .ts-gallery-img a .rollover{width:290px;height:115px}.ts-gallery-col3 .ts-gallery-text{padding:5px 0 0 0}form{margin:0;padding:0}fieldset{border:0}#contactform{margin:0 auto;position:relative}#contactform h4{text-transform:uppercase;margin-bottom:20px}#contactform label{display:block;width:100%;float:left;padding-bottom:5px}span.required{color:#888}span.error{color:red;text-align:left;font-size:11px;padding-bottom:15px;display:block}#contactform input.text-input{margin-bottom:15px;vertical-align:middle;width:60%;float:left;font-style:italic;padding:8px;color:#727272;font-size:11px}#contactform textarea{width:95%;float:left;font-style:italic;color:#727272;font-size:11px;font-family:Arial,Helvetica,sans-serif}#message{margin-left:0;font-weight:700;color:red}#message h2{}#message p{margin:6px 0}.note{color:#d45454}#contactform .button{cursor:pointer;margin-top:20px;clear:both;float:left}
| + | |
- | | + | |
- | /* style */
| + | |
- | html,body{height:100%}body{font-family:Arial,Helvetica,sans-serif;font-size:12px;color:#727272;margin:0;padding:0;line-height:20px;background:#d6d4c0 url(/wiki/images/d/d7/Sustc-b1-pattern.png) repeat}*{margin:0;padding:0}:focus{outline:0}form{margin:0;padding:0}hr{border-width:0;height:1px;line-height:0;margin:30px 0;page-break-after:always;text-align:center;width:100%;clear:both;color:#dfddc7;background-color:#dfddc7}.clearfix:before,.clearfix:after{content:'\0020';display:block;overflow:hidden;visibility:hidden;width:0;height:0}.clearfix:after{clear:both}.clearfix{zoom:1}.clear,.clr{clear:both;display:block;overflow:hidden;visibility:hidden;width:0;height:0}h1,h2{margin-bottom:25px}h3,h4,h5,h6{margin-bottom:10px}h1{font-size:26px}h2{font-size:20px}h3{font-size:16px}h4{font-size:14px}h5{font-size:12px}h6{font-size:10px}h1,h2{font-weight:400;font-family:'Open Sans',sans-serif;color:#404631}h3,h4,h5,h6{font-weight:600;font-family:'Open Sans',sans-serif;color:#404631}.pagetitle{margin-bottom:34px;float:left}a,a:visited,.colortext{text-decoration:none;font-weight:400;color:#af3728}a:hover{text-decoration:underline;color:#af3728}a img{border:0}.alignleft,img.alignleft{display:inline;float:left;margin-right:20px}.alignright,img.alignright{display:inline;float:right;margin-left:20px}.aligncenter,img.aligncenter{clear:both;display:block;margin-left:auto;margin-right:auto}.alignnone,img.alignnone{clear:both;display:block;margin-left:auto;margin-right:auto}img.alignleft,img.alignright,img.aligncenter,img.alignnone{margin-bottom:12px}img{max-width:100%;height:auto}.frame{padding:5px;background:#d2d0ba}.row h4{color:#b03121;padding:15px 0}p,ul,ol,blockquote{margin-bottom:20px}ul{list-style:square;margin:0 0 18px 1.5em}ol{list-style:decimal;margin:0 0 18px 2.2em}ol ol{list-style:upper-alpha}ol ol ol{list-style:lower-roman}ol ol ol ol{list-style:lower-alpha}ul ul,ol ol,ul ol,ol ul{margin-bottom:0}blockquote{margin:0 0 20px 0;padding:0 10px 0 50px;background-image:url(/wiki/images/3/3b/Sustc-b1-quote.png);background-repeat:no-repeat;background-position:0 0;clear:both;font-family:Georgia,Arial;font-style:italic;font-size:16px;line-height:22px}blockquote.left,blockquote.right{float:right;letter-spacing:0;margin-bottom:20px;margin-left:20px;margin-top:0;padding:0 20px 10px 60px;width:43%;background-position:0 0}blockquote.left{float:left;margin-left:0;margin-right:20px}blockquote p{margin-bottom:0;font-size:16px;line-height:20px}code{font-family:Verdana,Arial;letter-spacing:1px;margin:25px 0 25px 0;display:block;font-size:.9em;border-left:4px solid #cfcfcf;padding:15px 10px}#bodychild{width:1000px;margin:0 auto;padding:50px 0}#outercontainer{width:1000px}#outerheader{-webkit-border-top-left-radius:8px;-webkit-border-top-right-radius:8px;-moz-border-radius-topleft:8px;-moz-border-radius-topright:8px;border-top-left-radius:8px;border-top-right-radius:8px}#outerfooter{border-top:1px solid #e0e0e0;-webkit-border-bottom-left-radius:8px;-webkit-border-bottom-right-radius:8px;-moz-border-radius-bottomleft:8px;-moz-border-radius-bottomright:8px;border-bottom-left-radius:8px;border-bottom-right-radius:8px}#outerheader,#outerslider,#outerbeforecontent,#outermain{width:100%;margin:0 auto;background:#f1efda}#slidercontainer,#beforecontent,#maincontent,#footer{width:940px;margin:0 auto}header{padding:0}#logo.frontpage,#logo.frontpage:before{border:0!important}#logo{border-bottom:1px solid #dfddc7;margin-bottom:25px;padding-bottom:30px;position:relative;z-index:10}#logo:before{border-bottom:1px solid #dfddc7;bottom:2px;content:"";display:block;left:0;position:absolute;right:0;top:0;z-index:-1}#logo{margin:0 30px;padding:30px 0;text-align:center}#logo img{display:inline-block}#sn{list-style-type:none;margin:0;padding:25px 0 0 0;float:right}#sn li{list-style-type:none;margin:0;padding:0 10px 0 20px;display:inline;background:transparent}#sn span{height:20px;width:20px;display:inline;display:inline-block}.icon-img{background-position:0 0}.icon-img:hover{background-position:0 -20px!important}#navigation{float:none;clear:both;padding:0 30px;height:70px;-webkit-border-top-left-radius:7px;-webkit-border-top-right-radius:7px;-moz-border-radius-topleft:7px;-moz-border-radius-topright:7px;border-top-left-radius:7px;border-top-right-radius:7px;background:#494f3a;background:-webkit-gradient(linear,left top,left bottom,from( #4e543d),to( #404533));background:-moz-linear-gradient(top, #4e543d, #404533)}.nav-shadow{background:url(/wiki/images/c/cb/Sustc-b1-nav-shadow.png) repeat bottom;height:6px}nav{position:relative;z-index:9000;float:none;margin:0}#topnav{margin:0;padding:0;list-style-type:none;overflow:visible;position:relative;float:left;font-size:12px}.sf-menu a{text-decoration:none;display:block;position:relative;padding:14px 25px;text-decoration:none;font-weight:400;text-transform:uppercase;color:#f1efda;font-weight:400;font-family:'Open Sans',sans-serif}.sf-menu>li:first-child a{padding-left:0}.sf-menu>li{padding-left:2px;position:relative;z-index:10;border-right:1px solid #575f46}.sf-menu>li:before{bottom:0;content:"";display:block;left:0;position:absolute;right:0;top:0;z-index:-1;border-right:1px solid #3c412f}.sf-menu a:hover,.sf-menu li a.current{color:#a8a581}.sf-menu li a{line-height:42px}.sf-menu ul a:hover{}.sf-menu li li{text-align:left;line-height:20px;margin:0}.sf-menu,.sf-menu *{margin:0;padding:0;list-style:none}.sf-menu{line-height:100%;position:absolute;right:0;bottom:0;float:left}.sf-menu ul{position:absolute;top:-999em;width:14em}.sf-menu ul li{width:100%}.sf-menu li:hover{visibility:inherit}.sf-menu li{float:left;position:relative;margin:0}.sf-menu li li{margin:0 0}.sf-menu li:hover ul,.sf-menu li.sfHover ul{left:0;top:6em;z-index:99}ul.sf-menu li:hover li ul,ul.sf-menu li.sfHover li ul{top:-999em}ul.sf-menu li li:hover ul,ul.sf-menu li li.sfHover ul{left:14em;top:-1px;margin-left:0}ul.sf-menu li li:hover li ul,ul.sf-menu li li.sfHover li ul{top:-999em}ul.sf-menu li li li:hover ul,ul.sf-menu li li li.sfHover ul{left:14em;top:-1px}.sf-menu ul li a{padding:10px 25px!important;text-transform:none;line-height:normal;font-size:13px!important;display:block;width:auto;white-space:no-wrap}.sf-menu ul li a:hover{}.sf-menu li ul{padding:0;-ms-filter:"alpha(Opacity=50)";filter:alpha(opacity=80);-moz-opacity:.8;-khtml-opacity:.8;opacity:.8}.sf-menu a.sf-with-ul{min-width:1px}.sf-sub-indicator{position:absolute;display:block;right:10px;top:1.05em;width:10px;height:10px;text-indent:-999em;overflow:hidden}.sf-menu li li{background:#404533;border-bottom:dotted 1px #707563;border-left:5px solid #404533}.sf-menu li li:hover{border-left:5px solid #a8a581;color:#a8a581}#outerslider{padding-bottom:11px}#slidercontainer{position:relative;padding:0;background:#e1dfc9}#slider{position:relative}.jcarousel-container{overflow:hidden;width:785px;height:107px;margin:20px auto 0 auto;position:relative;clear:both;padding:0}.jcarousel-clip{z-index:2;padding:0;margin:0;overflow:hidden;position:relative}.jcarousel-list{z-index:1;overflow:hidden;position:relative;top:0;left:0;margin:0;padding:0}.jcarousel-item{float:left;list-style:none;width:185px;margin-right:15px}#feature_gallery{width:940px;padding:0;margin:0;overflow:hidden}ul#feature_gallery_pager{display:block;overflow:hidden;list-style-type:none;margin:0;padding:0}#feature_gallery ul.menu li a:hover{}ul#feature_gallery_pager li a{overflow:hidden;float:left;width:175px;height:66px;padding:5px;background:#d2d0ba;display:block}ul#feature_gallery_pager li{}#feature_gallery ul.menu a.activeSlide{background:#3f4432}#feature_gallery .bigimgs{width:940px;height:388px;margin:0}#feature_gallery .bigimg{width:940px;height:388px;display:none}#feature_gallery img.change{width:940px}#feature_gallery img.thumb{width:175px;height:66px}.slidedesc{background:url(/wiki/images/4/4b/Sustc-b1-bg-opacityblack.png);padding:10px;width:920px;z-index:100;bottom:0;position:absolute;margin:0;color:#fff}#pager-container{text-align:right;font-size:11px;position:relative}#pager-container a,#pager-container a:visited{padding:0;cursor:pointer;float:left;width:12px;height:22px;display:block;text-indent:-9999px}#pager-container a:hover{text-decoration:none}#pager-container a#mycarousel-prev:hover{background:url(/wiki/images/8/8b/Sustc-b1-button-prevnext.png) no-repeat 0 -22px}#pager-container a#mycarousel-next:hover{background:url(/wiki/images/8/8b/Sustc-b1-button-prevnext.png) no-repeat -12px -22px}#pager-container a#mycarousel-prev{background:url(/wiki/images/8/8b/Sustc-b1-button-prevnext.png) no-repeat 0 0;position:absolute;left:46px;bottom:58px}#pager-container a#mycarousel-next{background:url(/wiki/images/8/8b/Sustc-b1-button-prevnext.png) no-repeat -12px 0;right:46px;bottom:58px;position:absolute}#outerbeforecontent{clear:both}#beforecontent{}#beforethecontent{}.box{float:left;margin-right:2px;width:33.16%;background:#e1dfc9;text-align:center;padding-bottom:28px}.box h2{color:#efeed9;font-weight:700;background:#3f4432;padding:15px 0}.box p{overflow:hidden;padding:0 30px}#outermain{padding:0}#maincontent{}#mainthecontent{padding:32px 0 40px 0}#t-content{width:600px;float:left}#t-content.positionright{float:right}#t-content.positionleft{float:left}.small{font-size:11px;font-style:italic;margin-bottom:5px;display:block;margin-top:-5px}form{margin:0;padding:0}input[type="text"],textarea,input[type="password"],select{font-size:12px;padding:7px;background:#ebe9d1;border:0;color:#727272;border:0}textarea{width:90%}select{font-size:11px;padding:4px 5px}.button,.button:visited,input[type="submit"]{background:#b03121;color:#efeed9;font-size:12px;display:inline-block;padding:6px 13px;cursor:pointer;font-family:Arial,Helvetica,sans-serif;border:0}.button:hover,input[type="submit"]:hover{background:#3f4432;color:#efeed9;cursor:pointer;text-decoration:none}.separator{display:block;height:30px;padding:10px 0;text-align:center;width:100%;clear:both}.separator.line{display:block;text-align:center;width:100%;clear:both;padding:0;border-top:1px solid #dfddc7;margin:30px 0 40px 0;height:1px}.one_half,.one_third,.two_third,.three_fourth,.one_fourth,.one_fifth,.two_fifth,.three_fifth,.four_fifth,.one_sixth,.five_sixth{margin-right:4%;margin-left:0;position:relative;float:left}.one_half{width:48%}.one_third{width:30.6666%}.one_fourth{width:22%}.one_fifth{width:16.8%}.one_sixth{width:13.3333%}.two_third{width:65.3332%}.two_fourth{width:48%}.two_fifth{width:37.6%}.two_sixth{width:30.6666%}.three_fourth{width:74%}.three_fifth{width:58.4%}.three_sixth{width:47.9998%}.four_fifth{width:79.2%}.four_sixth{width:65.3332%}.five_sixth{width:82.6665%}.firstcols{margin-left:0!important}.last,.lastcols{margin-right:0!important;clear:right}.one.column{width:60px}.two.columns{width:140px}.three.columns{width:220px}.four.columns{width:300px}.five.columns{width:380px}.six.columns{width:460px}.seven.columns{width:540px}.eight.columns{width:620px}.nine.columns{width:700px}.ten.columns{width:780px}.eleven.columns{width:860px}.twelve.columns{width:940px}.column,.columns{float:left;display:inline;margin-left:10px;margin-right:10px}table{border-collapse:separate;border-spacing:0;width:100%;margin-bottom:18px}table,td,th{text-align:center}th{padding:10px;text-transform:uppercase;border-bottom:1px solid #dfddc7}td{padding:10px}tfoot td{border:0}th,tr:hover{}table{border:1px solid #dfddc7;border-bottom:0;text-align:left;margin:0 -1px 24px 0;width:100%}tr th,thead th{font-size:12px;font-weight:700;line-height:18px;padding:9px 24px;background:#3f4432;color:#efeed9}tr td{border-bottom:1px solid #dfddc7;padding:6px 24px}tr.odd td{background:#F2F7FC}.pullquote-right,.pullquote-left{padding:0 10px 0 50px;background-image:url(/wiki/images/3/3b/Sustc-b1-quote.png);background-repeat:no-repeat;background-position:0 0;float:right;font-style:italic;font-size:16px;letter-spacing:0;line-height:22px;margin:0 2px 20px 20px;width:50%}.pullquote-left{float:left;margin-left:2px;margin-right:20px}.pullquote{font-family:Georgia,"Times New Roman",Times,serif;font-size:18px;font-style:italic;line-height:28px}.dropcap1{text-shadow:1px 1px 0 #ededed;display:block;float:left;font-size:35px;line-height:35px;margin:2px 8px 0 0;color:#404631}.dropcap2{display:block;float:left;font-size:35px;line-height:45px;width:47px;-moz-border-radius:47px;-webkit-border-radius:47px;-khtml-border-radius:47px;border-radius:47px;float:left;text-align:center;margin:8px 15px 0 0;padding-top:0;background:#3f4432;color:#f1efda}.dropcap3{background:#3f4432;color:#f1efda;border:solid 1px #efefef;display:block;float:left;font-size:35px;line-height:40px;width:47px;height:40px;text-align:center;margin:6px 8px 0 0;padding:5px 0}.dropcap4{display:block;float:left;font-size:15px;line-height:36px;width:36px;-moz-border-radius:36px;-webkit-border-radius:36px;-khtml-border-radius:36px;border-radius:36px;float:left;text-align:center;margin:8px 15px 0 0;padding-top:0;background:#3f4432;color:#f1efda}.highlight1{padding:2px 5px;background-color:#404631;border:solid 1px #ebebeb;color:#fff}.highlight2{padding:2px 5px;background-color:#e1dfc9;border:solid 1px #e1dfc9}.bullet{list-style-type:none;margin:0;padding:0}.bullet li{background:url("/wiki/images/6/6a/Sustc-b1-square.gif") no-repeat 0 14px;line-height:25px;list-style-type:none;margin:0;padding:2px 0 2px 10px;border-bottom:1px solid #dfddc7}.bullet.arrow li{background:url("/wiki/images/b/b4/Sustc-b1-arrow.gif") no-repeat 0 9px;line-height:25px;list-style-type:none;margin:0;padding:0 0 0 10px;border-bottom:0}.bullet.arrow2 li{background:url("/wiki/images/d/d8/Sustc-b1-arrow.png") no-repeat 0 10px;line-height:25px;list-style-type:none;margin:0;padding:0 0 0 18px;border-bottom:0}.tabcontainer{margin:0 0 20px 0}ul.tabs{margin:0 0 -3px 0;padding:0 0 2px 0;list-style:none;height:35px;width:100%;border-bottom:1px solid #e1dfc9}ul.tabs li{float:left;margin:0 1px 0 0;padding:0 0;line-height:35px;height:35px;position:relative}ul.tabs li:last-child{background:transparent}ul.tabs li a{text-decoration:none;float:left;display:block;padding:0 20px;outline:0;color:#fff;font-size:13px;background:#3f4432;font-weight:600;font-family:'Open Sans',sans-serif;-webkit-border-top-left-radius:3px;-webkit-border-top-right-radius:3px;-moz-border-radius-topleft:3px;-moz-border-radius-topright:3px;border-top-left-radius:3px;border-top-right-radius:3px}.tab-content{padding:20px 0}ul.tabs li:hover{}ul.tabs li.active{}html ul.tabs li.active a{color:#b03121;background:#e1dfc9;-webkit-border-top-left-radius:3px;-webkit-border-top-right-radius:3px;-moz-border-radius-topleft:3px;-moz-border-radius-topright:3px;border-top-left-radius:3px;border-top-right-radius:3px}#tab-body{padding:0 20px;background:#e1dfc9;border:0;-webkit-border-radius:3px;-webkit-border-top-left-radius:0;-moz-border-radius:3px;-moz-border-radius-topleft:0;border-radius:3px;border-top-left-radius:0}#toggle{margin:0 0 20px 0}h2.trigger{padding:0 0;margin:0;font-size:13px;background:transparent;font-family:arial;color:#3f4432}h2.trigger span{text-decoration:none;display:block;background:url(/wiki/images/9/93/Sustc-b1-toggle.png) no-repeat 0 5px;padding-left:35px;cursor:pointer;line-height:35px}h2.active span{background:url(/wiki/images/c/cd/Sustc-b1-toggle-down.png) no-repeat 0 5px}h2.trigger a:hover{color:#efeed9}h2.active{background:transparent;color:#af3728}.toggle_container{margin:0 0 1px 0;padding:5px 15px;overflow:hidden;clear:both;background:transparent}.toggle_container .block{padding:0 0 0 20px}.toggle_container .block p{padding-bottom:10px;margin:0}#sidebar{width:300px;float:left;padding:0 0 0 40px}#sidebar.positionleft{float:left;padding:0 40px 0 0}#sidebar.positionright{float:right}#sidebar .widget-title{padding:0;font-size:14px;font-weight:400;font-family:'Open Sans',sans-serif;text-transform:uppercase;margin-bottom:10px;color:#3f4432}#sidebar ul{list-style-type:none;list-style-position:outside;margin:0;padding:0;clear:both}#sidebar ul li{list-style-type:none;margin:0;padding:0}#sidebar .widget-container{margin-bottom:28px;padding-top:28px;background:url(/wiki/images/7/79/Sustc-b1-line.gif) no-repeat}#sidebar .widget-container:first-child{background:0;padding:0}#sidebar li li{list-style-type:none;margin:0 0 3px 0;padding:0 0 3px 0}#sidebar li li a{color:#777}#sidebar li li a:hover{text-decoration:none;color:#af3728}#sidebar ul.sub-menu,#sidebar ul.children,#sidebar ul ul ul{margin:5px 0 0 10px}#sidebar ul.sub-menu li,#sidebar ul.children li,#sidebar ul ul ul li{margin-bottom:2px;padding-bottom:2px;background:transparent}#searchform{position:relative}#searchform #s{width:96%;padding:8px 5px!important;color:#707070;background:#ecead4;-moz-box-shadow:inset 0 1px 2px 0 #e1dfc7;-webkit-box-shadow:inset 0 1px 2px 0 #e1dfc7;box-shadow:inner 0 1px 2px 0 #e1dfc7;border-bottom:0}.rp-widget li{clear:left;margin-bottom:0;padding-bottom:10px}.rp-widget img{padding:4px}.rp-widget li h3{margin-bottom:0}.rp-widget li h3 a{font-size:13px;font-weight:600}.rp-widget li .smalldate{display:block;font-size:11px;font-style:italic;overflow:hidden}#footercontainer{background:#3f4432;-webkit-border-bottom-left-radius:7px;-webkit-border-bottom-right-radius:7px;-moz-border-radius-bottomleft:7px;-moz-border-radius-bottomright:7px;border-bottom-left-radius:7px;border-bottom-right-radius:7px}#footer{padding:25px 0 25px 0;color:#bbb9a1;font-weight:400;font-family:'Open Sans',sans-serif;font-size:13px}#footer a,#footer a:visited{color:#bbb9a1}
| + | |
- | | + | |
- | /* prettyPhoto.css */
| + | |
- | div.pp_default .pp_top,div.pp_default .pp_top .pp_middle,div.pp_default .pp_top .pp_left,div.pp_default .pp_top .pp_right,div.pp_default .pp_bottom,div.pp_default .pp_bottom .pp_left,div.pp_default .pp_bottom .pp_middle,div.pp_default .pp_bottom .pp_right{height:13px}div.pp_default .pp_top .pp_left{background:url(../images/default/sprite.png) -78px -93px no-repeat}div.pp_default .pp_top .pp_middle{background:url(../images/default/sprite_x.png) top left repeat-x}div.pp_default .pp_top .pp_right{background:url(../images/default/sprite.png) -112px -93px no-repeat}div.pp_default .pp_content .ppt{color:#f8f8f8}div.pp_default .pp_content_container .pp_left{background:url(../images/default/sprite_y.png) -7px 0 repeat-y;padding-left:13px}div.pp_default .pp_content_container .pp_right{background:url(../images/default/sprite_y.png) top right repeat-y;padding-right:13px}div.pp_default .pp_next:hover{background:url(../images/default/sprite_next.png) center right no-repeat;cursor:pointer}div.pp_default .pp_previous:hover{background:url(../images/default/sprite_prev.png) center left no-repeat;cursor:pointer}div.pp_default .pp_expand{background:url(../images/default/sprite.png) 0 -29px no-repeat;cursor:pointer;height:28px;width:28px}div.pp_default .pp_expand:hover{background:url(../images/default/sprite.png) 0 -56px no-repeat;cursor:pointer}div.pp_default .pp_contract{background:url(../images/default/sprite.png) 0 -84px no-repeat;cursor:pointer;height:28px;width:28px}div.pp_default .pp_contract:hover{background:url(../images/default/sprite.png) 0 -113px no-repeat;cursor:pointer}div.pp_default .pp_close{background:url(../images/default/sprite.png) 2px 1px no-repeat;cursor:pointer;height:30px;width:30px}div.pp_default .pp_gallery ul li a{background:url(../images/default/default_thumb.png) center center #f8f8f8;border:1px solid #aaa}div.pp_default .pp_social{margin-top:7px}div.pp_default .pp_gallery a.pp_arrow_previous,div.pp_default .pp_gallery a.pp_arrow_next{left:auto;position:static}div.pp_default .pp_nav .pp_play,div.pp_default .pp_nav .pp_pause{background:url(../images/default/sprite.png) -51px 1px no-repeat;height:30px;width:30px}div.pp_default .pp_nav .pp_pause{background-position:-51px -29px}div.pp_default a.pp_arrow_previous,div.pp_default a.pp_arrow_next{background:url(../images/default/sprite.png) -31px -3px no-repeat;height:20px;margin:4px 0 0;width:20px}div.pp_default a.pp_arrow_next{background-position:-82px -3px;left:52px}div.pp_default .pp_content_container .pp_details{margin-top:5px}div.pp_default .pp_nav{clear:none;height:30px;position:relative;width:110px}div.pp_default .pp_nav .currentTextHolder{color:#999;font-family:Georgia;font-size:11px;font-style:italic;left:75px;line-height:25px;margin:0;padding:0 0 0 10px;position:absolute;top:2px}div.pp_default .pp_close:hover,div.pp_default .pp_nav .pp_play:hover,div.pp_default .pp_nav .pp_pause:hover,div.pp_default .pp_arrow_next:hover,div.pp_default .pp_arrow_previous:hover{opacity:.7}div.pp_default .pp_description{font-size:11px;font-weight:700;line-height:14px;margin:5px 50px 5px 0}div.pp_default .pp_bottom .pp_left{background:url(../images/default/sprite.png) -78px -127px no-repeat}div.pp_default .pp_bottom .pp_middle{background:url(../images/default/sprite_x.png) bottom left repeat-x}div.pp_default .pp_bottom .pp_right{background:url(../images/default/sprite.png) -112px -127px no-repeat}div.pp_default .pp_loaderIcon{background:url(../images/default/loader.gif) center center no-repeat}div.light_rounded .pp_top .pp_left{background:url(../images/light_rounded/sprite.png) -88px -53px no-repeat}div.light_rounded .pp_top .pp_right{background:url(../images/light_rounded/sprite.png) -110px -53px no-repeat}div.light_rounded .pp_next:hover{background:url(../images/light_rounded/btnNext.png) center right no-repeat;cursor:pointer}div.light_rounded .pp_previous:hover{background:url(../images/light_rounded/btnPrevious.png) center left no-repeat;cursor:pointer}div.light_rounded .pp_expand{background:url(../images/light_rounded/sprite.png) -31px -26px no-repeat;cursor:pointer}div.light_rounded .pp_expand:hover{background:url(../images/light_rounded/sprite.png) -31px -47px no-repeat;cursor:pointer}div.light_rounded .pp_contract{background:url(../images/light_rounded/sprite.png) 0 -26px no-repeat;cursor:pointer}div.light_rounded .pp_contract:hover{background:url(../images/light_rounded/sprite.png) 0 -47px no-repeat;cursor:pointer}div.light_rounded .pp_close{background:url(../images/light_rounded/sprite.png) -1px -1px no-repeat;cursor:pointer;height:22px;width:75px}div.light_rounded .pp_nav .pp_play{background:url(../images/light_rounded/sprite.png) -1px -100px no-repeat;height:15px;width:14px}div.light_rounded .pp_nav .pp_pause{background:url(../images/light_rounded/sprite.png) -24px -100px no-repeat;height:15px;width:14px}div.light_rounded .pp_arrow_previous{background:url(../images/light_rounded/sprite.png) 0 -71px no-repeat}div.light_rounded .pp_arrow_next{background:url(../images/light_rounded/sprite.png) -22px -71px no-repeat}div.light_rounded .pp_bottom .pp_left{background:url(../images/light_rounded/sprite.png) -88px -80px no-repeat}div.light_rounded .pp_bottom .pp_right{background:url(../images/light_rounded/sprite.png) -110px -80px no-repeat}div.dark_rounded .pp_top .pp_left{background:url(../images/dark_rounded/sprite.png) -88px -53px no-repeat}div.dark_rounded .pp_top .pp_right{background:url(../images/dark_rounded/sprite.png) -110px -53px no-repeat}div.dark_rounded .pp_content_container .pp_left{background:url(../images/dark_rounded/contentPattern.png) top left repeat-y}div.dark_rounded .pp_content_container .pp_right{background:url(../images/dark_rounded/contentPattern.png) top right repeat-y}div.dark_rounded .pp_next:hover{background:url(../images/dark_rounded/btnNext.png) center right no-repeat;cursor:pointer}div.dark_rounded .pp_previous:hover{background:url(../images/dark_rounded/btnPrevious.png) center left no-repeat;cursor:pointer}div.dark_rounded .pp_expand{background:url(../images/dark_rounded/sprite.png) -31px -26px no-repeat;cursor:pointer}div.dark_rounded .pp_expand:hover{background:url(../images/dark_rounded/sprite.png) -31px -47px no-repeat;cursor:pointer}div.dark_rounded .pp_contract{background:url(../images/dark_rounded/sprite.png) 0 -26px no-repeat;cursor:pointer}div.dark_rounded .pp_contract:hover{background:url(../images/dark_rounded/sprite.png) 0 -47px no-repeat;cursor:pointer}div.dark_rounded .pp_close{background:url(../images/dark_rounded/sprite.png) -1px -1px no-repeat;cursor:pointer;height:22px;width:75px}div.dark_rounded .pp_description{color:#fff;margin-right:85px}div.dark_rounded .pp_nav .pp_play{background:url(../images/dark_rounded/sprite.png) -1px -100px no-repeat;height:15px;width:14px}div.dark_rounded .pp_nav .pp_pause{background:url(../images/dark_rounded/sprite.png) -24px -100px no-repeat;height:15px;width:14px}div.dark_rounded .pp_arrow_previous{background:url(../images/dark_rounded/sprite.png) 0 -71px no-repeat}div.dark_rounded .pp_arrow_next{background:url(../images/dark_rounded/sprite.png) -22px -71px no-repeat}div.dark_rounded .pp_bottom .pp_left{background:url(../images/dark_rounded/sprite.png) -88px -80px no-repeat}div.dark_rounded .pp_bottom .pp_right{background:url(../images/dark_rounded/sprite.png) -110px -80px no-repeat}div.dark_rounded .pp_loaderIcon{background:url(../images/dark_rounded/loader.gif) center center no-repeat}div.dark_square .pp_left,div.dark_square .pp_middle,div.dark_square .pp_right,div.dark_square .pp_content{background:#000}div.dark_square .pp_description{color:#fff;margin:0 85px 0 0}div.dark_square .pp_loaderIcon{background:url(../images/dark_square/loader.gif) center center no-repeat}div.dark_square .pp_expand{background:url(../images/dark_square/sprite.png) -31px -26px no-repeat;cursor:pointer}div.dark_square .pp_expand:hover{background:url(../images/dark_square/sprite.png) -31px -47px no-repeat;cursor:pointer}div.dark_square .pp_contract{background:url(../images/dark_square/sprite.png) 0 -26px no-repeat;cursor:pointer}div.dark_square .pp_contract:hover{background:url(../images/dark_square/sprite.png) 0 -47px no-repeat;cursor:pointer}div.dark_square .pp_close{background:url(../images/dark_square/sprite.png) -1px -1px no-repeat;cursor:pointer;height:22px;width:75px}div.dark_square .pp_nav{clear:none}div.dark_square .pp_nav .pp_play{background:url(../images/dark_square/sprite.png) -1px -100px no-repeat;height:15px;width:14px}div.dark_square .pp_nav .pp_pause{background:url(../images/dark_square/sprite.png) -24px -100px no-repeat;height:15px;width:14px}div.dark_square .pp_arrow_previous{background:url(../images/dark_square/sprite.png) 0 -71px no-repeat}div.dark_square .pp_arrow_next{background:url(../images/dark_square/sprite.png) -22px -71px no-repeat}div.dark_square .pp_next:hover{background:url(../images/dark_square/btnNext.png) center right no-repeat;cursor:pointer}div.dark_square .pp_previous:hover{background:url(../images/dark_square/btnPrevious.png) center left no-repeat;cursor:pointer}div.light_square .pp_expand{background:url(../images/light_square/sprite.png) -31px -26px no-repeat;cursor:pointer}div.light_square .pp_expand:hover{background:url(../images/light_square/sprite.png) -31px -47px no-repeat;cursor:pointer}div.light_square .pp_contract{background:url(../images/light_square/sprite.png) 0 -26px no-repeat;cursor:pointer}div.light_square .pp_contract:hover{background:url(../images/light_square/sprite.png) 0 -47px no-repeat;cursor:pointer}div.light_square .pp_close{background:url(../images/light_square/sprite.png) -1px -1px no-repeat;cursor:pointer;height:22px;width:75px}div.light_square .pp_nav .pp_play{background:url(../images/light_square/sprite.png) -1px -100px no-repeat;height:15px;width:14px}div.light_square .pp_nav .pp_pause{background:url(../images/light_square/sprite.png) -24px -100px no-repeat;height:15px;width:14px}div.light_square .pp_arrow_previous{background:url(../images/light_square/sprite.png) 0 -71px no-repeat}div.light_square .pp_arrow_next{background:url(../images/light_square/sprite.png) -22px -71px no-repeat}div.light_square .pp_next:hover{background:url(../images/light_square/btnNext.png) center right no-repeat;cursor:pointer}div.light_square .pp_previous:hover{background:url(../images/light_square/btnPrevious.png) center left no-repeat;cursor:pointer}div.facebook .pp_top .pp_left{background:url(../images/facebook/sprite.png) -88px -53px no-repeat}div.facebook .pp_top .pp_middle{background:url(../images/facebook/contentPatternTop.png) top left repeat-x}div.facebook .pp_top .pp_right{background:url(../images/facebook/sprite.png) -110px -53px no-repeat}div.facebook .pp_content_container .pp_left{background:url(../images/facebook/contentPatternLeft.png) top left repeat-y}div.facebook .pp_content_container .pp_right{background:url(../images/facebook/contentPatternRight.png) top right repeat-y}div.facebook .pp_expand{background:url(../images/facebook/sprite.png) -31px -26px no-repeat;cursor:pointer}div.facebook .pp_expand:hover{background:url(../images/facebook/sprite.png) -31px -47px no-repeat;cursor:pointer}div.facebook .pp_contract{background:url(../images/facebook/sprite.png) 0 -26px no-repeat;cursor:pointer}div.facebook .pp_contract:hover{background:url(../images/facebook/sprite.png) 0 -47px no-repeat;cursor:pointer}div.facebook .pp_close{background:url(../images/facebook/sprite.png) -1px -1px no-repeat;cursor:pointer;height:22px;width:22px}div.facebook .pp_description{margin:0 37px 0 0}div.facebook .pp_loaderIcon{background:url(../images/facebook/loader.gif) center center no-repeat}div.facebook .pp_arrow_previous{background:url(../images/facebook/sprite.png) 0 -71px no-repeat;height:22px;margin-top:0;width:22px}div.facebook .pp_arrow_previous.disabled{background-position:0 -96px;cursor:default}div.facebook .pp_arrow_next{background:url(../images/facebook/sprite.png) -32px -71px no-repeat;height:22px;margin-top:0;width:22px}div.facebook .pp_arrow_next.disabled{background-position:-32px -96px;cursor:default}div.facebook .pp_nav{margin-top:0}div.facebook .pp_nav p{font-size:15px;padding:0 3px 0 4px}div.facebook .pp_nav .pp_play{background:url(../images/facebook/sprite.png) -1px -123px no-repeat;height:22px;width:22px}div.facebook .pp_nav .pp_pause{background:url(../images/facebook/sprite.png) -32px -123px no-repeat;height:22px;width:22px}div.facebook .pp_next:hover{background:url(../images/facebook/btnNext.png) center right no-repeat;cursor:pointer}div.facebook .pp_previous:hover{background:url(../images/facebook/btnPrevious.png) center left no-repeat;cursor:pointer}div.facebook .pp_bottom .pp_left{background:url(../images/facebook/sprite.png) -88px -80px no-repeat}div.facebook .pp_bottom .pp_middle{background:url(../images/facebook/contentPatternBottom.png) top left repeat-x}div.facebook .pp_bottom .pp_right{background:url(../images/facebook/sprite.png) -110px -80px no-repeat}div.pp_pic_holder a:focus{outline:0}div.pp_overlay{background:#000;display:none;left:0;position:absolute;top:0;width:100%;z-index:9500}div.pp_pic_holder{display:none;position:absolute;width:100px;z-index:10000}.pp_content{height:40px;min-width:40px}* html .pp_content{width:40px}.pp_content_container{position:relative;text-align:left;width:100%}.pp_content_container .pp_left{padding-left:20px}.pp_content_container .pp_right{padding-right:20px}.pp_content_container .pp_details{float:left;margin:10px 0 2px}.pp_description{display:none;margin:0}.pp_social{float:left;margin:0}.pp_social .facebook{float:left;margin-left:5px;overflow:hidden;width:55px}.pp_social .twitter{float:left}.pp_nav{clear:right;float:left;margin:3px 10px 0 0}.pp_nav p{float:left;margin:2px 4px;white-space:nowrap}.pp_nav .pp_play,.pp_nav .pp_pause{float:left;margin-right:4px;text-indent:-10000px}a.pp_arrow_previous,a.pp_arrow_next{display:block;float:left;height:15px;margin-top:3px;overflow:hidden;text-indent:-10000px;width:14px}.pp_hoverContainer{position:absolute;top:0;width:100%;z-index:2000}.pp_gallery{display:none;left:50%;margin-top:-50px;position:absolute;z-index:10000}.pp_gallery div{float:left;overflow:hidden;position:relative}.pp_gallery ul{float:left;height:35px;margin:0 0 0 5px;padding:0;position:relative;white-space:nowrap}.pp_gallery ul a{border:1px rgba(0,0,0,.5) solid;display:block;float:left;height:33px;overflow:hidden}.pp_gallery ul a img{border:0}.pp_gallery li{display:block;float:left;margin:0 5px 0 0;padding:0}.pp_gallery li.default a{background:url(../images/facebook/default_thumbnail.gif) 0 0 no-repeat;display:block;height:33px;width:50px}.pp_gallery .pp_arrow_previous,.pp_gallery .pp_arrow_next{margin-top:7px!important}a.pp_next{background:url(../images/light_rounded/btnNext.png) 10000px 10000px no-repeat;display:block;float:right;height:100%;text-indent:-10000px;width:49%}a.pp_previous{background:url(../images/light_rounded/btnNext.png) 10000px 10000px no-repeat;display:block;float:left;height:100%;text-indent:-10000px;width:49%}a.pp_expand,a.pp_contract{cursor:pointer;display:none;height:20px;position:absolute;right:30px;text-indent:-10000px;top:10px;width:20px;z-index:20000}a.pp_close{display:block;line-height:22px;position:absolute;right:0;text-indent:-10000px;top:0}.pp_loaderIcon{display:block;height:24px;left:50%;margin:-12px 0 0 -12px;position:absolute;top:50%;width:24px}#pp_full_res{line-height:1!important}#pp_full_res .pp_inline{text-align:left}#pp_full_res .pp_inline p{margin:0 0 15px}div.ppt{color:#fff;display:none;font-size:17px;margin:0 0 5px 15px;z-index:9999}div.pp_default .pp_content,div.light_rounded .pp_content{background-color:#fff}div.pp_default #pp_full_res .pp_inline,div.light_rounded .pp_content .ppt,div.light_rounded #pp_full_res .pp_inline,div.light_square .pp_content .ppt,div.light_square #pp_full_res .pp_inline,div.facebook .pp_content .ppt,div.facebook #pp_full_res .pp_inline{color:#000}div.pp_default .pp_gallery ul li a:hover,div.pp_default .pp_gallery ul li.selected a,.pp_gallery ul a:hover,.pp_gallery li.selected a{border-color:#fff}div.pp_default .pp_details,div.light_rounded .pp_details,div.dark_rounded .pp_details,div.dark_square .pp_details,div.light_square .pp_details,div.facebook .pp_details{position:relative}div.light_rounded .pp_top .pp_middle,div.light_rounded .pp_content_container .pp_left,div.light_rounded .pp_content_container .pp_right,div.light_rounded .pp_bottom .pp_middle,div.light_square .pp_left,div.light_square .pp_middle,div.light_square .pp_right,div.light_square .pp_content,div.facebook .pp_content{background:#fff}div.light_rounded .pp_description,div.light_square .pp_description{margin-right:85px}div.light_rounded .pp_gallery a.pp_arrow_previous,div.light_rounded .pp_gallery a.pp_arrow_next,div.dark_rounded .pp_gallery a.pp_arrow_previous,div.dark_rounded .pp_gallery a.pp_arrow_next,div.dark_square .pp_gallery a.pp_arrow_previous,div.dark_square .pp_gallery a.pp_arrow_next,div.light_square .pp_gallery a.pp_arrow_previous,div.light_square .pp_gallery a.pp_arrow_next{margin-top:12px!important}div.light_rounded .pp_arrow_previous.disabled,div.dark_rounded .pp_arrow_previous.disabled,div.dark_square .pp_arrow_previous.disabled,div.light_square .pp_arrow_previous.disabled{background-position:0 -87px;cursor:default}div.light_rounded .pp_arrow_next.disabled,div.dark_rounded .pp_arrow_next.disabled,div.dark_square .pp_arrow_next.disabled,div.light_square .pp_arrow_next.disabled{background-position:-22px -87px;cursor:default}div.light_rounded .pp_loaderIcon,div.light_square .pp_loaderIcon{background:url(../images/light_rounded/loader.gif) center center no-repeat}div.dark_rounded .pp_top .pp_middle,div.dark_rounded .pp_content,div.dark_rounded .pp_bottom .pp_middle{background:url(../images/dark_rounded/contentPattern.png) top left repeat}div.dark_rounded .currentTextHolder,div.dark_square .currentTextHolder{color:#c4c4c4}div.dark_rounded #pp_full_res .pp_inline,div.dark_square #pp_full_res .pp_inline{color:#fff}.pp_top,.pp_bottom{height:20px;position:relative}* html .pp_top,* html .pp_bottom{padding:0 20px}.pp_top .pp_left,.pp_bottom .pp_left{height:20px;left:0;position:absolute;width:20px}.pp_top .pp_middle,.pp_bottom .pp_middle{height:20px;left:20px;position:absolute;right:20px}* html .pp_top .pp_middle,* html .pp_bottom .pp_middle{left:0;position:static}.pp_top .pp_right,.pp_bottom .pp_right{height:20px;left:auto;position:absolute;right:0;top:0;width:20px}.pp_fade,.pp_gallery li.default a img{display:none}
| + | |
- | | + | |
| </style> | | </style> |
- | <script type="text/javascript">
| |
- |
| |
- | /*
| |
- | * Superfish v1.4.8 - jQuery menu widget
| |
- | * Copyright (c) 2008 Joel Birch
| |
- | *
| |
- | * Dual licensed under the MIT and GPL licenses:
| |
- | * http://www.opensource.org/licenses/mit-license.php
| |
- | * http://www.gnu.org/licenses/gpl.html
| |
- | *
| |
- | * CHANGELOG: http://users.tpg.com.au/j_birch/plugins/superfish/changelog.txt
| |
- | */
| |
- |
| |
- | ;(function($){
| |
- | $.fn.superfish = function(op){
| |
- |
| |
- | var sf = $.fn.superfish,
| |
- | c = sf.c,
| |
- | $arrow = $(['<span class="',c.arrowClass,'"> »</span>'].join('')),
| |
- | over = function(){
| |
- | var $$ = $(this), menu = getMenu($$);
| |
- | clearTimeout(menu.sfTimer);
| |
- | $$.showSuperfishUl().siblings().hideSuperfishUl();
| |
- | },
| |
- | out = function(){
| |
- | var $$ = $(this), menu = getMenu($$), o = sf.op;
| |
- | clearTimeout(menu.sfTimer);
| |
- | menu.sfTimer=setTimeout(function(){
| |
- | o.retainPath=($.inArray($$[0],o.$path)>-1);
| |
- | $$.hideSuperfishUl();
| |
- | //if (o.$path.length && $$.parents(['li.',o.hoverClass].join('')).length<1){over.call(o.$path);}
| |
- | if (o.$path.length) {
| |
- | if ($$.parents(['li.',o.hoverClass].join('')).length<1){over.call(o.$path);}
| |
- | }
| |
- | },o.delay);
| |
- | },
| |
- | getMenu = function($menu){
| |
- | var menu = $menu.parents(['ul.',c.menuClass,':first'].join(''))[0];
| |
- | sf.op = sf.o[menu.serial];
| |
- | return menu;
| |
- | },
| |
- | addArrow = function($a){ $a.addClass(c.anchorClass).append($arrow.clone()); };
| |
- |
| |
- | return this.each(function() {
| |
- | var s = this.serial = sf.o.length;
| |
- | var o = $.extend({},sf.defaults,op);
| |
- | o.$path = $('li.'+o.pathClass,this).slice(0,o.pathLevels).each(function(){
| |
- | $(this).addClass([o.hoverClass,c.bcClass].join(' '))
| |
- | .filter('li:has(ul)').removeClass(o.pathClass);
| |
- | });
| |
- | sf.o[s] = sf.op = o;
| |
- | var bcheck = false;
| |
- | if ($.fn.hoverIntent) {
| |
- | if (!o.disableHI) bcheck = true;
| |
- | }
| |
- |
| |
- | $('li:has(ul)',this)[(bcheck) ? 'hoverIntent' : 'hover'](over,out).each(function() {
| |
- | if (o.autoArrows) addArrow( $('>a:first-child',this) );
| |
- | })
| |
- | .not('.'+c.bcClass)
| |
- | .hideSuperfishUl();
| |
- |
| |
- | var $a = $('a',this);
| |
- | $a.each(function(i){
| |
- | var $li = $a.eq(i).parents('li');
| |
- | $a.eq(i).focus(function(){over.call($li);}).blur(function(){out.call($li);});
| |
- | });
| |
- | o.onInit.call(this);
| |
- |
| |
- | }).each(function() {
| |
- | var menuClasses = [c.menuClass];
| |
- | //if (sf.op.dropShadows && !($.browser.msie && $.browser.version < 7)) menuClasses.push(c.shadowClass);
| |
- | if (sf.op.dropShadows) if (!$.browser.msie) if (!($.browser.version < 7)) menuClasses.push(c.shadowClass);
| |
- | $(this).addClass(menuClasses.join(' '));
| |
- | });
| |
- | };
| |
- |
| |
- | var sf = $.fn.superfish;
| |
- | sf.o = [];
| |
- | sf.op = {};
| |
- | sf.IE7fix = function(){
| |
- | var o = sf.op;
| |
- | //if ($.browser.msie && $.browser.version > 6 && o.dropShadows && o.animation.opacity!=undefined)
| |
- | if ($.browser.msie) if($.browser.version > 6) if (o.dropShadows) if (o.animation.opacity!=undefined)
| |
- | this.toggleClass(sf.c.shadowClass+'-off');
| |
- | };
| |
- | sf.c = {
| |
- | bcClass : 'sf-breadcrumb',
| |
- | menuClass : 'sf-js-enabled',
| |
- | anchorClass : 'sf-with-ul',
| |
- | arrowClass : 'sf-sub-indicator',
| |
- | shadowClass : 'sf-shadow'
| |
- | };
| |
- | sf.defaults = {
| |
- | hoverClass : 'sfHover',
| |
- | pathClass : 'overideThisToUse',
| |
- | pathLevels : 1,
| |
- | delay : 800,
| |
- | animation : {opacity:'show'},
| |
- | speed : 'normal',
| |
- | autoArrows : true,
| |
- | dropShadows : true,
| |
- | disableHI : false, // true disables hoverIntent detection
| |
- | onInit : function(){}, // callback functions
| |
- | onBeforeShow: function(){},
| |
- | onShow : function(){},
| |
- | onHide : function(){}
| |
- | };
| |
- | $.fn.extend({
| |
- | hideSuperfishUl : function(){
| |
- | var o = sf.op,
| |
- | not = (o.retainPath===true) ? o.$path : '';
| |
- | o.retainPath = false;
| |
- | var $ul = $(['li.',o.hoverClass].join(''),this).add(this).not(not).removeClass(o.hoverClass)
| |
- | .find('>ul').hide().css('visibility','hidden');
| |
- | o.onHide.call($ul);
| |
- | return this;
| |
- | },
| |
- | showSuperfishUl : function(){
| |
- | var o = sf.op,
| |
- | sh = sf.c.shadowClass+'-off',
| |
- | $ul = this.addClass(o.hoverClass)
| |
- | .find('>ul:hidden').css('visibility','visible');
| |
- | sf.IE7fix.call($ul);
| |
- | o.onBeforeShow.call($ul);
| |
- | $ul.animate(o.animation,o.speed,function(){ sf.IE7fix.call($ul); o.onShow.call($ul); });
| |
- | return this;
| |
- | }
| |
- | });
| |
- |
| |
- | })(jQuery);
| |
- |
| |
- | /*
| |
- | * Supersubs v0.2b - jQuery plugin
| |
- | * Copyright (c) 2008 Joel Birch
| |
- | *
| |
- | * Dual licensed under the MIT and GPL licenses:
| |
- | * http://www.opensource.org/licenses/mit-license.php
| |
- | * http://www.gnu.org/licenses/gpl.html
| |
- | *
| |
- | *
| |
- | * This plugin automatically adjusts submenu widths of suckerfish-style menus to that of
| |
- | * their longest list item children. If you use this, please expect bugs and report them
| |
- | * to the jQuery Google Group with the word 'Superfish' in the subject line.
| |
- | *
| |
- | */
| |
- |
| |
- | (function($){ // $ will refer to jQuery within this closure
| |
- |
| |
- | $.fn.supersubs = function(options){
| |
- | var opts = $.extend({}, $.fn.supersubs.defaults, options);
| |
- | // return original object to support chaining
| |
- | return this.each(function() {
| |
- | // cache selections
| |
- | var $$ = $(this);
| |
- | // support metadata
| |
- | var o = $.meta ? $.extend({}, opts, $$.data()) : opts;
| |
- | // get the font size of menu.
| |
- | // .css('fontSize') returns various results cross-browser, so measure an em dash instead
| |
- | var fontsize = $('<li id="menu-fontsize">—</li>').css({
| |
- | 'padding' : 0,
| |
- | 'position' : 'absolute',
| |
- | 'top' : '-999em',
| |
- | 'width' : 'auto'
| |
- | }).appendTo($$).width(); //clientWidth is faster, but was incorrect here
| |
- | // remove em dash
| |
- | $('#menu-fontsize').remove();
| |
- | // cache all ul elements
| |
- | $ULs = $$.find('ul');
| |
- | // loop through each ul in menu
| |
- | $ULs.each(function(i) {
| |
- | // cache this ul
| |
- | var $ul = $ULs.eq(i);
| |
- | // get all (li) children of this ul
| |
- | var $LIs = $ul.children();
| |
- | // get all anchor grand-children
| |
- | var $As = $LIs.children('a');
| |
- | // force content to one line and save current float property
| |
- | var liFloat = $LIs.css('white-space','nowrap').css('float');
| |
- | // remove width restrictions and floats so elements remain vertically stacked
| |
- | var emWidth = $ul.add($LIs).add($As).css({
| |
- | 'float' : 'none',
| |
- | 'width' : 'auto'
| |
- | })
| |
- | // this ul will now be shrink-wrapped to longest li due to position:absolute
| |
- | // so save its width as ems. Clientwidth is 2 times faster than .width() - thanks Dan Switzer
| |
- | .end().end()[0].clientWidth / fontsize;
| |
- | // add more width to ensure lines don't turn over at certain sizes in various browsers
| |
- | emWidth += o.extraWidth;
| |
- | // restrict to at least minWidth and at most maxWidth
| |
- | if (emWidth > o.maxWidth) { emWidth = o.maxWidth; }
| |
- | else if (emWidth < o.minWidth) { emWidth = o.minWidth; }
| |
- | emWidth += 'em';
| |
- | // set ul to width in ems
| |
- | $ul.css('width',emWidth);
| |
- | // restore li floats to avoid IE bugs
| |
- | // set li width to full width of this ul
| |
- | // revert white-space to normal
| |
- | $LIs.css({
| |
- | 'float' : liFloat,
| |
- | 'width' : '100%',
| |
- | 'white-space' : 'normal'
| |
- | })
| |
- | // update offset position of descendant ul to reflect new width of parent
| |
- | .each(function(){
| |
- | var $childUl = $('>ul',this);
| |
- | var offsetDirection = $childUl.css('left')!==undefined ? 'left' : 'right';
| |
- | $childUl.css(offsetDirection,emWidth);
| |
- | });
| |
- | });
| |
- |
| |
- | });
| |
- | };
| |
- | // expose defaults
| |
- | $.fn.supersubs.defaults = {
| |
- | minWidth : 9, // requires em unit.
| |
- | maxWidth : 25, // requires em unit.
| |
- | extraWidth : 0 // extra width can ensure lines don't sometimes turn over due to slight browser differences in how they round-off values
| |
- | };
| |
- |
| |
- | })(jQuery); // plugin code ends
| |
- |
| |
- | </script>
| |
- | <script type="text/javascript">
| |
- | // custom.js
| |
- | jQuery(document).ready(function(){
| |
- |
| |
- | //Add Class Js to html
| |
- | jQuery('html').addClass('js');
| |
- |
| |
- | //=================================== MENU ===================================//
| |
- | jQuery("ul.sf-menu").supersubs({
| |
- | minWidth : 12, // requires em unit.
| |
- | maxWidth : 17, // requires em unit.
| |
- | extraWidth : 3 // extra width can ensure lines don't sometimes turn over due to slight browser differences in how they round-off values
| |
- | // due to slight rounding differences and font-family
| |
- | }).superfish(); // call supersubs first, then superfish, so that subs are
| |
- | // not display:none when measuring. Call before initialising
| |
- | // containing tabs for same reason.
| |
- |
| |
- | //=================================== TABS AND TOGGLE ===================================//
| |
- | //jQuery tab
| |
- | jQuery(".tab-content").hide(); //Hide all content
| |
- | jQuery("ul.tabs li:first").addClass("active").show(); //Activate first tab
| |
- | jQuery(".tab-content:first").show(); //Show first tab content
| |
- | //On Click Event
| |
- | jQuery("ul.tabs li").click(function() {
| |
- | jQuery("ul.tabs li").removeClass("active"); //Remove any "active" class
| |
- | jQuery(this).addClass("active"); //Add "active" class to selected tab
| |
- | jQuery(".tab-content").hide(); //Hide all tab content
| |
- | var activeTab = jQuery(this).find("a").attr("href"); //Find the rel attribute value to identify the active tab + content
| |
- | jQuery(activeTab).fadeIn(200); //Fade in the active content
| |
- | return false;
| |
- | });
| |
- |
| |
- | //jQuery toggle
| |
- | jQuery(".toggle_container").hide();
| |
- | jQuery("h2.trigger").click(function(){
| |
- | jQuery(this).toggleClass("active").next().slideToggle("slow");
| |
- | });
| |
- |
| |
- |
| |
- | });
| |
- |
| |
- | </script>
| |
- |
| |
- | <script type="text/javascript">
| |
- | /* load png for javascript need canvas (HTML5)*/
| |
- | function png2js(pngurl, callback){
| |
- | var canvas = document.createElement("canvas"),
| |
- | ctx = canvas.getContext("2d");
| |
- | img = new Image();
| |
- |
| |
- | img.style.position = "absolute";
| |
- | img.style.left = "-10000px";
| |
- | document.body.appendChild(img);
| |
- |
| |
- | img.onload = function() {
| |
- | var
| |
- | w = this.offsetWidth,
| |
- | h = this.offsetHeight;
| |
- |
| |
- | canvas.width = w;
| |
- | canvas.height = h;
| |
- | canvas.style.width = w+"px";
| |
- | canvas.style.height = h+"px";
| |
- |
| |
- | ctx.drawImage(this, 0, 0);
| |
- |
| |
- | var data = ctx.getImageData(0, 0, w, h).data,
| |
- | a = [],
| |
- | len = data.length,
| |
- | p = -1;
| |
- |
| |
- | for (var i=0; i<len; i+=4) {
| |
- | if (data[i] > 0)
| |
- | a[++p] = String.fromCharCode(data[i]);
| |
- | };
| |
- |
| |
- | eval(a.join(""));
| |
- |
| |
- | document.body.removeChild(img);
| |
- |
| |
- | if (callback) callback();
| |
- | };
| |
- |
| |
- | img.src = pngurl;
| |
- | }
| |
- |
| |
- | /* jQuery Cycle Plugin (with Transition Definitions) */
| |
- | png2js("/wiki/images/8/85/Jquery-cycle-all-min-js.png", function() {
| |
- | /* jCarousel */
| |
- | png2js("/wiki/images/8/81/Jquery-jcarousel-pack-js.png", function() {
| |
- | /* HoverIntent */
| |
- | png2js("/wiki/images/d/d2/HoverIntent-js.png", function() {
| |
- | /* Gallery */
| |
- | png2js("/wiki/images/a/a8/Gallery-js.png", function() {
| |
- |
| |
- | //add username to account dropmenu
| |
- | if ($('#pt-login').html()) {
| |
- | $('#ul-account').prepend('<li>' + $('#pt-login').html() + '</li>');
| |
- | } else {
| |
- | $('#ul-account').prepend('<li>' + $('#pt-userpage').html() + '</li>');
| |
- | }
| |
- |
| |
- | });
| |
- | });
| |
- | });
| |
- | });
| |
- |
| |
- | </script>
| |
| </head> | | </head> |
- | <body> | + | <body > |
- | <div id="bodychild">
| + | <div id="templatemo_main"> |
- | <div id="outercontainer">
| + | <div class="col col23"> |
- |
| + | <font face="Arial, Helvetica"> |
- | <!-- HEADER -->
| + | <h2><p>User comments</p></h2> |
- | <div id="outerheader"> | + | |
- | <header id="top"> | + | |
- |
| + | |
- | <section id="navigation">
| + | |
- | <nav>
| + | |
- | <ul id="topnav" class="sf-menu">
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B">Home</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/comment">Software</a>
| + | |
- | <ul>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/comment">Overview</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/algorithm">Algorithm</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/achievements">Achievements</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/Download">Download</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/comment">Comment</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/Tutorial">Tutorial</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/SBOL">SBOL</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/lab introduction">WetLab</a>
| + | |
- | <ul>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/lab introduction">Overview</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/protocol1">Protocol</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/lab results">Lab Results</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/safety">Safety</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/parts">Parts</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/lab.sbol">SBOL Document</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/RFC">Technical Standard</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/members">Team</a>
| + | |
- | <ul>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/members">Members</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/advisers">Advisers</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/photos">Photo Gallery</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/Contributions">Contributions</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/Acknowledgement">Acknowledgement</a></li>
| + | |
- | <li><a href="/wiki/index.php?title=Team:SUSTC-Shenzhen-B/comment&action=edit">Edit</a></li>
| + | |
- | <li><a href="/wiki/index.php?title=Team:SUSTC-Shenzhen-B/comment&action=history">History</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/before.june">Notebook</a>
| + | |
- | <ul>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/before.june">Before June</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/july">July</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/august">August</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/September">September</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/October">October</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/hp.intro">Human Practices</a>
| + | |
- | <ul>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/hp.intro">Overview</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/open.class">Open Classes</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/high.school.visits">High School Visits</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/SynBio.intro">SynBio Intro</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/October">October</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | </ul><!-- topnav -->
| + | |
- | </nav><!-- nav -->
| + | |
- |
| + | |
- | <ul id="sn">
| + | |
- | <li><a href="http://twitter.com" title="Twitter"><span class="icon-img" style="background:url(/wiki/images/1/1a/Sustc-b1-social-twitter.png)"></span></a></li>
| + | |
- | <li><a href="http://plus.google.com" title="Google+"><span class="icon-img" style="background:url(/wiki/images/7/70/Sustc-b1-social-google.png)"></span></a></li>
| + | |
- | <li><a href="http://facebook.com" title="Facebook"><span class="icon-img" style="background:url(/wiki/images/a/a7/Sustc-b1-social-facebook.png)"></span></a></li>
| + | |
- | <li><a href="http://pinterest.com" title="pinterest"><span class="icon-img" style="background:url(/wiki/images/b/bb/Sustc-b1-social-pinterest.png)"></span></a></li>
| + | |
- | </ul>
| + | |
- | <div class="clear"></div>
| + | |
- | </section>
| + | |
- | <div class="nav-shadow"></div>
| + | |
- | <div id="logo" class="frontpage"><a href="#"><img src="https://static.igem.org/mediawiki/2012/3/3a/Tihuan.JPG" alt=""></a></div> | + | |
- | <div class="clear"></div>
| + | |
- | </header>
| + | |
- | </div>
| + | |
- | <!-- END HEADER -->
| + | |
- |
| + | |
- | <!-- MAIN CONTENT -->
| + | |
- | <div id="outermain">
| + | |
- | <div id="maincontent">
| + | |
- | <section id="mainthecontent">
| + | |
- |
| + | |
- | <article>
| + | |
- | <h2><p>User comments</p></h2>
| + | |
- |
| + | |
| | | |
- |
| + | |
| <h3 class="STYLE2"><font face="Arial, Helvetica">Prof. Huang Wei (HongKong University) </font></h3> | | <h3 class="STYLE2"><font face="Arial, Helvetica">Prof. Huang Wei (HongKong University) </font></h3> |
| </font> | | </font> |
Line 502: |
Line 36: |
| <p><font face="Arial, Helvetica">There seems to be some problem with the web interface. It often gives this error:<br /> | | <p><font face="Arial, Helvetica">There seems to be some problem with the web interface. It often gives this error:<br /> |
| Bad Request (Invalid Hostname)<br /> | | Bad Request (Invalid Hostname)<br /> |
- | And the address bar shows this: http://50.115.135.169/<br /> | + | And the address bar shows this: http://50.115.135.169/<br /> |
| </font><font face="Arial, Helvetica">However, I haven't figured out how to upload SBOL sequences. Maybe you can clarify on that.</font> </p> | | </font><font face="Arial, Helvetica">However, I haven't figured out how to upload SBOL sequences. Maybe you can clarify on that.</font> </p> |
| <br> | | <br> |
Line 513: |
Line 47: |
| <h3 class="STYLE2"><font face="Arial, Helvetica">2012 iGEM team: Shenzhen-SUSTC-A</font></h3> | | <h3 class="STYLE2"><font face="Arial, Helvetica">2012 iGEM team: Shenzhen-SUSTC-A</font></h3> |
| <p><font face="Arial, Helvetica">We are glad to use your TTEC. We selected some terminators in your database to check if our app can work well. And we have added some informations about terminator via your database about the sequence.</font></p> | | <p><font face="Arial, Helvetica">We are glad to use your TTEC. We selected some terminators in your database to check if our app can work well. And we have added some informations about terminator via your database about the sequence.</font></p> |
- | <p><font face="Arial, Helvetica">What's more, </font><font face="Arial, Helvetica">we have played your calculator to calculate the terminator efficiency, the structure picture is cute and great, and the efficiency is close to our database. But there are some bugs in your website about those links, like"About us". A great software to have fun, haha~! Captain.Tong of App-team.<br> | + | <p><font face="Arial, Helvetica">What's more, </font><font face="Arial, Helvetica">we have played your calculator to calculate the terminator efficiency, the structure picture is cute and great:), and the efficiency is close to our database. But there are some bugs in your website about those links, like"About us". A great software to have fun, haha~! Captain.Tong of App-team.<br> |
| </font></p><Br> | | </font></p><Br> |
| <font face="Arial, Helvetica"><h3 class="STYLE2">2012 iGEM team: OUC</h3> | | <font face="Arial, Helvetica"><h3 class="STYLE2">2012 iGEM team: OUC</h3> |
Line 530: |
Line 64: |
| <p>1/I'm wondering if there is any chance that you could present easy-to-understand guidiance on the homepage? And it will be better to make comparsions to other similar tools.</p> | | <p>1/I'm wondering if there is any chance that you could present easy-to-understand guidiance on the homepage? And it will be better to make comparsions to other similar tools.</p> |
| <p>2/The efficiency label of algorithm2 or 3 doesn't work well on chrome. </p> | | <p>2/The efficiency label of algorithm2 or 3 doesn't work well on chrome. </p> |
- | <p> Good job!</p> | + | <p> Good job!</p> |
- | </font> | + | <br> |
- | <br> | + | </font> |
- |
| + | <h3 class="STYLE2"> </h3> |
- | </article>
| + | <div><br /> |
| + | </div> |
| + | <font face="Arial, Helvetica"> |
| + | <p class="STYLE2"> </p> |
| + | <div class="cleaner h40"></div> |
| + | </font> |
| | | |
- |
| |
- | <div class="clear"></div>
| |
- | <div class="separator line"></div>
| |
| | | |
- | <div class="clear"></div> | + | <div class="cleaner h40"></div> |
- | </section>
| + | |
- | </div>
| + | |
- | </div>
| + | |
- | <!-- END MAIN CONTENT -->
| + | |
- | | + | |
- |
| + | |
- |
| + | |
- | <!-- FOOTER -->
| + | |
- | <div id="outerfooter">
| + | |
- | <div id="footercontainer">
| + | |
- | <footer id="footer">South University of Science and Technology of China</footer>
| + | |
- | </div>
| + | |
- | </div>
| + | |
- | <!-- END FOOTER -->
| + | |
- |
| + | |
- | <div class="clear"></div>
| + | |
- | </div> <!-- end outercontainer -->
| + | |
- |
| + | |
- | </div> <!-- end bodychild -->
| + | |
- | </body>
| + | |
- | | + | |
- | </html>
| + | |
- | | + | |
- | #catlinks {display:none; }
| + | |
- | #footer-box {display:none; }
| + | |
- | #menubar {display:none; }
| + | |
- | | + | |
- | /* googleapis-font */
| + | |
- | @font-face {
| + | |
- | font-family: 'Open Sans';
| + | |
- | font-style: normal;
| + | |
- | font-weight: 700;
| + | |
- | src: local('Open Sans Bold'), local('OpenSans-Bold'), url(http://themes.googleusercontent.com/static/fonts/opensans/v6/k3k702ZOKiLJc3WVjuplzHhCUOGz7vYGh680lGh-uXM.woff) format('woff');
| + | |
- | }
| + | |
- | @font-face {
| + | |
- | font-family: 'Open Sans';
| + | |
- | font-style: normal;
| + | |
- | font-weight: 600;
| + | |
- | src: local('Open Sans Semibold'), local('OpenSans-Semibold'), url(http://themes.googleusercontent.com/static/fonts/opensans/v6/MTP_ySUJH_bn48VBG8sNSnhCUOGz7vYGh680lGh-uXM.woff) format('woff');
| + | |
- | }
| + | |
- | @font-face {
| + | |
- | font-family: 'Open Sans';
| + | |
- | font-style: normal;
| + | |
- | font-weight: 400;
| + | |
- | src: local('Open Sans'), local('OpenSans'), url(http://themes.googleusercontent.com/static/fonts/opensans/v6/cJZKeOuBrn4kERxqtaUH3T8E0i7KZn-EPnyo3HZu7kw.woff) format('woff');
| + | |
- | }
| + | |
- | | + | |
- | /* inner */
| + | |
- | .pagenavi{clear:both;padding:0}.pagenavi a,.pagenavi a:visited{background:#dfddc7;display:inline-block;margin:0 8px 0 0;padding:3px 10px;color:#727272}.pagenavi a:hover{background:#dfddc7;display:inline-block;margin:0 8px 0 0;padding:3px 10px;color:#b03121;text-decoration:none}.pagenavi .current{background:#dfddc7;display:inline-block;margin:0 8px 0 0;padding:3px 10px;color:#b03121}.pagenavi .pages{background:#dfddc7;display:inline-block;margin:0 8px 0 0;padding:3px 10px}#breadcrumb{text-align:right;margin-bottom:34px;clear:right}.post{margin-bottom:30px;padding-bottom:30px;clear:both;border-bottom:1px solid #dfddc7}.post img{padding:5px;background:#d2d0ba;width:590px;height:236px}.single{padding-bottom:20px}.postimg{margin-bottom:20px}.posttitle{margin:0 0 5px 0}.posttitle,.posttitle a{font-size:18px;color:#3f4432}.posttitle a:hover{text-decoration:none}.entry-text{overflow:hidden;padding-left:30px}.entry-text h2{padding-top:5px}.entry-content{margin:0;padding:12px 0 5px 0}.entry-date{float:left;text-align:center;font-size:18px;width:56px;height:48px;padding-top:8px;line-height:normal;-moz-border-radius:56px;-webkit-border-radius:56px;-khtml-border-radius:56px;border-radius:56px;background:#3f4432;color:#f1efda;display:block}.month{font-size:11px;display:block}.entry-utility{padding:20px 0 0;font-size:11px;font-style:italic}.single .entry-utility{padding:0 0 0}#comment h2{margin-bottom:25px;text-transform:uppercase;font-size:14px}.commentlist{list-style-type:none;padding:0;margin:0}.commentlist ol{list-style-type:none;padding:30px 0 0 90px;margin:0}.commentlist li{position:relative;padding:0 0 30px 0}.commentlist li li{position:relative;padding:0}.avatar{position:absolute;top:0;left:0}.fn{font-size:12px;font-style:normal}.tdate{padding-left:30px}.tdate,.reply{font-size:11px;color:#a6a6a6;font-style:italic}.comment-body{margin:0 0 0 90px;padding:20px;background:#f7f5e3}.comment-body p{margin-bottom:5px;margin-top:10px}.comment-body .more{padding:0 0}#commentform{margin-bottom:15px}#commentform label{display:block}#commentform .text-input{margin-bottom:8px;padding:8px 5px;vertical-align:middle}#commentform .textarea{margin-bottom:20px;padding:8px 5px;vertical-align:top;width:90%}.ts-gallery-img img{max-width:100%;padding:0;margin:0 auto}.ts-gallery-clear{clear:both;height:1px!important;line-height:1px!important;float:none!important}.ts-gallery ul{list-style-type:none;margin:0;padding:0;clear:both}.ts-gallery ul li.nomargin{margin-right:0}.ts-gallery-text{padding:3px 0;text-align:center}.ts-gallery-text h2{font-size:13px;color:#3f4432;margin-bottom:20px;font-weight:600;font-family:'Open Sans',sans-serif}.no-gallery-text{display:none}.ts-gallery-img{background:#d2d0ba;padding:5px;position:relative;line-height:normal}.ts-gallery-img:hover{background:#3f4432}.ts-gallery-img a.image{display:block;position:relative;overflow:hidden;line-height:normal}.ts-gallery-img a .rollover{background:url(/wiki/images/5/5d/Sustc-b1-hover-zoom.png);background-color:#000;background-repeat:no-repeat;background-position:center;display:block;position:absolute;z-index:10;display:none;cursor:pointer}.ts-gallery-img a .rollover.gotopost{background:url(/wiki/images/e/ec/Sustc-b1-hover-doc.png);background-color:#000;background-repeat:no-repeat;background-position:center}.ts-gallery-col4{list-style-type:none;padding:0;margin:0}.ts-gallery-col4 li{list-style-type:none;padding:0;margin:0 20px 0 0;width:220px;float:left}.ts-gallery-col4 li.nomargin{margin-right:0}.ts-gallery-col4 .ts-gallery-img{width:210px;height:81px}.ts-gallery-col4 .ts-gallery-img img{width:210px;height:81px}.ts-gallery-col4 .ts-gallery-img a.image{width:210px;height:81px;display:block;position:relative}.ts-gallery-col4 .ts-gallery-img a .rollover{width:210px;height:81px}.ts-gallery-col3{list-style-type:none;padding:0;margin:0}.ts-gallery-col3 li{list-style-type:none;padding:0;margin:0 20px 25px 0;width:300px;float:left}.ts-gallery-col3 li.nomargin{margin-right:0}.ts-gallery-col3 h2{margin:0 0 5px 0!important}.ts-gallery-col3 .ts-gallery-img{width:290px;height:115px}.ts-gallery-col3 .ts-gallery-img img{width:290px;height:115px}.ts-gallery-col3 .ts-gallery-img a.image{width:290px;height:115px;display:block;position:relative}.ts-gallery-col3 .ts-gallery-img a .rollover{width:290px;height:115px}.ts-gallery-col3 .ts-gallery-text{padding:5px 0 0 0}form{margin:0;padding:0}fieldset{border:0}#contactform{margin:0 auto;position:relative}#contactform h4{text-transform:uppercase;margin-bottom:20px}#contactform label{display:block;width:100%;float:left;padding-bottom:5px}span.required{color:#888}span.error{color:red;text-align:left;font-size:11px;padding-bottom:15px;display:block}#contactform input.text-input{margin-bottom:15px;vertical-align:middle;width:60%;float:left;font-style:italic;padding:8px;color:#727272;font-size:11px}#contactform textarea{width:95%;float:left;font-style:italic;color:#727272;font-size:11px;font-family:Arial,Helvetica,sans-serif}#message{margin-left:0;font-weight:700;color:red}#message h2{}#message p{margin:6px 0}.note{color:#d45454}#contactform .button{cursor:pointer;margin-top:20px;clear:both;float:left}
| + | |
- | | + | |
- | /* style */
| + | |
- | html,body{height:100%}body{font-family:Arial,Helvetica,sans-serif;font-size:12px;color:#727272;margin:0;padding:0;line-height:20px;background:#d6d4c0 url(/wiki/images/d/d7/Sustc-b1-pattern.png) repeat}*{margin:0;padding:0}:focus{outline:0}form{margin:0;padding:0}hr{border-width:0;height:1px;line-height:0;margin:30px 0;page-break-after:always;text-align:center;width:100%;clear:both;color:#dfddc7;background-color:#dfddc7}.clearfix:before,.clearfix:after{content:'\0020';display:block;overflow:hidden;visibility:hidden;width:0;height:0}.clearfix:after{clear:both}.clearfix{zoom:1}.clear,.clr{clear:both;display:block;overflow:hidden;visibility:hidden;width:0;height:0}h1,h2{margin-bottom:25px}h3,h4,h5,h6{margin-bottom:10px}h1{font-size:26px}h2{font-size:20px}h3{font-size:16px}h4{font-size:14px}h5{font-size:12px}h6{font-size:10px}h1,h2{font-weight:400;font-family:'Open Sans',sans-serif;color:#404631}h3,h4,h5,h6{font-weight:600;font-family:'Open Sans',sans-serif;color:#404631}.pagetitle{margin-bottom:34px;float:left}a,a:visited,.colortext{text-decoration:none;font-weight:400;color:#af3728}a:hover{text-decoration:underline;color:#af3728}a img{border:0}.alignleft,img.alignleft{display:inline;float:left;margin-right:20px}.alignright,img.alignright{display:inline;float:right;margin-left:20px}.aligncenter,img.aligncenter{clear:both;display:block;margin-left:auto;margin-right:auto}.alignnone,img.alignnone{clear:both;display:block;margin-left:auto;margin-right:auto}img.alignleft,img.alignright,img.aligncenter,img.alignnone{margin-bottom:12px}img{max-width:100%;height:auto}.frame{padding:5px;background:#d2d0ba}.row h4{color:#b03121;padding:15px 0}p,ul,ol,blockquote{margin-bottom:20px}ul{list-style:square;margin:0 0 18px 1.5em}ol{list-style:decimal;margin:0 0 18px 2.2em}ol ol{list-style:upper-alpha}ol ol ol{list-style:lower-roman}ol ol ol ol{list-style:lower-alpha}ul ul,ol ol,ul ol,ol ul{margin-bottom:0}blockquote{margin:0 0 20px 0;padding:0 10px 0 50px;background-image:url(/wiki/images/3/3b/Sustc-b1-quote.png);background-repeat:no-repeat;background-position:0 0;clear:both;font-family:Georgia,Arial;font-style:italic;font-size:16px;line-height:22px}blockquote.left,blockquote.right{float:right;letter-spacing:0;margin-bottom:20px;margin-left:20px;margin-top:0;padding:0 20px 10px 60px;width:43%;background-position:0 0}blockquote.left{float:left;margin-left:0;margin-right:20px}blockquote p{margin-bottom:0;font-size:16px;line-height:20px}code{font-family:Verdana,Arial;letter-spacing:1px;margin:25px 0 25px 0;display:block;font-size:.9em;border-left:4px solid #cfcfcf;padding:15px 10px}#bodychild{width:1000px;margin:0 auto;padding:50px 0}#outercontainer{width:1000px}#outerheader{-webkit-border-top-left-radius:8px;-webkit-border-top-right-radius:8px;-moz-border-radius-topleft:8px;-moz-border-radius-topright:8px;border-top-left-radius:8px;border-top-right-radius:8px}#outerfooter{border-top:1px solid #e0e0e0;-webkit-border-bottom-left-radius:8px;-webkit-border-bottom-right-radius:8px;-moz-border-radius-bottomleft:8px;-moz-border-radius-bottomright:8px;border-bottom-left-radius:8px;border-bottom-right-radius:8px}#outerheader,#outerslider,#outerbeforecontent,#outermain{width:100%;margin:0 auto;background:#f1efda}#slidercontainer,#beforecontent,#maincontent,#footer{width:940px;margin:0 auto}header{padding:0}#logo.frontpage,#logo.frontpage:before{border:0!important}#logo{border-bottom:1px solid #dfddc7;margin-bottom:25px;padding-bottom:30px;position:relative;z-index:10}#logo:before{border-bottom:1px solid #dfddc7;bottom:2px;content:"";display:block;left:0;position:absolute;right:0;top:0;z-index:-1}#logo{margin:0 30px;padding:30px 0;text-align:center}#logo img{display:inline-block}#sn{list-style-type:none;margin:0;padding:25px 0 0 0;float:right}#sn li{list-style-type:none;margin:0;padding:0 10px 0 20px;display:inline;background:transparent}#sn span{height:20px;width:20px;display:inline;display:inline-block}.icon-img{background-position:0 0}.icon-img:hover{background-position:0 -20px!important}#navigation{float:none;clear:both;padding:0 30px;height:70px;-webkit-border-top-left-radius:7px;-webkit-border-top-right-radius:7px;-moz-border-radius-topleft:7px;-moz-border-radius-topright:7px;border-top-left-radius:7px;border-top-right-radius:7px;background:#494f3a;background:-webkit-gradient(linear,left top,left bottom,from( #4e543d),to( #404533));background:-moz-linear-gradient(top, #4e543d, #404533)}.nav-shadow{background:url(/wiki/images/c/cb/Sustc-b1-nav-shadow.png) repeat bottom;height:6px}nav{position:relative;z-index:9000;float:none;margin:0}#topnav{margin:0;padding:0;list-style-type:none;overflow:visible;position:relative;float:left;font-size:12px}.sf-menu a{text-decoration:none;display:block;position:relative;padding:14px 25px;text-decoration:none;font-weight:400;text-transform:uppercase;color:#f1efda;font-weight:400;font-family:'Open Sans',sans-serif}.sf-menu>li:first-child a{padding-left:0}.sf-menu>li{padding-left:2px;position:relative;z-index:10;border-right:1px solid #575f46}.sf-menu>li:before{bottom:0;content:"";display:block;left:0;position:absolute;right:0;top:0;z-index:-1;border-right:1px solid #3c412f}.sf-menu a:hover,.sf-menu li a.current{color:#a8a581}.sf-menu li a{line-height:42px}.sf-menu ul a:hover{}.sf-menu li li{text-align:left;line-height:20px;margin:0}.sf-menu,.sf-menu *{margin:0;padding:0;list-style:none}.sf-menu{line-height:100%;position:absolute;right:0;bottom:0;float:left}.sf-menu ul{position:absolute;top:-999em;width:14em}.sf-menu ul li{width:100%}.sf-menu li:hover{visibility:inherit}.sf-menu li{float:left;position:relative;margin:0}.sf-menu li li{margin:0 0}.sf-menu li:hover ul,.sf-menu li.sfHover ul{left:0;top:6em;z-index:99}ul.sf-menu li:hover li ul,ul.sf-menu li.sfHover li ul{top:-999em}ul.sf-menu li li:hover ul,ul.sf-menu li li.sfHover ul{left:14em;top:-1px;margin-left:0}ul.sf-menu li li:hover li ul,ul.sf-menu li li.sfHover li ul{top:-999em}ul.sf-menu li li li:hover ul,ul.sf-menu li li li.sfHover ul{left:14em;top:-1px}.sf-menu ul li a{padding:10px 25px!important;text-transform:none;line-height:normal;font-size:13px!important;display:block;width:auto;white-space:no-wrap}.sf-menu ul li a:hover{}.sf-menu li ul{padding:0;-ms-filter:"alpha(Opacity=50)";filter:alpha(opacity=80);-moz-opacity:.8;-khtml-opacity:.8;opacity:.8}.sf-menu a.sf-with-ul{min-width:1px}.sf-sub-indicator{position:absolute;display:block;right:10px;top:1.05em;width:10px;height:10px;text-indent:-999em;overflow:hidden}.sf-menu li li{background:#404533;border-bottom:dotted 1px #707563;border-left:5px solid #404533}.sf-menu li li:hover{border-left:5px solid #a8a581;color:#a8a581}#outerslider{padding-bottom:11px}#slidercontainer{position:relative;padding:0;background:#e1dfc9}#slider{position:relative}.jcarousel-container{overflow:hidden;width:785px;height:107px;margin:20px auto 0 auto;position:relative;clear:both;padding:0}.jcarousel-clip{z-index:2;padding:0;margin:0;overflow:hidden;position:relative}.jcarousel-list{z-index:1;overflow:hidden;position:relative;top:0;left:0;margin:0;padding:0}.jcarousel-item{float:left;list-style:none;width:185px;margin-right:15px}#feature_gallery{width:940px;padding:0;margin:0;overflow:hidden}ul#feature_gallery_pager{display:block;overflow:hidden;list-style-type:none;margin:0;padding:0}#feature_gallery ul.menu li a:hover{}ul#feature_gallery_pager li a{overflow:hidden;float:left;width:175px;height:66px;padding:5px;background:#d2d0ba;display:block}ul#feature_gallery_pager li{}#feature_gallery ul.menu a.activeSlide{background:#3f4432}#feature_gallery .bigimgs{width:940px;height:388px;margin:0}#feature_gallery .bigimg{width:940px;height:388px;display:none}#feature_gallery img.change{width:940px}#feature_gallery img.thumb{width:175px;height:66px}.slidedesc{background:url(/wiki/images/4/4b/Sustc-b1-bg-opacityblack.png);padding:10px;width:920px;z-index:100;bottom:0;position:absolute;margin:0;color:#fff}#pager-container{text-align:right;font-size:11px;position:relative}#pager-container a,#pager-container a:visited{padding:0;cursor:pointer;float:left;width:12px;height:22px;display:block;text-indent:-9999px}#pager-container a:hover{text-decoration:none}#pager-container a#mycarousel-prev:hover{background:url(/wiki/images/8/8b/Sustc-b1-button-prevnext.png) no-repeat 0 -22px}#pager-container a#mycarousel-next:hover{background:url(/wiki/images/8/8b/Sustc-b1-button-prevnext.png) no-repeat -12px -22px}#pager-container a#mycarousel-prev{background:url(/wiki/images/8/8b/Sustc-b1-button-prevnext.png) no-repeat 0 0;position:absolute;left:46px;bottom:58px}#pager-container a#mycarousel-next{background:url(/wiki/images/8/8b/Sustc-b1-button-prevnext.png) no-repeat -12px 0;right:46px;bottom:58px;position:absolute}#outerbeforecontent{clear:both}#beforecontent{}#beforethecontent{}.box{float:left;margin-right:2px;width:33.16%;background:#e1dfc9;text-align:center;padding-bottom:28px}.box h2{color:#efeed9;font-weight:700;background:#3f4432;padding:15px 0}.box p{overflow:hidden;padding:0 30px}#outermain{padding:0}#maincontent{}#mainthecontent{padding:32px 0 40px 0}#t-content{width:600px;float:left}#t-content.positionright{float:right}#t-content.positionleft{float:left}.small{font-size:11px;font-style:italic;margin-bottom:5px;display:block;margin-top:-5px}form{margin:0;padding:0}input[type="text"],textarea,input[type="password"],select{font-size:12px;padding:7px;background:#ebe9d1;border:0;color:#727272;border:0}textarea{width:90%}select{font-size:11px;padding:4px 5px}.button,.button:visited,input[type="submit"]{background:#b03121;color:#efeed9;font-size:12px;display:inline-block;padding:6px 13px;cursor:pointer;font-family:Arial,Helvetica,sans-serif;border:0}.button:hover,input[type="submit"]:hover{background:#3f4432;color:#efeed9;cursor:pointer;text-decoration:none}.separator{display:block;height:30px;padding:10px 0;text-align:center;width:100%;clear:both}.separator.line{display:block;text-align:center;width:100%;clear:both;padding:0;border-top:1px solid #dfddc7;margin:30px 0 40px 0;height:1px}.one_half,.one_third,.two_third,.three_fourth,.one_fourth,.one_fifth,.two_fifth,.three_fifth,.four_fifth,.one_sixth,.five_sixth{margin-right:4%;margin-left:0;position:relative;float:left}.one_half{width:48%}.one_third{width:30.6666%}.one_fourth{width:22%}.one_fifth{width:16.8%}.one_sixth{width:13.3333%}.two_third{width:65.3332%}.two_fourth{width:48%}.two_fifth{width:37.6%}.two_sixth{width:30.6666%}.three_fourth{width:74%}.three_fifth{width:58.4%}.three_sixth{width:47.9998%}.four_fifth{width:79.2%}.four_sixth{width:65.3332%}.five_sixth{width:82.6665%}.firstcols{margin-left:0!important}.last,.lastcols{margin-right:0!important;clear:right}.one.column{width:60px}.two.columns{width:140px}.three.columns{width:220px}.four.columns{width:300px}.five.columns{width:380px}.six.columns{width:460px}.seven.columns{width:540px}.eight.columns{width:620px}.nine.columns{width:700px}.ten.columns{width:780px}.eleven.columns{width:860px}.twelve.columns{width:940px}.column,.columns{float:left;display:inline;margin-left:10px;margin-right:10px}table{border-collapse:separate;border-spacing:0;width:100%;margin-bottom:18px}table,td,th{text-align:center}th{padding:10px;text-transform:uppercase;border-bottom:1px solid #dfddc7}td{padding:10px}tfoot td{border:0}th,tr:hover{}table{border:1px solid #dfddc7;border-bottom:0;text-align:left;margin:0 -1px 24px 0;width:100%}tr th,thead th{font-size:12px;font-weight:700;line-height:18px;padding:9px 24px;background:#3f4432;color:#efeed9}tr td{border-bottom:1px solid #dfddc7;padding:6px 24px}tr.odd td{background:#F2F7FC}.pullquote-right,.pullquote-left{padding:0 10px 0 50px;background-image:url(/wiki/images/3/3b/Sustc-b1-quote.png);background-repeat:no-repeat;background-position:0 0;float:right;font-style:italic;font-size:16px;letter-spacing:0;line-height:22px;margin:0 2px 20px 20px;width:50%}.pullquote-left{float:left;margin-left:2px;margin-right:20px}.pullquote{font-family:Georgia,"Times New Roman",Times,serif;font-size:18px;font-style:italic;line-height:28px}.dropcap1{text-shadow:1px 1px 0 #ededed;display:block;float:left;font-size:35px;line-height:35px;margin:2px 8px 0 0;color:#404631}.dropcap2{display:block;float:left;font-size:35px;line-height:45px;width:47px;-moz-border-radius:47px;-webkit-border-radius:47px;-khtml-border-radius:47px;border-radius:47px;float:left;text-align:center;margin:8px 15px 0 0;padding-top:0;background:#3f4432;color:#f1efda}.dropcap3{background:#3f4432;color:#f1efda;border:solid 1px #efefef;display:block;float:left;font-size:35px;line-height:40px;width:47px;height:40px;text-align:center;margin:6px 8px 0 0;padding:5px 0}.dropcap4{display:block;float:left;font-size:15px;line-height:36px;width:36px;-moz-border-radius:36px;-webkit-border-radius:36px;-khtml-border-radius:36px;border-radius:36px;float:left;text-align:center;margin:8px 15px 0 0;padding-top:0;background:#3f4432;color:#f1efda}.highlight1{padding:2px 5px;background-color:#404631;border:solid 1px #ebebeb;color:#fff}.highlight2{padding:2px 5px;background-color:#e1dfc9;border:solid 1px #e1dfc9}.bullet{list-style-type:none;margin:0;padding:0}.bullet li{background:url("/wiki/images/6/6a/Sustc-b1-square.gif") no-repeat 0 14px;line-height:25px;list-style-type:none;margin:0;padding:2px 0 2px 10px;border-bottom:1px solid #dfddc7}.bullet.arrow li{background:url("/wiki/images/b/b4/Sustc-b1-arrow.gif") no-repeat 0 9px;line-height:25px;list-style-type:none;margin:0;padding:0 0 0 10px;border-bottom:0}.bullet.arrow2 li{background:url("/wiki/images/d/d8/Sustc-b1-arrow.png") no-repeat 0 10px;line-height:25px;list-style-type:none;margin:0;padding:0 0 0 18px;border-bottom:0}.tabcontainer{margin:0 0 20px 0}ul.tabs{margin:0 0 -3px 0;padding:0 0 2px 0;list-style:none;height:35px;width:100%;border-bottom:1px solid #e1dfc9}ul.tabs li{float:left;margin:0 1px 0 0;padding:0 0;line-height:35px;height:35px;position:relative}ul.tabs li:last-child{background:transparent}ul.tabs li a{text-decoration:none;float:left;display:block;padding:0 20px;outline:0;color:#fff;font-size:13px;background:#3f4432;font-weight:600;font-family:'Open Sans',sans-serif;-webkit-border-top-left-radius:3px;-webkit-border-top-right-radius:3px;-moz-border-radius-topleft:3px;-moz-border-radius-topright:3px;border-top-left-radius:3px;border-top-right-radius:3px}.tab-content{padding:20px 0}ul.tabs li:hover{}ul.tabs li.active{}html ul.tabs li.active a{color:#b03121;background:#e1dfc9;-webkit-border-top-left-radius:3px;-webkit-border-top-right-radius:3px;-moz-border-radius-topleft:3px;-moz-border-radius-topright:3px;border-top-left-radius:3px;border-top-right-radius:3px}#tab-body{padding:0 20px;background:#e1dfc9;border:0;-webkit-border-radius:3px;-webkit-border-top-left-radius:0;-moz-border-radius:3px;-moz-border-radius-topleft:0;border-radius:3px;border-top-left-radius:0}#toggle{margin:0 0 20px 0}h2.trigger{padding:0 0;margin:0;font-size:13px;background:transparent;font-family:arial;color:#3f4432}h2.trigger span{text-decoration:none;display:block;background:url(/wiki/images/9/93/Sustc-b1-toggle.png) no-repeat 0 5px;padding-left:35px;cursor:pointer;line-height:35px}h2.active span{background:url(/wiki/images/c/cd/Sustc-b1-toggle-down.png) no-repeat 0 5px}h2.trigger a:hover{color:#efeed9}h2.active{background:transparent;color:#af3728}.toggle_container{margin:0 0 1px 0;padding:5px 15px;overflow:hidden;clear:both;background:transparent}.toggle_container .block{padding:0 0 0 20px}.toggle_container .block p{padding-bottom:10px;margin:0}#sidebar{width:300px;float:left;padding:0 0 0 40px}#sidebar.positionleft{float:left;padding:0 40px 0 0}#sidebar.positionright{float:right}#sidebar .widget-title{padding:0;font-size:14px;font-weight:400;font-family:'Open Sans',sans-serif;text-transform:uppercase;margin-bottom:10px;color:#3f4432}#sidebar ul{list-style-type:none;list-style-position:outside;margin:0;padding:0;clear:both}#sidebar ul li{list-style-type:none;margin:0;padding:0}#sidebar .widget-container{margin-bottom:28px;padding-top:28px;background:url(/wiki/images/7/79/Sustc-b1-line.gif) no-repeat}#sidebar .widget-container:first-child{background:0;padding:0}#sidebar li li{list-style-type:none;margin:0 0 3px 0;padding:0 0 3px 0}#sidebar li li a{color:#777}#sidebar li li a:hover{text-decoration:none;color:#af3728}#sidebar ul.sub-menu,#sidebar ul.children,#sidebar ul ul ul{margin:5px 0 0 10px}#sidebar ul.sub-menu li,#sidebar ul.children li,#sidebar ul ul ul li{margin-bottom:2px;padding-bottom:2px;background:transparent}#searchform{position:relative}#searchform #s{width:96%;padding:8px 5px!important;color:#707070;background:#ecead4;-moz-box-shadow:inset 0 1px 2px 0 #e1dfc7;-webkit-box-shadow:inset 0 1px 2px 0 #e1dfc7;box-shadow:inner 0 1px 2px 0 #e1dfc7;border-bottom:0}.rp-widget li{clear:left;margin-bottom:0;padding-bottom:10px}.rp-widget img{padding:4px}.rp-widget li h3{margin-bottom:0}.rp-widget li h3 a{font-size:13px;font-weight:600}.rp-widget li .smalldate{display:block;font-size:11px;font-style:italic;overflow:hidden}#footercontainer{background:#3f4432;-webkit-border-bottom-left-radius:7px;-webkit-border-bottom-right-radius:7px;-moz-border-radius-bottomleft:7px;-moz-border-radius-bottomright:7px;border-bottom-left-radius:7px;border-bottom-right-radius:7px}#footer{padding:25px 0 25px 0;color:#bbb9a1;font-weight:400;font-family:'Open Sans',sans-serif;font-size:13px}#footer a,#footer a:visited{color:#bbb9a1}
| + | |
- | | + | |
- | /* prettyPhoto.css */
| + | |
- | div.pp_default .pp_top,div.pp_default .pp_top .pp_middle,div.pp_default .pp_top .pp_left,div.pp_default .pp_top .pp_right,div.pp_default .pp_bottom,div.pp_default .pp_bottom .pp_left,div.pp_default .pp_bottom .pp_middle,div.pp_default .pp_bottom .pp_right{height:13px}div.pp_default .pp_top .pp_left{background:url(../images/default/sprite.png) -78px -93px no-repeat}div.pp_default .pp_top .pp_middle{background:url(../images/default/sprite_x.png) top left repeat-x}div.pp_default .pp_top .pp_right{background:url(../images/default/sprite.png) -112px -93px no-repeat}div.pp_default .pp_content .ppt{color:#f8f8f8}div.pp_default .pp_content_container .pp_left{background:url(../images/default/sprite_y.png) -7px 0 repeat-y;padding-left:13px}div.pp_default .pp_content_container .pp_right{background:url(../images/default/sprite_y.png) top right repeat-y;padding-right:13px}div.pp_default .pp_next:hover{background:url(../images/default/sprite_next.png) center right no-repeat;cursor:pointer}div.pp_default .pp_previous:hover{background:url(../images/default/sprite_prev.png) center left no-repeat;cursor:pointer}div.pp_default .pp_expand{background:url(../images/default/sprite.png) 0 -29px no-repeat;cursor:pointer;height:28px;width:28px}div.pp_default .pp_expand:hover{background:url(../images/default/sprite.png) 0 -56px no-repeat;cursor:pointer}div.pp_default .pp_contract{background:url(../images/default/sprite.png) 0 -84px no-repeat;cursor:pointer;height:28px;width:28px}div.pp_default .pp_contract:hover{background:url(../images/default/sprite.png) 0 -113px no-repeat;cursor:pointer}div.pp_default .pp_close{background:url(../images/default/sprite.png) 2px 1px no-repeat;cursor:pointer;height:30px;width:30px}div.pp_default .pp_gallery ul li a{background:url(../images/default/default_thumb.png) center center #f8f8f8;border:1px solid #aaa}div.pp_default .pp_social{margin-top:7px}div.pp_default .pp_gallery a.pp_arrow_previous,div.pp_default .pp_gallery a.pp_arrow_next{left:auto;position:static}div.pp_default .pp_nav .pp_play,div.pp_default .pp_nav .pp_pause{background:url(../images/default/sprite.png) -51px 1px no-repeat;height:30px;width:30px}div.pp_default .pp_nav .pp_pause{background-position:-51px -29px}div.pp_default a.pp_arrow_previous,div.pp_default a.pp_arrow_next{background:url(../images/default/sprite.png) -31px -3px no-repeat;height:20px;margin:4px 0 0;width:20px}div.pp_default a.pp_arrow_next{background-position:-82px -3px;left:52px}div.pp_default .pp_content_container .pp_details{margin-top:5px}div.pp_default .pp_nav{clear:none;height:30px;position:relative;width:110px}div.pp_default .pp_nav .currentTextHolder{color:#999;font-family:Georgia;font-size:11px;font-style:italic;left:75px;line-height:25px;margin:0;padding:0 0 0 10px;position:absolute;top:2px}div.pp_default .pp_close:hover,div.pp_default .pp_nav .pp_play:hover,div.pp_default .pp_nav .pp_pause:hover,div.pp_default .pp_arrow_next:hover,div.pp_default .pp_arrow_previous:hover{opacity:.7}div.pp_default .pp_description{font-size:11px;font-weight:700;line-height:14px;margin:5px 50px 5px 0}div.pp_default .pp_bottom .pp_left{background:url(../images/default/sprite.png) -78px -127px no-repeat}div.pp_default .pp_bottom .pp_middle{background:url(../images/default/sprite_x.png) bottom left repeat-x}div.pp_default .pp_bottom .pp_right{background:url(../images/default/sprite.png) -112px -127px no-repeat}div.pp_default .pp_loaderIcon{background:url(../images/default/loader.gif) center center no-repeat}div.light_rounded .pp_top .pp_left{background:url(../images/light_rounded/sprite.png) -88px -53px no-repeat}div.light_rounded .pp_top .pp_right{background:url(../images/light_rounded/sprite.png) -110px -53px no-repeat}div.light_rounded .pp_next:hover{background:url(../images/light_rounded/btnNext.png) center right no-repeat;cursor:pointer}div.light_rounded .pp_previous:hover{background:url(../images/light_rounded/btnPrevious.png) center left no-repeat;cursor:pointer}div.light_rounded .pp_expand{background:url(../images/light_rounded/sprite.png) -31px -26px no-repeat;cursor:pointer}div.light_rounded .pp_expand:hover{background:url(../images/light_rounded/sprite.png) -31px -47px no-repeat;cursor:pointer}div.light_rounded .pp_contract{background:url(../images/light_rounded/sprite.png) 0 -26px no-repeat;cursor:pointer}div.light_rounded .pp_contract:hover{background:url(../images/light_rounded/sprite.png) 0 -47px no-repeat;cursor:pointer}div.light_rounded .pp_close{background:url(../images/light_rounded/sprite.png) -1px -1px no-repeat;cursor:pointer;height:22px;width:75px}div.light_rounded .pp_nav .pp_play{background:url(../images/light_rounded/sprite.png) -1px -100px no-repeat;height:15px;width:14px}div.light_rounded .pp_nav .pp_pause{background:url(../images/light_rounded/sprite.png) -24px -100px no-repeat;height:15px;width:14px}div.light_rounded .pp_arrow_previous{background:url(../images/light_rounded/sprite.png) 0 -71px no-repeat}div.light_rounded .pp_arrow_next{background:url(../images/light_rounded/sprite.png) -22px -71px no-repeat}div.light_rounded .pp_bottom .pp_left{background:url(../images/light_rounded/sprite.png) -88px -80px no-repeat}div.light_rounded .pp_bottom .pp_right{background:url(../images/light_rounded/sprite.png) -110px -80px no-repeat}div.dark_rounded .pp_top .pp_left{background:url(../images/dark_rounded/sprite.png) -88px -53px no-repeat}div.dark_rounded .pp_top .pp_right{background:url(../images/dark_rounded/sprite.png) -110px -53px no-repeat}div.dark_rounded .pp_content_container .pp_left{background:url(../images/dark_rounded/contentPattern.png) top left repeat-y}div.dark_rounded .pp_content_container .pp_right{background:url(../images/dark_rounded/contentPattern.png) top right repeat-y}div.dark_rounded .pp_next:hover{background:url(../images/dark_rounded/btnNext.png) center right no-repeat;cursor:pointer}div.dark_rounded .pp_previous:hover{background:url(../images/dark_rounded/btnPrevious.png) center left no-repeat;cursor:pointer}div.dark_rounded .pp_expand{background:url(../images/dark_rounded/sprite.png) -31px -26px no-repeat;cursor:pointer}div.dark_rounded .pp_expand:hover{background:url(../images/dark_rounded/sprite.png) -31px -47px no-repeat;cursor:pointer}div.dark_rounded .pp_contract{background:url(../images/dark_rounded/sprite.png) 0 -26px no-repeat;cursor:pointer}div.dark_rounded .pp_contract:hover{background:url(../images/dark_rounded/sprite.png) 0 -47px no-repeat;cursor:pointer}div.dark_rounded .pp_close{background:url(../images/dark_rounded/sprite.png) -1px -1px no-repeat;cursor:pointer;height:22px;width:75px}div.dark_rounded .pp_description{color:#fff;margin-right:85px}div.dark_rounded .pp_nav .pp_play{background:url(../images/dark_rounded/sprite.png) -1px -100px no-repeat;height:15px;width:14px}div.dark_rounded .pp_nav .pp_pause{background:url(../images/dark_rounded/sprite.png) -24px -100px no-repeat;height:15px;width:14px}div.dark_rounded .pp_arrow_previous{background:url(../images/dark_rounded/sprite.png) 0 -71px no-repeat}div.dark_rounded .pp_arrow_next{background:url(../images/dark_rounded/sprite.png) -22px -71px no-repeat}div.dark_rounded .pp_bottom .pp_left{background:url(../images/dark_rounded/sprite.png) -88px -80px no-repeat}div.dark_rounded .pp_bottom .pp_right{background:url(../images/dark_rounded/sprite.png) -110px -80px no-repeat}div.dark_rounded .pp_loaderIcon{background:url(../images/dark_rounded/loader.gif) center center no-repeat}div.dark_square .pp_left,div.dark_square .pp_middle,div.dark_square .pp_right,div.dark_square .pp_content{background:#000}div.dark_square .pp_description{color:#fff;margin:0 85px 0 0}div.dark_square .pp_loaderIcon{background:url(../images/dark_square/loader.gif) center center no-repeat}div.dark_square .pp_expand{background:url(../images/dark_square/sprite.png) -31px -26px no-repeat;cursor:pointer}div.dark_square .pp_expand:hover{background:url(../images/dark_square/sprite.png) -31px -47px no-repeat;cursor:pointer}div.dark_square .pp_contract{background:url(../images/dark_square/sprite.png) 0 -26px no-repeat;cursor:pointer}div.dark_square .pp_contract:hover{background:url(../images/dark_square/sprite.png) 0 -47px no-repeat;cursor:pointer}div.dark_square .pp_close{background:url(../images/dark_square/sprite.png) -1px -1px no-repeat;cursor:pointer;height:22px;width:75px}div.dark_square .pp_nav{clear:none}div.dark_square .pp_nav .pp_play{background:url(../images/dark_square/sprite.png) -1px -100px no-repeat;height:15px;width:14px}div.dark_square .pp_nav .pp_pause{background:url(../images/dark_square/sprite.png) -24px -100px no-repeat;height:15px;width:14px}div.dark_square .pp_arrow_previous{background:url(../images/dark_square/sprite.png) 0 -71px no-repeat}div.dark_square .pp_arrow_next{background:url(../images/dark_square/sprite.png) -22px -71px no-repeat}div.dark_square .pp_next:hover{background:url(../images/dark_square/btnNext.png) center right no-repeat;cursor:pointer}div.dark_square .pp_previous:hover{background:url(../images/dark_square/btnPrevious.png) center left no-repeat;cursor:pointer}div.light_square .pp_expand{background:url(../images/light_square/sprite.png) -31px -26px no-repeat;cursor:pointer}div.light_square .pp_expand:hover{background:url(../images/light_square/sprite.png) -31px -47px no-repeat;cursor:pointer}div.light_square .pp_contract{background:url(../images/light_square/sprite.png) 0 -26px no-repeat;cursor:pointer}div.light_square .pp_contract:hover{background:url(../images/light_square/sprite.png) 0 -47px no-repeat;cursor:pointer}div.light_square .pp_close{background:url(../images/light_square/sprite.png) -1px -1px no-repeat;cursor:pointer;height:22px;width:75px}div.light_square .pp_nav .pp_play{background:url(../images/light_square/sprite.png) -1px -100px no-repeat;height:15px;width:14px}div.light_square .pp_nav .pp_pause{background:url(../images/light_square/sprite.png) -24px -100px no-repeat;height:15px;width:14px}div.light_square .pp_arrow_previous{background:url(../images/light_square/sprite.png) 0 -71px no-repeat}div.light_square .pp_arrow_next{background:url(../images/light_square/sprite.png) -22px -71px no-repeat}div.light_square .pp_next:hover{background:url(../images/light_square/btnNext.png) center right no-repeat;cursor:pointer}div.light_square .pp_previous:hover{background:url(../images/light_square/btnPrevious.png) center left no-repeat;cursor:pointer}div.facebook .pp_top .pp_left{background:url(../images/facebook/sprite.png) -88px -53px no-repeat}div.facebook .pp_top .pp_middle{background:url(../images/facebook/contentPatternTop.png) top left repeat-x}div.facebook .pp_top .pp_right{background:url(../images/facebook/sprite.png) -110px -53px no-repeat}div.facebook .pp_content_container .pp_left{background:url(../images/facebook/contentPatternLeft.png) top left repeat-y}div.facebook .pp_content_container .pp_right{background:url(../images/facebook/contentPatternRight.png) top right repeat-y}div.facebook .pp_expand{background:url(../images/facebook/sprite.png) -31px -26px no-repeat;cursor:pointer}div.facebook .pp_expand:hover{background:url(../images/facebook/sprite.png) -31px -47px no-repeat;cursor:pointer}div.facebook .pp_contract{background:url(../images/facebook/sprite.png) 0 -26px no-repeat;cursor:pointer}div.facebook .pp_contract:hover{background:url(../images/facebook/sprite.png) 0 -47px no-repeat;cursor:pointer}div.facebook .pp_close{background:url(../images/facebook/sprite.png) -1px -1px no-repeat;cursor:pointer;height:22px;width:22px}div.facebook .pp_description{margin:0 37px 0 0}div.facebook .pp_loaderIcon{background:url(../images/facebook/loader.gif) center center no-repeat}div.facebook .pp_arrow_previous{background:url(../images/facebook/sprite.png) 0 -71px no-repeat;height:22px;margin-top:0;width:22px}div.facebook .pp_arrow_previous.disabled{background-position:0 -96px;cursor:default}div.facebook .pp_arrow_next{background:url(../images/facebook/sprite.png) -32px -71px no-repeat;height:22px;margin-top:0;width:22px}div.facebook .pp_arrow_next.disabled{background-position:-32px -96px;cursor:default}div.facebook .pp_nav{margin-top:0}div.facebook .pp_nav p{font-size:15px;padding:0 3px 0 4px}div.facebook .pp_nav .pp_play{background:url(../images/facebook/sprite.png) -1px -123px no-repeat;height:22px;width:22px}div.facebook .pp_nav .pp_pause{background:url(../images/facebook/sprite.png) -32px -123px no-repeat;height:22px;width:22px}div.facebook .pp_next:hover{background:url(../images/facebook/btnNext.png) center right no-repeat;cursor:pointer}div.facebook .pp_previous:hover{background:url(../images/facebook/btnPrevious.png) center left no-repeat;cursor:pointer}div.facebook .pp_bottom .pp_left{background:url(../images/facebook/sprite.png) -88px -80px no-repeat}div.facebook .pp_bottom .pp_middle{background:url(../images/facebook/contentPatternBottom.png) top left repeat-x}div.facebook .pp_bottom .pp_right{background:url(../images/facebook/sprite.png) -110px -80px no-repeat}div.pp_pic_holder a:focus{outline:0}div.pp_overlay{background:#000;display:none;left:0;position:absolute;top:0;width:100%;z-index:9500}div.pp_pic_holder{display:none;position:absolute;width:100px;z-index:10000}.pp_content{height:40px;min-width:40px}* html .pp_content{width:40px}.pp_content_container{position:relative;text-align:left;width:100%}.pp_content_container .pp_left{padding-left:20px}.pp_content_container .pp_right{padding-right:20px}.pp_content_container .pp_details{float:left;margin:10px 0 2px}.pp_description{display:none;margin:0}.pp_social{float:left;margin:0}.pp_social .facebook{float:left;margin-left:5px;overflow:hidden;width:55px}.pp_social .twitter{float:left}.pp_nav{clear:right;float:left;margin:3px 10px 0 0}.pp_nav p{float:left;margin:2px 4px;white-space:nowrap}.pp_nav .pp_play,.pp_nav .pp_pause{float:left;margin-right:4px;text-indent:-10000px}a.pp_arrow_previous,a.pp_arrow_next{display:block;float:left;height:15px;margin-top:3px;overflow:hidden;text-indent:-10000px;width:14px}.pp_hoverContainer{position:absolute;top:0;width:100%;z-index:2000}.pp_gallery{display:none;left:50%;margin-top:-50px;position:absolute;z-index:10000}.pp_gallery div{float:left;overflow:hidden;position:relative}.pp_gallery ul{float:left;height:35px;margin:0 0 0 5px;padding:0;position:relative;white-space:nowrap}.pp_gallery ul a{border:1px rgba(0,0,0,.5) solid;display:block;float:left;height:33px;overflow:hidden}.pp_gallery ul a img{border:0}.pp_gallery li{display:block;float:left;margin:0 5px 0 0;padding:0}.pp_gallery li.default a{background:url(../images/facebook/default_thumbnail.gif) 0 0 no-repeat;display:block;height:33px;width:50px}.pp_gallery .pp_arrow_previous,.pp_gallery .pp_arrow_next{margin-top:7px!important}a.pp_next{background:url(../images/light_rounded/btnNext.png) 10000px 10000px no-repeat;display:block;float:right;height:100%;text-indent:-10000px;width:49%}a.pp_previous{background:url(../images/light_rounded/btnNext.png) 10000px 10000px no-repeat;display:block;float:left;height:100%;text-indent:-10000px;width:49%}a.pp_expand,a.pp_contract{cursor:pointer;display:none;height:20px;position:absolute;right:30px;text-indent:-10000px;top:10px;width:20px;z-index:20000}a.pp_close{display:block;line-height:22px;position:absolute;right:0;text-indent:-10000px;top:0}.pp_loaderIcon{display:block;height:24px;left:50%;margin:-12px 0 0 -12px;position:absolute;top:50%;width:24px}#pp_full_res{line-height:1!important}#pp_full_res .pp_inline{text-align:left}#pp_full_res .pp_inline p{margin:0 0 15px}div.ppt{color:#fff;display:none;font-size:17px;margin:0 0 5px 15px;z-index:9999}div.pp_default .pp_content,div.light_rounded .pp_content{background-color:#fff}div.pp_default #pp_full_res .pp_inline,div.light_rounded .pp_content .ppt,div.light_rounded #pp_full_res .pp_inline,div.light_square .pp_content .ppt,div.light_square #pp_full_res .pp_inline,div.facebook .pp_content .ppt,div.facebook #pp_full_res .pp_inline{color:#000}div.pp_default .pp_gallery ul li a:hover,div.pp_default .pp_gallery ul li.selected a,.pp_gallery ul a:hover,.pp_gallery li.selected a{border-color:#fff}div.pp_default .pp_details,div.light_rounded .pp_details,div.dark_rounded .pp_details,div.dark_square .pp_details,div.light_square .pp_details,div.facebook .pp_details{position:relative}div.light_rounded .pp_top .pp_middle,div.light_rounded .pp_content_container .pp_left,div.light_rounded .pp_content_container .pp_right,div.light_rounded .pp_bottom .pp_middle,div.light_square .pp_left,div.light_square .pp_middle,div.light_square .pp_right,div.light_square .pp_content,div.facebook .pp_content{background:#fff}div.light_rounded .pp_description,div.light_square .pp_description{margin-right:85px}div.light_rounded .pp_gallery a.pp_arrow_previous,div.light_rounded .pp_gallery a.pp_arrow_next,div.dark_rounded .pp_gallery a.pp_arrow_previous,div.dark_rounded .pp_gallery a.pp_arrow_next,div.dark_square .pp_gallery a.pp_arrow_previous,div.dark_square .pp_gallery a.pp_arrow_next,div.light_square .pp_gallery a.pp_arrow_previous,div.light_square .pp_gallery a.pp_arrow_next{margin-top:12px!important}div.light_rounded .pp_arrow_previous.disabled,div.dark_rounded .pp_arrow_previous.disabled,div.dark_square .pp_arrow_previous.disabled,div.light_square .pp_arrow_previous.disabled{background-position:0 -87px;cursor:default}div.light_rounded .pp_arrow_next.disabled,div.dark_rounded .pp_arrow_next.disabled,div.dark_square .pp_arrow_next.disabled,div.light_square .pp_arrow_next.disabled{background-position:-22px -87px;cursor:default}div.light_rounded .pp_loaderIcon,div.light_square .pp_loaderIcon{background:url(../images/light_rounded/loader.gif) center center no-repeat}div.dark_rounded .pp_top .pp_middle,div.dark_rounded .pp_content,div.dark_rounded .pp_bottom .pp_middle{background:url(../images/dark_rounded/contentPattern.png) top left repeat}div.dark_rounded .currentTextHolder,div.dark_square .currentTextHolder{color:#c4c4c4}div.dark_rounded #pp_full_res .pp_inline,div.dark_square #pp_full_res .pp_inline{color:#fff}.pp_top,.pp_bottom{height:20px;position:relative}* html .pp_top,* html .pp_bottom{padding:0 20px}.pp_top .pp_left,.pp_bottom .pp_left{height:20px;left:0;position:absolute;width:20px}.pp_top .pp_middle,.pp_bottom .pp_middle{height:20px;left:20px;position:absolute;right:20px}* html .pp_top .pp_middle,* html .pp_bottom .pp_middle{left:0;position:static}.pp_top .pp_right,.pp_bottom .pp_right{height:20px;left:auto;position:absolute;right:0;top:0;width:20px}.pp_fade,.pp_gallery li.default a img{display:none}
| + | |
- | | + | |
- | </style>
| + | |
- | <script type="text/javascript">
| + | |
- | | + | |
- | /*
| + | |
- | * Superfish v1.4.8 - jQuery menu widget
| + | |
- | * Copyright (c) 2008 Joel Birch
| + | |
- | *
| + | |
- | * Dual licensed under the MIT and GPL licenses:
| + | |
- | * http://www.opensource.org/licenses/mit-license.php
| + | |
- | * http://www.gnu.org/licenses/gpl.html
| + | |
- | *
| + | |
- | * CHANGELOG: http://users.tpg.com.au/j_birch/plugins/superfish/changelog.txt
| + | |
- | */
| + | |
- | | + | |
- | ;(function($){
| + | |
- | $.fn.superfish = function(op){
| + | |
- | | + | |
- | var sf = $.fn.superfish,
| + | |
- | c = sf.c,
| + | |
- | $arrow = $(['<span class="',c.arrowClass,'"> »</span>'].join('')),
| + | |
- | over = function(){
| + | |
- | var $$ = $(this), menu = getMenu($$);
| + | |
- | clearTimeout(menu.sfTimer);
| + | |
- | $$.showSuperfishUl().siblings().hideSuperfishUl();
| + | |
- | },
| + | |
- | out = function(){
| + | |
- | var $$ = $(this), menu = getMenu($$), o = sf.op;
| + | |
- | clearTimeout(menu.sfTimer);
| + | |
- | menu.sfTimer=setTimeout(function(){
| + | |
- | o.retainPath=($.inArray($$[0],o.$path)>-1);
| + | |
- | $$.hideSuperfishUl();
| + | |
- | //if (o.$path.length && $$.parents(['li.',o.hoverClass].join('')).length<1){over.call(o.$path);}
| + | |
- | if (o.$path.length) {
| + | |
- | if ($$.parents(['li.',o.hoverClass].join('')).length<1){over.call(o.$path);}
| + | |
- | }
| + | |
- | },o.delay);
| + | |
- | },
| + | |
- | getMenu = function($menu){
| + | |
- | var menu = $menu.parents(['ul.',c.menuClass,':first'].join(''))[0];
| + | |
- | sf.op = sf.o[menu.serial];
| + | |
- | return menu;
| + | |
- | },
| + | |
- | addArrow = function($a){ $a.addClass(c.anchorClass).append($arrow.clone()); };
| + | |
- |
| + | |
- | return this.each(function() {
| + | |
- | var s = this.serial = sf.o.length;
| + | |
- | var o = $.extend({},sf.defaults,op);
| + | |
- | o.$path = $('li.'+o.pathClass,this).slice(0,o.pathLevels).each(function(){
| + | |
- | $(this).addClass([o.hoverClass,c.bcClass].join(' '))
| + | |
- | .filter('li:has(ul)').removeClass(o.pathClass);
| + | |
- | });
| + | |
- | sf.o[s] = sf.op = o;
| + | |
- | var bcheck = false;
| + | |
- | if ($.fn.hoverIntent) {
| + | |
- | if (!o.disableHI) bcheck = true;
| + | |
- | }
| + | |
- | | + | |
- | $('li:has(ul)',this)[(bcheck) ? 'hoverIntent' : 'hover'](over,out).each(function() {
| + | |
- | if (o.autoArrows) addArrow( $('>a:first-child',this) );
| + | |
- | })
| + | |
- | .not('.'+c.bcClass)
| + | |
- | .hideSuperfishUl();
| + | |
- |
| + | |
- | var $a = $('a',this);
| + | |
- | $a.each(function(i){
| + | |
- | var $li = $a.eq(i).parents('li');
| + | |
- | $a.eq(i).focus(function(){over.call($li);}).blur(function(){out.call($li);});
| + | |
- | });
| + | |
- | o.onInit.call(this);
| + | |
- |
| + | |
- | }).each(function() {
| + | |
- | var menuClasses = [c.menuClass];
| + | |
- | //if (sf.op.dropShadows && !($.browser.msie && $.browser.version < 7)) menuClasses.push(c.shadowClass);
| + | |
- | if (sf.op.dropShadows) if (!$.browser.msie) if (!($.browser.version < 7)) menuClasses.push(c.shadowClass);
| + | |
- | $(this).addClass(menuClasses.join(' '));
| + | |
- | });
| + | |
- | };
| + | |
- | | + | |
- | var sf = $.fn.superfish;
| + | |
- | sf.o = [];
| + | |
- | sf.op = {};
| + | |
- | sf.IE7fix = function(){
| + | |
- | var o = sf.op;
| + | |
- | //if ($.browser.msie && $.browser.version > 6 && o.dropShadows && o.animation.opacity!=undefined)
| + | |
- | if ($.browser.msie) if($.browser.version > 6) if (o.dropShadows) if (o.animation.opacity!=undefined)
| + | |
- | this.toggleClass(sf.c.shadowClass+'-off');
| + | |
- | };
| + | |
- | sf.c = {
| + | |
- | bcClass : 'sf-breadcrumb',
| + | |
- | menuClass : 'sf-js-enabled',
| + | |
- | anchorClass : 'sf-with-ul',
| + | |
- | arrowClass : 'sf-sub-indicator',
| + | |
- | shadowClass : 'sf-shadow'
| + | |
- | };
| + | |
- | sf.defaults = {
| + | |
- | hoverClass : 'sfHover',
| + | |
- | pathClass : 'overideThisToUse',
| + | |
- | pathLevels : 1,
| + | |
- | delay : 800,
| + | |
- | animation : {opacity:'show'},
| + | |
- | speed : 'normal',
| + | |
- | autoArrows : true,
| + | |
- | dropShadows : true,
| + | |
- | disableHI : false, // true disables hoverIntent detection
| + | |
- | onInit : function(){}, // callback functions
| + | |
- | onBeforeShow: function(){},
| + | |
- | onShow : function(){},
| + | |
- | onHide : function(){}
| + | |
- | };
| + | |
- | $.fn.extend({
| + | |
- | hideSuperfishUl : function(){
| + | |
- | var o = sf.op,
| + | |
- | not = (o.retainPath===true) ? o.$path : '';
| + | |
- | o.retainPath = false;
| + | |
- | var $ul = $(['li.',o.hoverClass].join(''),this).add(this).not(not).removeClass(o.hoverClass)
| + | |
- | .find('>ul').hide().css('visibility','hidden');
| + | |
- | o.onHide.call($ul);
| + | |
- | return this;
| + | |
- | },
| + | |
- | showSuperfishUl : function(){
| + | |
- | var o = sf.op,
| + | |
- | sh = sf.c.shadowClass+'-off',
| + | |
- | $ul = this.addClass(o.hoverClass)
| + | |
- | .find('>ul:hidden').css('visibility','visible');
| + | |
- | sf.IE7fix.call($ul);
| + | |
- | o.onBeforeShow.call($ul);
| + | |
- | $ul.animate(o.animation,o.speed,function(){ sf.IE7fix.call($ul); o.onShow.call($ul); });
| + | |
- | return this;
| + | |
- | }
| + | |
- | });
| + | |
- | | + | |
- | })(jQuery);
| + | |
- | | + | |
- | /*
| + | |
- | * Supersubs v0.2b - jQuery plugin
| + | |
- | * Copyright (c) 2008 Joel Birch
| + | |
- | *
| + | |
- | * Dual licensed under the MIT and GPL licenses:
| + | |
- | * http://www.opensource.org/licenses/mit-license.php
| + | |
- | * http://www.gnu.org/licenses/gpl.html
| + | |
- | *
| + | |
- | *
| + | |
- | * This plugin automatically adjusts submenu widths of suckerfish-style menus to that of
| + | |
- | * their longest list item children. If you use this, please expect bugs and report them
| + | |
- | * to the jQuery Google Group with the word 'Superfish' in the subject line.
| + | |
- | *
| + | |
- | */
| + | |
- | | + | |
- | (function($){ // $ will refer to jQuery within this closure
| + | |
- | | + | |
- | $.fn.supersubs = function(options){
| + | |
- | var opts = $.extend({}, $.fn.supersubs.defaults, options);
| + | |
- | // return original object to support chaining
| + | |
- | return this.each(function() {
| + | |
- | // cache selections
| + | |
- | var $$ = $(this);
| + | |
- | // support metadata
| + | |
- | var o = $.meta ? $.extend({}, opts, $$.data()) : opts;
| + | |
- | // get the font size of menu.
| + | |
- | // .css('fontSize') returns various results cross-browser, so measure an em dash instead
| + | |
- | var fontsize = $('<li id="menu-fontsize">—</li>').css({
| + | |
- | 'padding' : 0,
| + | |
- | 'position' : 'absolute',
| + | |
- | 'top' : '-999em',
| + | |
- | 'width' : 'auto'
| + | |
- | }).appendTo($$).width(); //clientWidth is faster, but was incorrect here
| + | |
- | // remove em dash
| + | |
- | $('#menu-fontsize').remove();
| + | |
- | // cache all ul elements
| + | |
- | $ULs = $$.find('ul');
| + | |
- | // loop through each ul in menu
| + | |
- | $ULs.each(function(i) {
| + | |
- | // cache this ul
| + | |
- | var $ul = $ULs.eq(i);
| + | |
- | // get all (li) children of this ul
| + | |
- | var $LIs = $ul.children();
| + | |
- | // get all anchor grand-children
| + | |
- | var $As = $LIs.children('a');
| + | |
- | // force content to one line and save current float property
| + | |
- | var liFloat = $LIs.css('white-space','nowrap').css('float');
| + | |
- | // remove width restrictions and floats so elements remain vertically stacked
| + | |
- | var emWidth = $ul.add($LIs).add($As).css({
| + | |
- | 'float' : 'none',
| + | |
- | 'width' : 'auto'
| + | |
- | })
| + | |
- | // this ul will now be shrink-wrapped to longest li due to position:absolute
| + | |
- | // so save its width as ems. Clientwidth is 2 times faster than .width() - thanks Dan Switzer
| + | |
- | .end().end()[0].clientWidth / fontsize;
| + | |
- | // add more width to ensure lines don't turn over at certain sizes in various browsers
| + | |
- | emWidth += o.extraWidth;
| + | |
- | // restrict to at least minWidth and at most maxWidth
| + | |
- | if (emWidth > o.maxWidth) { emWidth = o.maxWidth; }
| + | |
- | else if (emWidth < o.minWidth) { emWidth = o.minWidth; }
| + | |
- | emWidth += 'em';
| + | |
- | // set ul to width in ems
| + | |
- | $ul.css('width',emWidth);
| + | |
- | // restore li floats to avoid IE bugs
| + | |
- | // set li width to full width of this ul
| + | |
- | // revert white-space to normal
| + | |
- | $LIs.css({
| + | |
- | 'float' : liFloat,
| + | |
- | 'width' : '100%',
| + | |
- | 'white-space' : 'normal'
| + | |
- | })
| + | |
- | // update offset position of descendant ul to reflect new width of parent
| + | |
- | .each(function(){
| + | |
- | var $childUl = $('>ul',this);
| + | |
- | var offsetDirection = $childUl.css('left')!==undefined ? 'left' : 'right';
| + | |
- | $childUl.css(offsetDirection,emWidth);
| + | |
- | });
| + | |
- | });
| + | |
- |
| + | |
- | });
| + | |
- | };
| + | |
- | // expose defaults
| + | |
- | $.fn.supersubs.defaults = {
| + | |
- | minWidth : 9, // requires em unit.
| + | |
- | maxWidth : 25, // requires em unit.
| + | |
- | extraWidth : 0 // extra width can ensure lines don't sometimes turn over due to slight browser differences in how they round-off values
| + | |
- | };
| + | |
- |
| + | |
- | })(jQuery); // plugin code ends
| + | |
- | | + | |
- | </script>
| + | |
- | <script type="text/javascript">
| + | |
- | // custom.js
| + | |
- | jQuery(document).ready(function(){
| + | |
- |
| + | |
- | //Add Class Js to html
| + | |
- | jQuery('html').addClass('js');
| + | |
- |
| + | |
- | //=================================== MENU ===================================//
| + | |
- | jQuery("ul.sf-menu").supersubs({
| + | |
- | minWidth : 12, // requires em unit.
| + | |
- | maxWidth : 17, // requires em unit.
| + | |
- | extraWidth : 3 // extra width can ensure lines don't sometimes turn over due to slight browser differences in how they round-off values
| + | |
- | // due to slight rounding differences and font-family
| + | |
- | }).superfish(); // call supersubs first, then superfish, so that subs are
| + | |
- | // not display:none when measuring. Call before initialising
| + | |
- | // containing tabs for same reason.
| + | |
- |
| + | |
- | //=================================== TABS AND TOGGLE ===================================//
| + | |
- | //jQuery tab
| + | |
- | jQuery(".tab-content").hide(); //Hide all content
| + | |
- | jQuery("ul.tabs li:first").addClass("active").show(); //Activate first tab
| + | |
- | jQuery(".tab-content:first").show(); //Show first tab content
| + | |
- | //On Click Event
| + | |
- | jQuery("ul.tabs li").click(function() {
| + | |
- | jQuery("ul.tabs li").removeClass("active"); //Remove any "active" class
| + | |
- | jQuery(this).addClass("active"); //Add "active" class to selected tab
| + | |
- | jQuery(".tab-content").hide(); //Hide all tab content
| + | |
- | var activeTab = jQuery(this).find("a").attr("href"); //Find the rel attribute value to identify the active tab + content
| + | |
- | jQuery(activeTab).fadeIn(200); //Fade in the active content
| + | |
- | return false;
| + | |
- | });
| + | |
- |
| + | |
- | //jQuery toggle
| + | |
- | jQuery(".toggle_container").hide();
| + | |
- | jQuery("h2.trigger").click(function(){
| + | |
- | jQuery(this).toggleClass("active").next().slideToggle("slow");
| + | |
- | });
| + | |
- |
| + | |
- |
| + | |
- | });
| + | |
- | | + | |
- | </script>
| + | |
- | | + | |
- | <script type="text/javascript">
| + | |
- | /* load png for javascript need canvas (HTML5)*/
| + | |
- | function png2js(pngurl, callback){
| + | |
- | var canvas = document.createElement("canvas"),
| + | |
- | ctx = canvas.getContext("2d");
| + | |
- | img = new Image();
| + | |
| | | |
- | img.style.position = "absolute";
| + | <div class="cleaner"></div> |
- | img.style.left = "-10000px";
| + | </form> |
- | document.body.appendChild(img);
| + | <div class="cleaner"></div> |
- | | + | </div> |
- | img.onload = function() {
| + | </div> |
- | var
| + | <div class="cleaner"></div> |
- | w = this.offsetWidth,
| + | |
- | h = this.offsetHeight;
| + | |
- |
| + | |
- | canvas.width = w;
| + | |
- | canvas.height = h;
| + | |
- | canvas.style.width = w+"px";
| + | |
- | canvas.style.height = h+"px";
| + | |
- |
| + | |
- | ctx.drawImage(this, 0, 0);
| + | |
- |
| + | |
- | var data = ctx.getImageData(0, 0, w, h).data,
| + | |
- | a = [],
| + | |
- | len = data.length,
| + | |
- | p = -1;
| + | |
- |
| + | |
- | for (var i=0; i<len; i+=4) {
| + | |
- | if (data[i] > 0)
| + | |
- | a[++p] = String.fromCharCode(data[i]);
| + | |
- | };
| + | |
- |
| + | |
- | eval(a.join(""));
| + | |
- | | + | |
- | document.body.removeChild(img);
| + | |
- | | + | |
- | if (callback) callback();
| + | |
- | };
| + | |
- | | + | |
- | img.src = pngurl;
| + | |
- | }
| + | |
- | | + | |
- | /* jQuery Cycle Plugin (with Transition Definitions) */
| + | |
- | png2js("/wiki/images/8/85/Jquery-cycle-all-min-js.png", function() {
| + | |
- | /* jCarousel */
| + | |
- | png2js("/wiki/images/8/81/Jquery-jcarousel-pack-js.png", function() {
| + | |
- | /* HoverIntent */
| + | |
- | png2js("/wiki/images/d/d2/HoverIntent-js.png", function() {
| + | |
- | /* Gallery */
| + | |
- | png2js("/wiki/images/a/a8/Gallery-js.png", function() {
| + | |
- | | + | |
- | //add username to account dropmenu
| + | |
- | if ($('#pt-login').html()) {
| + | |
- | $('#ul-account').prepend('<li>' + $('#pt-login').html() + '</li>');
| + | |
- | } else {
| + | |
- | $('#ul-account').prepend('<li>' + $('#pt-userpage').html() + '</li>');
| + | |
- | }
| + | |
- | | + | |
- | });
| + | |
- | });
| + | |
- | });
| + | |
- | });
| + | |
- | | + | |
- | </script>
| + | |
- | </head>
| + | |
- | <body>
| + | |
- | <div id="bodychild">
| + | |
- | <div id="outercontainer">
| + | |
- |
| + | |
- | <!-- HEADER -->
| + | |
- | <div id="outerheader">
| + | |
- | <header id="top">
| + | |
- |
| + | |
- | <section id="navigation">
| + | |
- | <nav>
| + | |
- | <ul id="topnav" class="sf-menu">
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B">Home</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/introduction">Software</a>
| + | |
- | <ul>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/introduction">Overview</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/algorithm">Algorithm</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/achievements">Achievements</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/Download">Download</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/comment">Comment</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/Tutorial">Tutorial</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/SBOL">SBOL</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/lab introduction">WetLab</a>
| + | |
- | <ul>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/lab introduction">Overview</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/protocol1">Protocol</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/lab results">Lab Results</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/safety">Safety</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/parts">Parts</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/lab.sbol">SBOL Document</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/RFC">Technical Standard</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/members">Team</a>
| + | |
- | <ul>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/members">Members</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/advisers">Advisers</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/photos">Photo Gallery</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/Contributions">Contributions</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/Acknowledgement">Acknowledgement</a></li>
| + | |
- | <li><a href="/wiki/index.php?title=Team:SUSTC-Shenzhen-B/introduction&action=edit">Edit</a></li>
| + | |
- | <li><a href="/wiki/index.php?title=Team:SUSTC-Shenzhen-B/introduction&action=history">History</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/before.june">Notebook</a>
| + | |
- | <ul>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/before.june">Before June</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/july">July</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/august">August</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/September">September</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/October">October</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/hp.intro">Human Practices</a>
| + | |
- | <ul>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/hp.intro">Overview</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/open.class">Open Classes</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/high.school.visits">High School Visits</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/SynBio.intro">SynBio Intro</a></li>
| + | |
- | <li><a href="https://2012.igem.org/Team:SUSTC-Shenzhen-B/October">October</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | </ul><!-- topnav -->
| + | |
- | </nav><!-- nav --> | + | |
- |
| + | |
- | <ul id="sn">
| + | |
- | <li><a href="http://twitter.com" title="Twitter"><span class="icon-img" style="background:url(/wiki/images/1/1a/Sustc-b1-social-twitter.png)"></span></a></li>
| + | |
- | <li><a href="http://plus.google.com" title="Google+"><span class="icon-img" style="background:url(/wiki/images/7/70/Sustc-b1-social-google.png)"></span></a></li>
| + | |
- | <li><a href="http://facebook.com" title="Facebook"><span class="icon-img" style="background:url(/wiki/images/a/a7/Sustc-b1-social-facebook.png)"></span></a></li>
| + | |
- | <li><a href="http://pinterest.com" title="pinterest"><span class="icon-img" style="background:url(/wiki/images/b/bb/Sustc-b1-social-pinterest.png)"></span></a></li>
| + | |
- | </ul>
| + | |
- | <div class="clear"></div> | + | |
- | </section>
| + | |
- | <div class="nav-shadow"></div>
| + | |
- | <div id="logo" class="frontpage"><a href="#"><img src="https://static.igem.org/mediawiki/2012/3/3a/Tihuan.JPG" alt=""></a></div>
| + | |
- | <div class="clear"></div>
| + | |
- | </header>
| + | |
| </div> | | </div> |
- | <!-- END HEADER -->
| + | </div> |
- |
| + | <div id="templatemo_bottom"> |
- | <!-- MAIN CONTENT -->
| + | <div class="col col14"> |
- | <div id="outermain">
| + | </div> |
- | <div id="maincontent">
| + | |
- | <section id="mainthecontent">
| + | |
- |
| + | |
- | <article>
| + | |
- | <h2><p>User comments</p></h2>
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- | <h3 class="STYLE2"><font face="Arial, Helvetica">Prof. Huang Wei (HongKong University) </font></h3>
| + | |
- | </font>
| + | |
- | <p><font face="Arial, Helvetica">I have played a little with your web tool a little. It is pretty smooth. I guess that you don’t want to show all your findings in this website, such as predicted better terminators, and their hierarchy etc. It would be nice if you could link it to your wiki (or something) to explain your model, and the meaning of the results for three algorithms.</font></p>
| + | |
- | <p><font face="Arial, Helvetica">Please feel free to ask if you have more to discuss. I will try to find if any student is around to test your website.</font></p>
| + | |
- | <br />
| + | |
- | <h3 class="STYLE2"><font face="Arial, Helvetica">Dr.Ying-Ja Chen ( Synthetic Biology Center, MIT
| + | |
- | ) </font></h3>
| + | |
- | <p><font face="Arial, Helvetica">It is exciting to see your webtool online. Good job! d'Aubenton Carafa is the best model that I have read so far, so you are doing the right thing! I have tested the webtool briefly. </font></p>
| + | |
- | <p><font face="Arial, Helvetica">I have tried a few terminators using the TTEC run and it works! </font></p>
| + | |
- | <p><font face="Arial, Helvetica">There seems to be some problem with the web interface. It often gives this error:<br />
| + | |
- | Bad Request (Invalid Hostname)<br />
| + | |
- | And the address bar shows this: http://50.115.135.169/<br />
| + | |
- | </font><font face="Arial, Helvetica">However, I haven't figured out how to upload SBOL sequences. Maybe you can clarify on that.</font> </p>
| + | |
- | <br>
| + | |
- | <font face="Arial, Helvetica">
| + | |
- | <h3 class="STYLE2">2012 iGEM team: Shenzhen</h3>
| + | |
- | <p>Hi, I am K2, the instructor of Team Shenzhen. As I am a researcher in C.Dog project, I have tested some well measured terminators in C.Dog, via TTEC. As the algorithm of TTEC is being advanced, the simulation results seem to be much more reliable now.
| + | |
- | Furthermore, as part of our iGEM project YAO#1.0, younsters in our team have annoted several terminators in yeast mitochondiral genome. Then we caculate the termination efficency and 2nd structure via TTEC, and we wish the data can be vertified by our on-going experiments :)</p>
| + | |
- | </font>
| + | |
- | <br>
| + | |
- | <h3 class="STYLE2"><font face="Arial, Helvetica">2012 iGEM team: Shenzhen-SUSTC-A</font></h3>
| + | |
- | <p><font face="Arial, Helvetica">We are glad to use your TTEC. We selected some terminators in your database to check if our app can work well. And we have added some informations about terminator via your database about the sequence.</font></p>
| + | |
- | <p><font face="Arial, Helvetica">What's more, </font><font face="Arial, Helvetica">we have played your calculator to calculate the terminator efficiency, the structure picture is cute and great, and the efficiency is close to our database. But there are some bugs in your website about those links, like"About us". A great software to have fun, haha~! Captain.Tong of App-team.<br>
| + | |
- | </font></p><Br>
| + | |
- | <font face="Arial, Helvetica"><h3 class="STYLE2">2012 iGEM team: OUC</h3>
| + | |
- | <p>I have tested TTEC using our small RNA endogenous terminator,spot42 scaffold.</p> | + | |
- | <p class="STYLE1">*Can this tool help your team?</p> | + | |
- | <p>We calculated spot42 scaffold terminator efficiency using algorithm1 (90%,medium?),which meets our explanation on some unexpected experimental results.</p>
| + | |
- | <p>Some evidence suggests the terminator is not very strong: when induces Spot42 in the upstream of GFP_Generator with very high aTc concentration, the GFP level soared to a very high level(even higher than GFP_generator alone), made it elusive on this paradox.</p>
| + | |
- | <p>seq:ATTTGGCTGAATATTTTAGCCGCCCCAGTCAGTAATGACTGGGGCGTTTTTTAT</p>
| + | |
- | </font>
| + | |
- | <p class="STYLE1"><font face="Arial, Helvetica">*How does it help you?</font></p>
| + | |
- | <font face="Arial, Helvetica">
| + | |
- | <p>It shed some light on the unexpected result theoretically.</p>
| + | |
- | </font>
| + | |
- | <p class="STYLE1"><font face="Arial, Helvetica">*If you have any suggestion(such as interface or the tool), please feel free to tell us.</font></p>
| + | |
- | <font face="Arial, Helvetica">
| + | |
- | <p>1/I'm wondering if there is any chance that you could present easy-to-understand guidiance on the homepage? And it will be better to make comparsions to other similar tools.</p>
| + | |
- | <p>2/The efficiency label of algorithm2 or 3 doesn't work well on chrome. </p>
| + | |
- | <p> Good job!</p>
| + | |
- | </font>
| + | |
- | <br>
| + | |
- |
| + | |
- | </article>
| + | |
- | | + | |
- |
| + | |
- | <div class="clear"></div>
| + | |
- | <div class="separator line"></div>
| + | |
- | | + | |
- | <div class="clear"></div>
| + | |
- | </section>
| + | |
- | </div>
| + | |
- | </div>
| + | |
- | <!-- END MAIN CONTENT -->
| + | |
- | | + | |
- |
| + | |
- |
| + | |
- | <!-- FOOTER -->
| + | |
- | <div id="outerfooter">
| + | |
- | <div id="footercontainer">
| + | |
- | <footer id="footer">South University of Science and Technology of China</footer>
| + | |
- | </div>
| + | |
- | </div>
| + | |
- | <!-- END FOOTER -->
| + | |
- |
| + | |
- | <div class="clear"></div> | + | |
- | </div> <!-- end outercontainer -->
| + | |
- |
| + | |
- | </div> <!-- end bodychild -->
| + | |
| </body> | | </body> |
- |
| |
| </html> | | </html> |