Team:Shenzhen/Result/YAO.Suicider

Result Summary

In the experiment part of suicide, we have succefully engineered GAL1 promoter, lambda phage holin, and linked GAL1 promoter with yeast GFP, yeast RFP and lambda phage holin respectively.

Preview for Whole Experiments

    GAL1 promoter + kozak sequence + signal peptide to mitochondria + T7 RNAP + ADH terminator (backbone:YEP325)

    T7 promoter + mt RBS + DNase I + terminator for mitochondria (under experiment)

    DLD3 promoter + kozak sequence + Holin + degradation tag + ADH terminator (under experiment)

Identification for Engineering GAL1 Promoter without Downstream ATG Start Codon

0. This is based on BBa_J63006 and is without ATG start codon. We point-mutate the ATG to ACG. It is more convenient to use. There is ATG in GAL1 promoter RBS which can change read frame.

1. >BBa_J63006 Part-only sequence (549 bp)

ccccattatcttagcctaaaaaaaccttctctttggaactttcagtaatacgcttaactgctcattgctatattgaagtacggattagaagccgccgagcgggtgacagccctccgaaggaagactctcctccgtgcgtcctcgtcttcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccgaacaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaacctggccccacaaaccttcaaatgaacgaatcaaattaacaaccataggatgataatgcgattagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatgcaaaaactgcataaccactttaactaatactttcaacattttcggtttgtattacttcttattcaaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggaggaaactagacccgccgccacc<red>atg</red>gag

The backbone for it BBa_J63010 is for combinant protein.

2. >Engineered GAL1(gz-GAL1)

ccccattatcttagcctaaaaaaaccttctctttggaactttcagtaatacgcttaactgctcattgctatattgaagtacggattagaagccgccgagcgggtgacagccctccgaaggaagactctcctccgtgcgtcctcgtcttcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccgaacaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaacctggccccacaaaccttcaaatgaacgaatcaaattaacaaccataggatgataatgcgattagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatgcaaaaactgcataaccactttaactaatactttcaacattttcggtttgtattacttcttattcaaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggaggaaactagacccgccgccacc<red>acg</red>gag

The backbone for it is T vector, it can be linked to PSB1A3 or PSB1A2 in standard BioBrick format.

3. Primer for engineering:

PGALF1 5'-GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCCCATTATCTTAGCCTA

PGALR1 5'-GTTTCTTCCTGCAGCGGCCGCTACTAGTACTC<red>CGT</red>GGTGGCGGCGGGTC

4. GAL 1 Promoter Construction Identification:

Figure 1. Sanger sequencing diagrams for GAL1 Promoter mutant.

Figure 2. Sequencing result comparison diagram. The cyan one means BBa standard prefix and suffix from standard part fabrication. The black one means GAL 1 promoter, and ATG start codon in the final is replaced by ACG.

As learn from the diagram, we have successfully constructed the GAL 1 promoter without ATG.

Identification for Engineering Lambda Holin into BBa Format

0. Due to that BBa_K112306 (lambda holin) is in BBb format and is inconvenient to use. We change it to BBa format. This is used to form pores on the outer membrane of mitochondria and ER to release apoptosis factor to repress yeast cells.

1. Origin holin and its adaptor:

GAATTCatgAGATCT

Atgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtagaaatcaataa

GGATCCtaaCTCGAG

The backbone for it BBa_J63010 is for combinant protein.

2. >Engineered holin and its adaptor:

GTTTCTT C GAATTC GCGGCCGC T TCTAG ag

Atgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtagaaatcaataa

T ACTAGT A GCGGCCG CTGCAG G AAGAAAC

The backbone for it is T vector, it can be linked to PSB1A3 or PSB1A2 in standard BioBrick format.

3. Primer for engineering:

Holin-F GTTTCTTCGA ATTCGCGGCC GCTTCTAGAG ATGCCAGAAA AACATGACCT

Holin-R GTTTCTTCCT GCAGCGGCCG CTACTAGTAT TATTGATTTC TACCATCTT

4. Holin Construction Identification:

Figure 3. Sanger sequencing diagrams for Lambda Holin modification.

Figure 4. Sequencing result comparison diagram. The cyan one means BBa standard prefix and suffix from standard part fabrication. The black one means the coding gene of lambda phage holin.

As learn from the diagram, we have successfully constructed the Lambda holin in BBa format.

Identification for Bioparts

• GAL1 promoter +E0030(GFP)

Figure 5. Sequencing result comparison diagram for GAL1 promoter +E0030(GFP).

• GAL1 promoter +E1010(RFP)

Figure 6. Sequencing result comparison diagram for GAL1 promoter +E1010(RFP).

• GAL1 promoter +lamda holin

Figure 7. Sequencing result comparison diagram for GAL1 promoter +lamda holin.

Protocol: Point mutation to GAL1 Promoter

1. Plasmid extraction of GAL1 promoter (BBa-J63005)

2. Point mutation:

    Primers

        > PGALF1   5'-GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCCCATTATCTTAGCCTA

        > PGALR1   5'-GTTTCTTCCTGCAGCGGCCGCTACTAGTACTCCGTGGTGGCGGCGGGTC

    BBa-J63005    20ng

    Ex Taq    0.5ul

    10 X Ex Buffer    2ul

    Dntp Mix    1ul

    PGALF    0.5ul

    PGALR1    0.5ul

    ddH2O    20ul

    94℃    3min

    94℃    30s

    55℃    30s

    72℃    30s

    72℃    10min

    12℃    ∞

    30 cycles

3. Gel electrophoresis

4. Gel recovery(QIAGEN)

5. Digestion:

    gz-GALproduction    17ul

    PSB1A2linear backbone    400ng

    EcoRI    0.5ul

    EcoRI    0.5ul

    PstI    0.5ul

    PstI    0.5ul

    10 x H Buffer    2ul

    10 x H Buffer    2ul

    ddH2O    20ul

    37oC X 1h, 80oC X  20min

6. Tranformation:

    As above.

7. Colony PCR:

    As above.

    Prefix

        5' GTTTCTT C GAATTC GCGGCCGC  T  TCTAGA  G   [part] 3'

        3' CAAAGAA G CTTAAG CGCCGGCG  A  AGATCT  C   [part] 5'

    Suffix

        5' [part] T ACTAGT  A  GCGGCCG CTGCAG G AAGAAAC   3'

        3' [part] A TGATCA  T  CGCCGGC GACGTC C TTCTTTG   5'

8. Sequencing

Protocol: Test of T7 RNAP Function in Nucleus

• I. Construction of Vector

1. Bacterial culture (BBa_I712074（T7 poromter，Amp resistant or Kana resistant），E0840（GFP generator，Amp resistant）

2. Plasmid extraction for BBa_I712074，E0840( Tiangen normal plasmid extraction kits

3. Measure the concentration of plasmid by NANODROP 2000(Thermo)

4. Digestion: (enzymes are all from Takara

    BBa_I712074    2-3ug

    PstI    2ul

    SpeI    2ul

    10 x H Buffer    5ul

    ddH2O    50ul

    E0840    2-3ug

    XbaI    2ul

    PstI    2ul

    10 x H Buffer    5ul

    ddH2O    50ul

    37oC    3h

    80 oC     20min

5. Electrophoresis:

    1% agarose gel, 120V, after 45min,EB dye.

6. Gel recovery of GAL(EcoRI/SpeI), Holin(XbaI/PstI) (QIAquick Gel recovery kits)

7. Measure the concentration of fragment of interest by NANODROP 2000(Thermo)

8. Linage:

    BBa_I712074 （(stI/SpeI)    2ul

    E0840 (PstI/XbaI)    6ul

    T4 ligase    1ul

    T4 ligase Buffer    1ul

    16 oC    3 hours

9. Transduction:

    1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

    2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

    3. 42oC ice-bath heat shock for 50s.

    4. Stewing on ice for 2mins.

    5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

    6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

    7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

10. Colony PCR:

    dNTPmix(2.5mM)    1μl

    PCR 10×buffer2μl

    VF    0.5μl

    VR    0.5μl

    Ex Taq    0.5μl

    H2O    15.5μl

    Primer

        VF:    TGCCACCTGACGTCTAAGAA

        VR:    ATTACCGCCTTTGAGTGAGC

    94℃    3min

    94℃    30s

    55℃    30s

    72℃    1min

    72℃    10min

    12℃    ∞

    30 cycles

11. 1%~1.5% agarose gel electrophoresis, <130V, 40mins.

12. Sequencing:

    Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector PSB1AK3-T7 poromter+GFP+T7 terminater

• II. Construction of Yeast Expression Vector

1. Culture of PSB1AK3-T7 poromter+GFP+T7 terminater （Cmr resistant）gz-YEP352（AmpResistant, we have replaced the URA mark with trp mark）

2. Plasmid extraction: PSB1AK3-T7 poromter+GFP+T7 terminater，gz-YEP352

3. Digestion:

    Gz-YEP352    2ug

    XbaI    2ul

    PstI    2ul

    10 x H Buffer    5ul

    ddH2O        50ul

    PSB1AK3-T7 poromter+GFP+T7 terminater    2ug  

    XbaI    2ul

    Pst    2ul

    10 x H Buffer    5ul

    ddH2    50ul

4. Electrophoresis:

    1% agarose gel, 120V, after 45min,EB dye.

5. Gel recovery of gz-YEP352 (XbaI /PstI)PSB1AK3-T7 poromter+GFP+T7 terminater (XbaI / PstI) (Qiagen Gel recovery kits)

6. Lingake:

    Gz-YEP352 (XbaI /PstI)    100ng

    PSB1AK3-T7 poromter+GFP+T7 terminater    100ng

    T4 buffer    1ul

    T4 ligase    1ul

    ddH2O    10ul

    16oC    overnight

7. Transduction:

    1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

    2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

    3. 42oC ice-bath heat shock for 50s.

    4. Stewing on ice for 2mins.

    5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

    6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

    7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

8. Clony PCR: <p>    dNTPmix(2.5mM)    1μl

    PCR 10×buffer    2μl

    M13_pUC_fwd_primer    0.5μl

    M13_reverse_primer    0.5μl

    Ex Taq    0.5μl

    H2O    15.5μl

    94℃    3min

    94℃    30s

    55℃    30s

    72℃    1.5min

    72℃    10min

    12℃    ∞

    30 cycles

9. 1.5% agarose gel electrophoresis, <130V, 40mins.

10. Sequencing:

    Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector:EP352-GAL1,Holin-ADH1

• III. Yeast Transformation Experiment:

1. plasmid extraction.

2. Preparation  of Competent Yeast Cells - LiAc Method

    1.treak a YPDA agar plate with a small portion of AH109 or Y187. Incubate the plate upside down at 30°C until colonies appear(~3days). Yeast strains can be stored for up to 1 month at 4°C on YPDA medium in culture plates.

    2.Prepare 1.1X TE/LiAc Solution

    3.Prepare YPDA liquid medium (Yeast Protocols Handbook)

    4.Inoculate one colony(<4 weeks old, 2–3mm in diameter) into 3ml of YPDA medium in a sterile, 15-ml   centrifuge tube.

    5.Incubate at 30°C with shaking    for   8hr.

    6.Transfer 5µl of the culture  to a 250-ml flask containing  50ml of YPDA.

    7.Incubate at 30°C with shaking at 230–250 rpm for   16–20hr.The OD600 should reach 0.15–0.3.

    8.Centrifuge the cells at 700 x g for 5min at room temperature.

    9.Discard the supernatant and resuspend the  cell  pellet in 100 ml of YPDA.

    10.Incubate at 30°C for 3–5hr (OD600= 0.4–0.5).

    11.Centrifuge the cells at 700 x g for 5min at room  temperature.

    12.Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O.

    13.Centrifuge the cells at 700 x g for 5min at room  temperature.

    14.Discard the supernatant and resuspend the cells in 3 ml of 1.1 X TE/LiAc Solution.

    15.Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml per tube).

    16.Centrifuge each tube at high speed for 15 sec.

    17.Discard the supernatant and resuspend each pellet in 600 µl of 1.1 X TE/LiAc Solution.

3.Transformation:

    1. Gz-YEP352-T7poromter+GFP+T7terminater 0.2ug

    Sperm DNA*(10 mg/ml) 0.1mg

    Sperm DNA  :when prepared, water-bath boiling for 20mins, then ice-bath, -20°C preservation.

    2. 100 ul dense medium of yeast competent cell by 1×TE/LiAc. Whirlpool oscillation.

    3. 600 ulPEG/LiAc, oscillation strongly, 30°C,200rpm, culture oscillating for 30mins.

    4. Add 70ul DMSO, mixing it slightly and 42oC heat shock by water-bath for 15mins, ice-bath for 1-2mins

    5. Centrifuging for 14,000rpm for 5sec, abandon the supermate, 0.1ml 1x TE suspense the cell precipitation, spread it to SD/ -Ura-trp solid plat, 30°C culture reversely for 3 days.

6. Holin function identification:

    Pick a SD/ -Ura-trp-cultured colony and inoculate it to 50ml YPDA medium, 30°C,220rpm culture reelingly to OD-0.1, transfer 20ml to 50ml sterile medium (alpha-galactose), versus is added by equivalent water. Measuring the OD value one time for one hour and drawing the curve.

    Result analyzation:

        If the bacteria in alpha-galactose show flurorescence, that shows T7 RNAP/T7 promoter can work.

Protocol: Holin Adaptor Engineering

1. Plasmid extraction of BBa-K112306（holin）

2. Point mutation:

    Primers

        > Holin-F GTTTCTTCGA ATTCGCGGCC GCTTCTAGAG ATGCCAGAAA AACATGACCT

        > Holin-R GTTTCTTCCT GCAGCGGCCG CTACTAGTAT TATTGATTTC TACCATCTT

    BBa-K112306    20ng

    Ex Taq    0.5ul

    10 X Ex Buffer    2ul

    Dntp Mix    1ul

    Holin-F    0.5ul

    Holin-R    0.5ul

    ddH2O    20ul

    94℃    3min

    94℃    30s

    55℃    30s

    72℃    30s

    72℃    10min

    12℃    ∞

    30 cycles

3. Gel electrophoresis

4. Gel recovery(QIAGEN)

5. T clone of holing(TAKARA T clone kits)

6. Colony PCR:

    Ex Taq    0.5ul

    10 X Ex Buffer    2ul

    Dntp Mix    1ul

    M13-47    0.5ul

    RV-M    0.5ul

    ddH2O    20ul

    94℃    3min

    94℃    30s

    55℃    30s

    72℃    30s

    72℃    10min

    12℃    ∞

    30 cycles

7. Digestion Verification:

    Plasmid T-holin    100ng

    XbaI    0.5ul

    PstI    0.5ul

    1 X M buffer    2ul

    ddH2O    20ul

    37oC 3 hours

8. Sequencing