"
Non-antibiotic selectable and counter-selectable markers:
Sucrose Hydrolase
Background
Sucrose hydrolase is an enzyme from Escherichia coli O157:H7 strain Sakai which is involved in sucrose utilization (Jahreis, et al., 2002). Transforming Escherichia coli K12 strains with sucrose hydrolase allows the cells to grow with sucrose as a sole carbon source which the untransformed K12 strain cannot do. This allows this gene to be used as a selectable marker.
Cloning
CscA selection plasmid
The cscA and pSBIC3 gene were cloned using these primers. Method. pSBIC3-cscA ligation transformants are to be checked for the success of this cloning procedure.
Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT
Figure 12: DNA gel of PCR product s of pSBIC3 without chloramphenicol and cscA. One product is around 1.4 kb which corresponds to the size of cscA gene, the other is around 2.2 kb which corresponds to the pSBIC3 vector without cml resistance.
Close the primers.
Method: The purified cscA and psBIC3 PCR products were digested with NdeI and ClaI. Both products were ligated and E.coli cells transformed with the ligation.
Close the primers.
Characterization
Plates
Plates characterization showed that cscA is a suitable selectable marker- only cells which had the gene grew on sucrose as a sole carbon sourse. The drawback of this antibiotic-free selectable market is that more time is required for the growth of the cscA cells on sucrose (overnight at 37°C+4 days at room temperature).
Figure 13: cscA cells as well as control cells were spread on LB plate, minimal plate with sucrose, minimal plate with sucrose and minimal plate with no sugars. Both cscA and control cells do not grow on minimal plate with no sugars and grow on LB and minimal plate with glucose. However, cscA cells are growing on minimal media with sucrose while control cells are not.
Conclusion:
We successfully cloned the sucrose hydrolase gene and inserted it into biobrick vector.
We extensively characterized the sucrose gene in plates and liquid cultures.
We determined its suitability as selectable marker.
Further plans:
To check the success of pSBIC3-cscA selection plasmid and characterize it.
Methods (expand)
Inserting gene into a biobrick vecor: Cloning a PCR product into a biobrick vector protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:bbcloning) however NEB buffers were used.
DNA gel preparation: Analysing DNA by gel electrophoresis protocol on OpanWetWare (http://openwetware.org/wiki/Cfrench:AGE) however 0.5*TAE rather than 1*TAE was used.
Colony PCR screen: Screening colonies by PCR protocol on OpenWetWare http://openwetware.org/wiki/Cfrench:PCRScreening
Transformations: Preparing and using compenent E.coli cells protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:compcellprep1)
PCR reactions : Cloning parts by PCR with Kod polymerase protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:KodPCR)
Minipreps : Plasmid DNA minipreps from Escerichia coli JM109 and similar strains protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:minipreps1)
Digests to linearise the DNA frangment/determine size of insert: Analytical restriction digests protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:restriction1)
DNA purification: Purifying a PCR product from solution protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:DNAPurification1) however 165 ul NaI, 5 ul glass beads,180 ul wash buffer and 10 ul EB were used.
DNA preparation for sequencing: 2.5 ul miniprepped DNA, 2 ul water and 1 ul forward primer ( specific for biobrick prefix) or reverse primer (specific for biobrick suffix)
Nitroreductase activity assay: Overnight liquid cultures of nitroreductase strains were centrifuged at 10000 rpm for 5 mins to pellet the cells. The cells were then resuspended in 250 ul PBS and 1 ul DTT to ensure that cellular proteins are not oxidized. The solution was sonicated 6* (10 s sonication+20 s rest). The supernatant was separated from the pellet by centrifugation and used for the NADH-dependent nitroreductase activity assay.
To assess background activity NADH (5 ul) and bacterial supernatant (5 ul) were added to 0.8 ml PBS and mixed. OD340 was measured for 1 minute. DNBA(5 ul) was added to the same cuvette to start the reaction and change in OD340 was monitored for 1 minute. DMSO(5 ul) was used a control (DNBA is dissolved in DMSO)
The protein concentration of each of the supernants was estimated by by Bradford protein assay using the Pierce reagent protocol on OpenWetWare(http://openwetware.org/wiki/Cfrench:ProteinAssay)
Close methods.
French, C., & Kowal, M. (2010, 09 24). B. subtilis levansucrase. Lethal to E.coli in presence of sucrose. Retrieved 2012, from Registry of standard biological parts: http://partsregistry.org/Part:BBa_K322921
Gay, P., Coq, D. l., Strinmetz, M., Ferrari, E., & Hoch, J. A. (1983). Cloning Structural Gene SacB, which Codes for Exoenzyme Levansucrase of Bacillus subtilis: Expression of the Gene in Esherichia coli. Journal of Bacteriology , 1424-1431.
Jahreis, K., Bentler, L., Bockmann, J., Hans, S., Meyer, A., Siepelmeyer, J., et al. (2002). Adaptation of sucrose metabolism in the Escherichia coli Wild-Type Strain EC31132. Journal of Bacteriology, 5307-5316.
Keuning, S., Janssen, D. B., & Witholt, B. (1985). Purification and Characterisation of Hyrdrolytic Haloalkane Dehalogenase from Xanthobacter autotrophicus GJ10. Journal of Bacteriology, 635-639.
Naested, H., Fennema, M., Hao, L., Andersen, M., Janssen, D. B., & Mundy, J. (1999). A bacterial haloalkane dehalogenase gene as a negative selectable marker in Arabidopsis. The Plant Journal, 571-576.
Nicklin, C. E., & Bruce, N. C. (1998). Aerobic degradation of 2,4,6-Trinitrotoluene by Enterobacter cloaceae PB2 and by Pentaerythritol tetranitrate reductase. Applied and environmental microbiology , 2864-2868.
Nillius, D., Muller, J., & Muller, N. (2011). Nitroreductase (GlNR1) increases susceptibility of Giardia lamblia and Escherichia coli to nitro drugs. Journal of antimicrobial chemotherapy, 1029-1035.
Kang et al. (2009). "Levan: Applications and Perspectives". Microbial Production of Biopolymers and Polymer Precursors. Caister Academic Press
Dahech, I, Belghith, K. S., Hamden, K., Feki, A., Belghith, H. and Mejdoub, H. (2011) Antidiabetic activity of levan polysaccharide in alloxan-induced diabetic rats. International Journal of Biological Macromolecules 49(4):742-746
Close cited works.
