Team:St Andrews/Omega-3-synthesis

From 2012.igem.org

(Difference between revisions)
m (Δ instead of delta)
(added in methods text, put sequences to end of page)
Line 120: Line 120:
</div>
</div>
<h2>Sequences</h2>
<h2>Sequences</h2>
 +
<p>
 +
<p>By combining a number of genes, we were able to recreate the pathway described above (Fig. 1). The following genes were employed:
 +
<ul><li>
 +
<p> Δ12 from <i>Synechocystis sp. PCC 6803</i>, KEGG entry 429257.20</p>
 +
<p> Δ15 <i>Synechocystis sp. PCC 6803</i>, KEGG s111441</p>
 +
<p>ELO6 <i>Synechocystis sp. PCC 6803</i>, KEGG entry LmjF32.1160</p>
 +
<p>Δ12 from <i>Trypanosome cruzi</i>, KEGG entry 429257.20</p></li></ul>
 +
</p>
<p>
<p>
<div class="btn-toolbar">
<div class="btn-toolbar">
Line 279: Line 287:
     </div>
     </div>
</div>
</div>
 +
<p>These genes were extracted using PCR (Promega, GoTaq HotStart) at temperatures 48°C and 56°C. Both vectors pET-15b and pET-20b were tested for expression. The recombinant plasmids were ligated into two <i>E. coli</i> strains: BL21(DE3) and BL21(DE3)pLysS.</p>
<h2>Primers</h2>
<h2>Primers</h2>
Line 486: Line 495:
</div>
</div>
 +
<p>After a number of expression attempts, some initial conclusions were reached. All experiments done on ELO6 failed. Also, Δ12 from <i>T. cruzi</i> gave overall weaker results than the same gene from <i>Synechocystis</i>.  As such, latter work was only carried out on genes from <i>Synechocystis</i>.</p>
 +
 +
<p> Δ15 was successfully expressed in pET-15b and transformed into cell strains BL21(DE3) and BL21(DE3)PlysS. However, functionality could not be established.
 +
 +
<p>Additionally, a pET-duet vector expressing Δ12 and Δ15 was used to start assembling the metabolic pathway. Due to time constraints, no duet  <sup>BioBrick</sup> was submitted.</p>
 +
 +
 +
<h2>Lipid analysis</h2>
 +
 +
<p>Lipids were extracted from transformed <i>E. coli</i> using the Blight/Dyer method. (Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book">Lipid extraction lab book entry</a> for further detail.)</p>
 +
 +
<p>We then analyzed the the fatty acid content of the transformed cells to determine whether it differed from the previously analyzed background lipid composition. This was done using mass spectrometry.</p>
 +
 +
<h2>Mass Spectrometry</h2>
 +
 +
<div class="row-fluid">
 +
<div class="span12 well">
 +
    <ul class="thumbnails">
 +
    <li class="span4">
 +
    <a href="#fame-analysis" data-toggle="modal" class="thumbnail">
 +
    <img src="https://static.igem.org/mediawiki/2012/4/4e/Fame_analysis.png" alt="">
 +
    <p><h5>Chart 1: <em>"Fatty acid methyl ester analysis"</em></h5></p>
 +
    <p>C18:3 refers to an 18 carbon backbone with 3 double bonds. C18:2 and C18:1 would have 2 double bonds and 1 respectively. The upper portion of this figure shows the peaks that would be expected for the various fatty acid methyl esters.The lower 4 panels show mass spec fingerprints that are indicative of our fatty acids of interest.</p>
 +
    </a>
 +
    </li>
 +
<div class="modal large hide" id="fame-analysis">
 +
  <div class="modal-header">
 +
    <button type="button" class="close" data-dismiss="modal">×</button>
 +
    <h3>Chart zoom: <em>Fatty acid methyl ester analysis</em></h3>
 +
  </div>
 +
  <div class="modal-body">
 +
    <img src="https://static.igem.org/mediawiki/2012/4/4e/Fame_analysis.png" alt="">
 +
  </div>
 +
</div>
 +
 +
    <li class="span4">
 +
    <a href="#lipid-extraction" data-toggle="modal" class="thumbnail">
 +
    <img src="https://static.igem.org/mediawiki/2012/c/c6/Slide2.tiff" alt="">
 +
    <p><h5>Chart 3: <em>"Lipid extraction analysis"</em></h5></p>
 +
    <p>Chart 2. All of the cellular lipids were extracted and their fatty acid methyl esters produced. These were analysed by mass spec. In the control cells no C18:2 is present. When Δ6 is expressed, a peak indicative of C18:2 is present. However, the primary fatty acid is still C18:1 - with the bouble bond present at position 9. With the expression of Δ12 and the addition of exogenous C18:1(3) we get great abundance of C18:2 and negligible abundance of C18:1 indicating that the C18:1 is being processed successfully. The lowest graph shows that Δ12 expressed with Δ15 acts in a complementary fashion and C18:3 - Omega 3 - is produced. </p>
 +
    </a>
 +
    </li>
 +
<div class="modal large hide" id="lipid-extraction">
 +
  <div class="modal-header">
 +
    <button type="button" class="close" data-dismiss="modal">×</button>
 +
    <h3>Chart zoom: <em>Fatty acid methyl ester analysis</em></h3>
 +
  </div>
 +
  <div class="modal-body">
 +
    <img src="https://static.igem.org/mediawiki/2012/c/c6/Slide2.tiff" alt="">
 +
  </div>
 +
</div>
 +
 +
 +
    <li class="span4">
 +
    <a href="#membrane-assay" data-toggle="modal" class="thumbnail">
 +
    <img src="https://static.igem.org/mediawiki/2012/4/40/Membrane_assay.jpg" alt="">
 +
    <p><h5>Chart 4: <em>"Membrane assay"</em></h5></p>
 +
    <p>Chart 3. The cellular membranes were extracted and their lipids were analysed by mass spec. As in chart 2 it is confirmed that expression of Δ12 and Δ15 lead to the production of omega 3 fatty acids. This chart shows that these lipids locate to the plasma membrane of the bacteria</p>
 +
    </a>
 +
    </li>
 +
<div class="modal large hide" id="membrane-assay">
 +
  <div class="modal-header">
 +
    <button type="button" class="close" data-dismiss="modal">×</button>
 +
    <h3>Chart zoom: <em>Fatty acid methyl ester analysis</em></h3>
 +
  </div>
 +
  <div class="modal-body">
 +
    <img src="https://static.igem.org/mediawiki/2012/4/40/Membrane_assay.jpg" alt="">
 +
  </div>
 +
</div>
 +
    </ul>
 +
</div>
 +
</div>
<h2>Sequencing results</h2>
<h2>Sequencing results</h2>
<dl class="dl-horizontal">
<dl class="dl-horizontal">
Line 596: Line 677:
</div>
</div>
-
<h2>Lipid analysis</h2>
+
</section>
-
 
+
-
<p>Lipids were extracted from transformed <i>E. coli</i> using the Blight/Dyer method. (Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book">Lipid extraction lab book entry</a> for further detail.)</p>
+
-
 
+
-
<p>We then analyzed the the fatty acid content of the transformed cells to determine whether it differed from the previously analyzed background lipid composition. This was done using mass spectrometry.</p>
+
-
 
+
-
<h2>Mass Spectrometry</h2>
+
-
 
+
-
<div class="row-fluid">
+
-
<div class="span12 well">
+
-
    <ul class="thumbnails">
+
-
    <li class="span4">
+
-
    <a href="#fame-analysis" data-toggle="modal" class="thumbnail">
+
-
    <img src="https://static.igem.org/mediawiki/2012/4/4e/Fame_analysis.png" alt="">
+
-
    <p><h5>Chart 1: <em>"Fatty acid methyl ester analysis"</em></h5></p>
+
-
    <p>C18:3 refers to an 18 carbon backbone with 3 double bonds. C18:2 and C18:1 would have 2 double bonds and 1 respectively. The upper portion of this figure shows the peaks that would be expected for the various fatty acid methyl esters.The lower 4 panels show mass spec fingerprints that are indicative of our fatty acids of interest.</p>
+
-
    </a>
+
-
    </li>
+
-
<div class="modal large hide" id="fame-analysis">
+
-
  <div class="modal-header">
+
-
    <button type="button" class="close" data-dismiss="modal">×</button>
+
-
    <h3>Chart zoom: <em>Fatty acid methyl ester analysis</em></h3>
+
-
  </div>
+
-
  <div class="modal-body">
+
-
    <img src="https://static.igem.org/mediawiki/2012/4/4e/Fame_analysis.png" alt="">
+
-
  </div>
+
-
</div>
+
-
 
+
-
    <li class="span4">
+
-
    <a href="#lipid-extraction" data-toggle="modal" class="thumbnail">
+
-
    <img src="https://static.igem.org/mediawiki/2012/c/c6/Slide2.tiff" alt="">
+
-
    <p><h5>Chart 3: <em>"Lipid extraction analysis"</em></h5></p>
+
-
    <p>Chart 2. All of the cellular lipids were extracted and their fatty acid methyl esters produced. These were analysed by mass spec. In the control cells no C18:2 is present. When Δ6 is expressed, a peak indicative of C18:2 is present. However, the primary fatty acid is still C18:1 - with the bouble bond present at position 9. With the expression of Δ12 and the addition of exogenous C18:1(3) we get great abundance of C18:2 and negligible abundance of C18:1 indicating that the C18:1 is being processed successfully. The lowest graph shows that Δ12 expressed with Δ15 acts in a complementary fashion and C18:3 - Omega 3 - is produced. </p>
+
-
    </a>
+
-
    </li>
+
-
<div class="modal large hide" id="lipid-extraction">
+
-
  <div class="modal-header">
+
-
    <button type="button" class="close" data-dismiss="modal">×</button>
+
-
    <h3>Chart zoom: <em>Fatty acid methyl ester analysis</em></h3>
+
-
  </div>
+
-
  <div class="modal-body">
+
-
    <img src="https://static.igem.org/mediawiki/2012/c/c6/Slide2.tiff" alt="">
+
-
  </div>
+
-
</div>
+
-
 
+
-
 
+
-
    <li class="span4">
+
-
    <a href="#membrane-assay" data-toggle="modal" class="thumbnail">
+
-
    <img src="https://static.igem.org/mediawiki/2012/4/40/Membrane_assay.jpg" alt="">
+
-
    <p><h5>Chart 4: <em>"Membrane assay"</em></h5></p>
+
-
    <p>Chart 3. The cellular membranes were extracted and their lipids were analysed by mass spec. As in chart 2 it is confirmed that expression of Δ12 and Δ15 lead to the production of omega 3 fatty acids. This chart shows that these lipids locate to the plasma membrane of the bacteria</p>
+
-
    </a>
+
-
    </li>
+
-
<div class="modal large hide" id="membrane-assay">
+
-
  <div class="modal-header">
+
-
    <button type="button" class="close" data-dismiss="modal">×</button>
+
-
    <h3>Chart zoom: <em>Fatty acid methyl ester analysis</em></h3>
+
-
  </div>
+
-
  <div class="modal-body">
+
-
    <img src="https://static.igem.org/mediawiki/2012/4/40/Membrane_assay.jpg" alt="">
+
-
  </div>
+
-
</div>
+
-
    </ul>
+
-
</div>
+
-
</div>
+
<section id="biobricks">
<section id="biobricks">

Revision as of 22:54, 24 September 2012

St Andrews iGEM '12

Omega-3 fatty acid synthesis

Introduction

ω-3 Fatty acids are an essential component of our diet and are paramount to maintaining human health. Our team is recreating this synthetic pathway in E. coli, using genes from the cyanobacteria Synechocystis and the trypanosomatid Leishmania major. Combining the DNA code for elongase and desaturase enzymes, we can convert the plain fatty acid of E. coli into highly valuable ω-3 fatty acids.

Project Description

  • Synechocystis sp.

  • Trypanosome cruzi

  • Leishmania major

Omega-3 fatty acids are an essential part of the human diet (Bender, Bender, 1999). Human beings, as all larger organisms, cannot synthesize ω-3 fatty acids, This is due to a lack of the enzyme Δ15 desaturase, which creates a double bond at the 15th carbon of a long-chain fatty acid. Certain microrganisms, such as microalgae and cyanobacteria, do contain this desaturase and can thus directly synthesize ω-3 fatty acids (Arts et al, 2009). ω-3 fatty acids then enter the food chain – algae are eaten by fish, and seafood is sbsequently the main source of ω-3 for humans(Tonon et al, 2002).

However, the current economic policies of overfishing are a serious contributor to marine biodestruction. As the human population is estimated to rise to 9.1 billion by 2050 (Cohen, 2003), pressure on fish stock will increase. Additionally, global warming will reduce the availability of ω-3 (Arts et al, 2009): at higher temperatures, microalgae produce less ω-3 desaturated fatty acids. Desaturated carbon chains cause a lower melting temperature in the membrane, which the microorganism wants to avoid by synthesizing more saturated fatty acids in their membranes (Garwin, Cronan, 1980). Thus, the combination of declining fish stock and a decrease in overall ω-3 fatty acids is making the supply for human nutrition a relevant issue.

Harvesting algae directly is costly and ineffective (Borowitzka, 1997). There is much potential in expressing a metabolic pathway for ω-3 fatty acid synthesis in E. coli, which is cheaper and more accessible.

Synthesizing the pathway

E. coli naturally synthesize poly-unsaturated fatty acids up to a carbon chain length of 18, with a single desaturation at the 9th carbon (18:1) (Marr, Ingraham, 1969). Valuable ω-3 fatty acids require 3 double bonds, and need to have a chain length between 18 and 22 carbons. The double bonds needs to start at the thrid carbon, counting from the end of the carbon chain.

In order to have synthesize ω-3 fatty acids, we needed to introduce enzymes that could elongate and desaturate fatty acid substrates. As seen in the figure above, this pathway can be recreated by a number of desaturases and elongases.

The genes for Δ12, Δ15 (ω6) and Δ6 were obtained from Synechocystis sp., a cyanobacterium. The trypanosomatid Leishmania major provided the DNA for the ELO 6 gene. Additionally, we used Trypanosome cruzi as a secondary source of Δ12. (cf. Fig. 2)

However, our first successful ligations of Δ12 did not yield us with the expected 18:2 fatty acid. We hypothesized that E. coli’s inherent 18-carbon chain fatty acid might not be suited as a substrate for Δ12 – perhaps the double bond is in a different position. Therefore, we "fed" our cells with suitable 18:1, to then observe 18:2 fatty acid in the mass spec results!

The below figure shows the results of a PCR extraction of our genes of choice, done with GoTaq HotStart PCR kit at 2 different annealing temperatues: Δ12 (48°C) - Δ12 (56°C) - Δ15 (48°C) - Δ15 (56°C) - Δ6 (48°C) - Δ6 (56°C).

Methods

Sequences

By combining a number of genes, we were able to recreate the pathway described above (Fig. 1). The following genes were employed:

  • Δ12 from Synechocystis sp. PCC 6803, KEGG entry 429257.20

    Δ15 Synechocystis sp. PCC 6803, KEGG s111441

    ELO6 Synechocystis sp. PCC 6803, KEGG entry LmjF32.1160

    Δ12 from Trypanosome cruzi, KEGG entry 429257.20

Δ12 T. Cruzi Δ12 Synechocystis Δ15 Synechocystis Δ6 Synechocystis ELO 6 L. major

These genes were extracted using PCR (Promega, GoTaq HotStart) at temperatures 48°C and 56°C. Both vectors pET-15b and pET-20b were tested for expression. The recombinant plasmids were ligated into two E. coli strains: BL21(DE3) and BL21(DE3)pLysS.

Primers

All primers are notated 5' to 3'. Initially, we worked with NdeI and XhoI as the restriction sites.

Δ12 T. Cruzi forward
    ATATCATATGTGGCGGGTTGACAATTTA
Δ12 T. Cruzi reverse

    ATATCTCGAGTTACCCATGAAAGACAC

Δ12 Synechocystis forward
    ATATCATATGACTGCCACGATTCCC
Δ12 Synechocystis reverse
    ATATCTCGAGTTAAACTTTTTTCAGGGAGC
Δ15 Synechocystis forward
    ATATCATATCGCTCTAGAAATTTCATC
Δ15 Synechocystis reverse
    ATATCACGACTTAAGGTTTCTTTTGATATC
Δ6 Synechocystis forward
    ATATCATATGCAAACAGCGGAAAGAATT
Δ6 Synechocystis reverse
    ATATCTCGAGTAACGATGCTTTGACCATGGCCTCTAG
ELO6 L. major forward
    ATATCATATGTTCTCTCTGGAGCAGGCCGAA
ELO6 L. major reverse
    ATATCTCGAGTCATCGACTGCCTGCCATGGCCTG

When using the pET-duet vector, we needed additionally primers for the alternative restriction sites and His-tags. For Δ6 and Δ12, we cut with HindIII and EcoRI; NdeI and XhoI were used for Δ15 and ELO6.

ELO6 L. major forward
    TATCATATGGGAAGCAGCCATCATCATCATCATCACAGCATGGTCTCTCTGGAGCAGGCC
Δ15 Synechocystis sp. forward
    TATCATATGGGCAGCCATCATCATCATCATCACAGCATGCGTCTAGAAATTTCATCG
Δ6 Synechocystis sp. forward
    GGATCCGAATTCATCTAACAGCGGAAAGAATT
Δ6 Synechocystis sp. reverse
    GACAAGCTTTCACGATGCTTTGCCCATGGCCTCTAC
Δ12 Synechocystis sp. forward
    GGATCCGAATTCATGACTGCCACGATTCCC
Δ12 Synechocystis sp. reverse
    GACAAGCTTTTAAACTTTTTTCAGGGAGC

For the submission vector, we once again required new primers, using restriction sites EcoRI and PstI. For Δ6 and Δ12 forward, we used the primers from the duet vector (see above).

Δ6 Synechocystis reverse
    GTTCCTGCAGTCACGATGCTTTGCCCATGG CTCTAG
Δ15 Synechocystis forward
    GGATCCGAATTCATGCGTCTAGAAATTTCATCG
Δ15 and Δ12 Synechocystis reverse
    GTTCCTGCAGTTAAACTTTTTTCAGGGAGC

After a number of expression attempts, some initial conclusions were reached. All experiments done on ELO6 failed. Also, Δ12 from T. cruzi gave overall weaker results than the same gene from Synechocystis. As such, latter work was only carried out on genes from Synechocystis.

Δ15 was successfully expressed in pET-15b and transformed into cell strains BL21(DE3) and BL21(DE3)PlysS. However, functionality could not be established.

Additionally, a pET-duet vector expressing Δ12 and Δ15 was used to start assembling the metabolic pathway. Due to time constraints, no duet BioBrick was submitted.

Lipid analysis

Lipids were extracted from transformed E. coli using the Blight/Dyer method. (Please refer to the Lipid extraction lab book entry for further detail.)

We then analyzed the the fatty acid content of the transformed cells to determine whether it differed from the previously analyzed background lipid composition. This was done using mass spectrometry.

Mass Spectrometry

Sequencing results

16/7/12 Δ15

    Δ15 and Δ6 desaturases from Synechocystis in pET-15b were sent off for sequencing. Once again, the results were discouraging even though protein and lipid analysis showed the opposite. BLAST showed that the gene found in both samples corresponded to a T. brucei HMG-CoA reductase which we thought we had cut out from the plasmid. We thus performed a PCR, using the vectors sent off for sequencing as a template.

    Sequence

16/7/12 Δ6

    Sequence

29/6/12 ELO6

    After showing successful insertion of L. major Δ6 elongase in pET-15b, the sample was sent off for sequencing. Unfortunately, the gene sequenced was not the Δ6 elongase we were hoping to find, but a T. brucei mevalonate kinase, which was previously inserted in the pET-15b vectors we had been using. Thus, we digested some fresh pET-15b to be used in the future.

    Sequence

23/7/12 Δ12

    15b forward gave 0 nucleotides

    15b reverse gave 0 nucleotides

    20b forward gave a 41 nucleotide result.

    Sequence
      gCGnCctGntGCCgCGCGGCnnnnnnnnnnnnnnnnnngac

    A BLAST search showed this to be compatible with Crocosphaera watsonii (genome shotgun sequence, 21%), a diazotrophic cyanobacteria.

    20b reverse gave 0 nucleotides

Biobricks

TODO

References

ARTS, et al, 2009. Lipids in Aquatic Ecosystems. New York. Springer.

BENDER D. A. and BENDER, A. E, 1999. Benders' dictionary of nutrition and food technology. Cambridge: CRC Press.

COHEN, J., 2003. Human Population: The Next Half Century. Science, New Series, Vol. 302, No. 5648. Pp. 1172-1175.

GARWIN J. L. and CRONAN J. E. Jr, 1980. Thermal modulation of fatty acid synthesis in Escherichia coli does not involve de novo enzyme synthesis. J Bacteriol, 141(3): 1457–1459.

LIVORE V., TRIPODI K., UTARRO A., 2007. Elongation of polyunsaturated fatty acids in trypanosomatids. FEBS Journal, 274: 264–274.

MARR A., INGRAHAM J., 1969. Effect of temperature on the composition of fatty acids in Escherichia coli. J. Bactiol. 84(6). Pp. 1260–1267.

TONON T., et al, 2002. Long chain polyunsaturated fatty acid production and partitioning to triacylglycerols in four microalgae. Phytochemistry, Vol 61 Iss 1. Pgs 15-24.

Back to top

University of St Andrews, 2012.

Contact us: igem2012@st-andrews.ac.uk, Twitter, Facebook

This iGEM team has been funded by the MSD Scottish Life Sciences Fund. The opinions expressed by this iGEM team are those of the team members and do not necessarily represent those of Merck Sharp & Dohme Limited, nor its Affiliates.

Retrieved from "http://2012.igem.org/Team:St_Andrews/Omega-3-synthesis"