From 2012.igem.org

Revision as of 12:57, 24 September 2012

• Home
• Team
  • The Team
  • Team Registration
• Project
  • 1. Introduction
  • 2. PnA System
  • 3. Virus-Like Particles
    • CCMV
    • HepB
    • Polerovirus Natural BioBrick
  • 4. Outside Modification
  • 5. Inside Modification
  • 6. Detection of VLPs
  • 7. Applications
  • 8. The Constructor
  • 9. Final Overview
• Human Practices
  • Human Practices Home
  • 1. Mini Symposium
  • 2. Visiting Secondary Schools
  • 3. Discovery Festival
    • Communication Science
  • 4. Stakeholders
  • 5. Munich CAS Conference
• Safety
  • Introduction
  • 1. General safety
  • 2. Virus-related safety
  • 3. Regulations
  • 4. Safety suggestions
  • 5. Safety of applications
• Modeling
  • Human Body Model
  • Tertiary folding prediction
  • VLP assembly model
• Attributions
• Parts
• Notebook
  • Journal
  • Protocols

---

Last year's project: Synchronized Oscillatory System

iGEM Home

Contact Us

Our Sponsors:

week 14: 30 july - 5 august

Lab work

General

PCR st.10 Berkeley KILR

Follow up of the experiment started in week 9 to switch the BBa_K197022 into a iGEM standard 10 compatible pSB1C3 backbone. Two self-designed primers were used to amplify the KILR construct out of the original BBa_K197038 backbone .

• FW primer Berkeley KILR: 5’ GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGATCTGTTAAAGAACTGGAAGACAAAAA 3’
• BW primer Berkeley KILR: 5’ TACTAGTAGCGGCCGCTGCAGGAAGAAACCGCAACCACCACGTTCAC 3’

PCR purification of the two samples with a kit of Thermo Scientific (yield: ca. 40 ng/µl)

digestion PCR product Berkeley coil

Prerequired step for the final ligation into pSB1C3. Both donor backbone (BBa_J04450) and the PCR product were digested with the same approach by using the restriction enzymes EcoRI and PstI. Using PstI requires another PCR purification (yield: ca.15 ng/ µl) before ligation and transformation.

Hepatitis B

30.July

• Miniprepping of successful transformants from the transformation (Hep B + BBa_J04500)
• Digestion check of those minipreps

1.August

-> the digestion check was repeated 2 times (once with a longer incubation time and once with a higher amount of DNA in the digestion mixture) until the insert size could be seen on the gel

Figure 1: digestion check 1.August

-> the digestion check confirmed the right insert sizes in the samples they where expected (around 800bp)

TuYV

• The four 'brickable' TuYV CP gene amplicons (1,1H,4,4H) were digested, ligated into the backbone from BBa_J04450, which is ampicillin resistant and transformed into our electrocompetent Mach1 E coli.
• Colony check: We saw many colonies on all 4 sample plates this time.
• We did two colony PCR to check the samples, but we got negative results from the colony PCR. Even so, we still continued to miniprep those colonoes which were used for colony PCR and checked them with normal PCR later, this time we saw expected bands for all 4 samples, which should be around 600bp for 1(TuYV coat protein) and 1H(TuYV coat protein with his-tag) and 800bp for 4(TuYV coat protein with partial readthrough) and 4H (TuYV coat protein with partial readthrough with his-tag).

Figure 2: PCR check for the TuYV constructs 1, 1H 4, and 4H in the pSB1A3 backbone

PLRV

The PCR products obtained after Reverse Transcription followed by PCR were used as template to add iGEM prefix and suffix. The products were inserted into the backbone with Ampicilin/Kanamycin resistance.

Also the PLRV coat protein plus read trough (PLRV CP_RT) was obtained by PCR reactions. We wanted to add iGEM prefix and suffix to that gene but after successful addition we found out that there are two illegal restriction sites in the read through part. This was concluded from the DNA sequences available in the GenBank database.

[previous week] [next week]