Team:St Andrews/metal-binding

From 2012.igem.org

(Difference between revisions)
(Background watermark, like on HP page)
(added in procedure html)
Line 68: Line 68:
<h2>Synthesizing metal-binding peptides</h2>
<h2>Synthesizing metal-binding peptides</h2>
<p>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Fusce commodo convallis mollis. Vivamus vestibulum consequat consectetur. Aenean et dolor lorem, sed laoreet risus. Duis et gravida sapien. Donec sit amet est dignissim sapien condimentum posuere non eu ante.</p>
<p>Lorem ipsum dolor sit amet, consectetur adipiscing elit. Fusce commodo convallis mollis. Vivamus vestibulum consequat consectetur. Aenean et dolor lorem, sed laoreet risus. Duis et gravida sapien. Donec sit amet est dignissim sapien condimentum posuere non eu ante.</p>
-
<p>Please see the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book">Lab Book</a>.</p>
+
<p><span class="label label-info"><a href="#Primers2"><font color="white">Primers</font></a></span>&nbsp;<span class="label label-info"><a href="#Digestion2"><font color="white">Digestion</font></a></span>&nbsp;<span class="label label-info"><a href="#Transformation2"><font color="white">Transformation</font></a></span></p>
 +
 
 +
<BR>&nbsp;</BR>
 +
<a name="Primers2"><span class="label label-info">Primers</span></a>
 +
 
 +
<BR>&nbsp;</BR>
 +
<p>All primers are notated 5' to 3'.</p>
 +
 
 +
<p>Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book#Primer annealing"><strong>Primer annealing lab book entry</strong></a> for further detail.</p>
 +
<p> </p>
 +
<div class="btn-toolbar">
 +
<div class="btn-group">
 +
  <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
 +
  Ni forward
 +
    <span class="caret"></span>
 +
  </a>
 +
  <ul class="dropdown-menu">
 +
    <div class="span3">AATTCCATCATCACCATCACCACC</ul>
 +
</div>
 +
 
 +
<div class="btn-group">
 +
  <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
 +
    Ni reverse
 +
    <span class="caret"></span>
 +
  </a>
 +
  <ul class="dropdown-menu">
 +
  <p><div class="span3">TCGAGGTGGTGATCGTGATGATGG</div></p> 
 +
  </ul>
 +
</div>
 +
 
 +
<div class="btn-group">
 +
  <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
 +
    Ni<sub>2</sub> forward
 +
    <span class="caret"></span>
 +
  </a>
 +
  <ul class="dropdown-menu">
 +
      <div class="span4">AATTCATGTGTACAACATGCGGTTGCGGTGAAGGCC</div>
 +
  </ul>
 +
</div>
 +
 
 +
<div class="btn-group">
 +
  <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
 +
    Ni<sub>2</sub> reverse
 +
    <span class="caret"></span>
 +
  </a>
 +
  <ul class="dropdown-menu">
 +
      <div class="span4">TCGAGGCCTTCACCGCAACCGCATGTTGTACACATG</div>
 +
  </ul>
 +
</div>.
 +
</div>
 +
 
 +
<p>
 +
<div class="btn-toolbar">
 +
<div class="btn-group">
 +
  <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
 +
    Pd forward
 +
    <span class="caret"></span>
 +
  </a>
 +
  <ul class="dropdown-menu">
 +
      <div class="span3">AGCGTGACCCAGAACAAATAT</div>
 +
  </ul>
 +
</div>
 +
 
 +
<div class="btn-group">
 +
  <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
 +
    Pd reverse
 +
    <span class="caret"></span>
 +
  </a>
 +
  <ul class="dropdown-menu">
 +
      <div class="span3">ATATTTGTTCTGGGTCACGCT</div>
 +
  </ul>
 +
</div>
 +
 
 +
<div class="btn-group">
 +
  <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
 +
    Pt forward
 +
    <span class="caret"></span>
 +
  </a>
 +
  <ul class="dropdown-menu">
 +
<div class="span3">GATCGCACCAGCACCTGGCGC</div>
 +
  </ul>
 +
</div>
 +
 
 +
<div class="btn-group">
 +
  <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
 +
    Pt reverse
 +
    <span class="caret"></span>
 +
  </a>
 +
  <ul class="dropdown-menu">
 +
  <div class="span3">GCGCCAGGTGCTGGTGCGATC</div>
 +
  </ul>
 +
</div></p>
 +
</div>
 +
 
 +
<BR>&nbsp;</BR>
 +
 
 +
<p>For primer annealing in the PCR, the primer sequences were combined in the following way:</p>
 +
 
 +
<p>Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book"><strong>Primer annealing lab book entry</strong></a> for further detail.</p>
 +
 
 +
<li><strong>GST Forward</strong> and <strong>Ni Reverse</strong></li>
 +
<li><strong>GST Forward</strong> and <strong>Ni<sub>2</sub> Reverse</strong></li>
 +
<li><strong>GST Forward</strong> and <strong>Pd Reverse</strong></li>
 +
<li><strong>GST Forward</strong> and <strong>Pt Reverse</strong></li>
 +
 
 +
<BR>&nbsp;</BR>
 +
<a name="Digestion2"><span class="label label-info">Digestion</span></a>
 +
 
 +
<BR>&nbsp;</BR>
 +
<p>pGEX-6P-1 was cut using EcoR1(954) and Xho1 (975)</p>
 +
 
 +
<BR>&nbsp;</BR>
 +
 
 +
<a name="Transformation2"><span class="label label-info">Transformation</span></a>
 +
<BR>&nbsp;</BR>
 +
<p>pGEX vector with insert transformed into DH5α E. coli cells to replicate.</p>
 +
<p>pGEX vector with G-Block insert transformed into DH5α E. coli cells to replicate.</p>
 +
<BR>&nbsp;</BR>
 +
<p>pGEX vector with insert transformed into BL21 E. coli cells for protein expression.</p>
 +
<p>pGEX vector with G-Block insert transformed into BL21 E. coli cells for protein expression.</p>
 +
 
</section>
</section>

Revision as of 11:51, 23 September 2012

Metal binding protein

Precious and toxic metals frequently find their way into the environment. As their names suggest this is wasteful and damaging respectively. St Andrews iGEM '12 plans to take the first steps towards solving this problem using synthetic biology.



Project Description

The human race moved from the stone of the Neolithic period and into the metallurgy of the Chalcolithic period with the widespread use of metal tools in their every day work regime (Gale 1991). From here little changed over the next 6,000 years where metals are still a massive part of our everyday lives but in quantities that dwarf previous usages. These high levels of metal requirements have left the landscape scarred.

Our project was inspired by the work done in the identification of platinum and palladium particles that are present on roads; emitted from catalytic converters (Deplanche, Murray et al. ). In 2010 50% of the worlds production of platinum and palladium were used for catalytic converters, with the highest amount being in Europe (Jollie 2010). Platinum and palladium appear ion the roads in small concentrations and in minute particles, < 3 μm (Prichard, Fisher 2012). These precious elements are a finite resource meaning that once its gone its gone. This doesn’t have to be the case, as the metals can be collected up and recycled.

The collection process is what we have been focussing on specifically. We have worked in a similar way to Chung et al, in that we have produced a protein with a metal binding peptide on the N-terminus of an easily expressible protein (Chan Chung, Cao et al. 2008). The difference is that we used glutathione S-transferase (GST tag) rather than ubiquitin, and instead of adding the binding peptide chemically to the protein we expressed both the protein and the peptide in E. Coli BL21 (DE3) cells. The peptides were taken from various sources (Seker, Demir 2011, Bae, Chen et al. 2000, Song, Caguiat et al. 2004, White, Liljestrand et al. 2007) and back translated specifically for E. coli using an online program Protein to DNA.

We decided to go down two different routes. The first was making an array of protein that bind a specific metal, and the second was to make a protein that has multiple metal binding sites.

With the first of the two ideas we thought that it would be possible to make a column, using the GST tag to bind the proteins in place. A solution containing multiple metal ions would then be passed through the column and bind each metal ion specifically. We initially looked at binding palladium, platinum and nickel (Seker, Demir 2011). The choice to use these metals was first, because platinum and palladium are the precious metals we were initially looking at, and second, because nickel columns were readily available to test this idea.

The second Idea is more of a scavenging protein. gBlocks (≤ 500 bps) were specifically designed and inserted into a pGEX-6P-1. One of them was designed to bind toxic metals; cadmium, mercury and cobalt (Seker, Demir 2011, Bae, Chen et al. 2000, Song, Caguiat et al. 2004, White, Liljestrand et al. 2007). This was done by inserting flexible linkers between the metal binding sites (Hu, Wang et al. 2007). The linkers were used because they were quite flexible. This prevented hairpins in the structure. The second gBlock designed was for precious metals, not including platinum and palladium. The corresponding base pairs for gold, silver, aluminum and titanium peptides (Seker, Demir 2011) were used. The design of this differed from the other gBlock as myoglobin was hijacked, the loops removed and replaced with our metal binding peptides. .


Synthesizing metal-binding peptides

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Fusce commodo convallis mollis. Vivamus vestibulum consequat consectetur. Aenean et dolor lorem, sed laoreet risus. Duis et gravida sapien. Donec sit amet est dignissim sapien condimentum posuere non eu ante.

Primers Digestion Transformation


 
Primers
 

All primers are notated 5' to 3'.

Please refer to the Primer annealing lab book entry for further detail.

Ni forward
Ni reverse
Ni2 forward
Ni2 reverse
.

Pd forward
Pd reverse
Pt forward
Pt reverse


 

For primer annealing in the PCR, the primer sequences were combined in the following way:

Please refer to the Primer annealing lab book entry for further detail.

  • GST Forward and Ni Reverse
  • GST Forward and Ni2 Reverse
  • GST Forward and Pd Reverse
  • GST Forward and Pt Reverse

  •  
    Digestion
     

    pGEX-6P-1 was cut using EcoR1(954) and Xho1 (975)


     
    Transformation
     

    pGEX vector with insert transformed into DH5α E. coli cells to replicate.

    pGEX vector with G-Block insert transformed into DH5α E. coli cells to replicate.


     

    pGEX vector with insert transformed into BL21 E. coli cells for protein expression.

    pGEX vector with G-Block insert transformed into BL21 E. coli cells for protein expression.


    Biobricks


    References

    BAE, W., CHEN, W., MULCHANDANI, A. and MEHRA, R.K., 2000. Enhanced bioaccumulation of heavy metals by bacterial cells displaying synthetic phytochelatins. Biotechnology and bioengineering, 70(5), pp. 518-524.

    CHAN CHUNG, K.C., CAO, L., DIAS, A.V., PICKERING, I.J., GEORGE, G.N. and ZAMBLE, D.B., 2008. A high-affinity metal-binding peptide from Escherichia coli HypB. Journal of the American Chemical Society, 130(43), pp. 14056-14057.

    DEPLANCHE, K., MURRAY, A., MENNAN, C., TAYLOR, S. and MACASKIE, L., Biorecycling of Precious Metals and Rare Earth Elements.

    GALE, N.H., 1991. Metals and metallurgy in the Chalcolithic period. Bulletin of the American Schools of Oriental Research, , pp. 37-61.

    HU, X., WANG, H., KE, H. and KUHLMAN, B., 2007. High-resolution design of a protein loop. Proceedings of the National Academy of Sciences, 104(45), pp. 17668.

    JOLLIE, D., 2010. Platinum 2010. Johnson Matthey.

    PRICHARD, H.M. and FISHER, P.C., 2012. Identification of platinum and palladium particles emitted from vehicles and dispersed into the surface environment. Environmental science & technology, .

    SEKER, U.O.S. and DEMIR, H.V., 2011. Material binding peptides for nanotechnology. Molecules, 16(2), pp. 1426-1451.

    SONG, L., CAGUIAT, J., LI, Z., SHOKES, J., SCOTT, R.A., OLLIFF, L. and SUMMERS, A.O., 2004. Engineered single-chain, antiparallel, coiled coil mimics the MerR metal binding site. Journal of Bacteriology, 186(6), pp. 1861-1868.

    WHITE, B.R., LILJESTRAND, H.M. and HOLCOMBE, J.A., 2007. A ‘turn-on’FRET peptide sensor based on the mercury binding protein MerP. Analyst, 133(1), pp. 65-70.

    Back to top

    University of St Andrews, 2012.

    Contact us: igem2012@st-andrews.ac.uk, Twitter, Facebook

    This iGEM team has been funded by the MSD Scottish Life Sciences Fund. The opinions expressed by this iGEM team are those of the team members and do not necessarily represent those of Merck Sharp & Dohme Limited, nor its Affiliates.