Team:TU Munich/Project/Limonene
From 2012.igem.org
(→Background and principles) |
|||
Line 3: | Line 3: | ||
=Limonene= | =Limonene= | ||
- | ==Background and principles== | + | == Background and principles == |
- | ===Limonene=== is a cyclic terpene and a major constituent of several citrus oils (orange, lemon, mandarin, lime and grapefruit). It is a chiral molecule; citrus fruits contain the (R)-enantiomer. The (R)-enantiomer smells like oranges, while the (S)-enantionmer has a piney, turpentine-like odor. D-Limonene is used as a component of flavorings and fragrances. It has been shown to inhibit rat mammary and other tumor development (Tsuda et al. 2004). Being an excellent solvent of cholesterol, d-limonene also has been used clinically to dissolve cholesterol-containing gallstones. Because of its gastric acid neutralizing effect and its support of normal peristalsis, it has also been used for relief of heartburn (Sun 2007). | + | === Limonene === |
+ | Limonene is a cyclic terpene and a major constituent of several citrus oils (orange, lemon, mandarin, lime and grapefruit). It is a chiral molecule; citrus fruits contain the (R)-enantiomer. The (R)-enantiomer smells like oranges, while the (S)-enantionmer has a piney, turpentine-like odor. D-Limonene is used as a component of flavorings and fragrances. It has been shown to inhibit rat mammary and other tumor development (Tsuda et al. 2004). Being an excellent solvent of cholesterol, d-limonene also has been used clinically to dissolve cholesterol-containing gallstones. Because of its gastric acid neutralizing effect and its support of normal peristalsis, it has also been used for relief of heartburn (Sun 2007). | ||
- | ===Biosynthesis=== | + | === Biosynthesis === |
Limonene is formed from geranyl pyrophosphat by limonene synthase. (R)-limonene synthase 1 consists of 606 aminoacids (sequence shown below, EC=4.2.3.20). (R)-limonene synthase needs magnesium or manganese as cofactor and catalyzes the following reaction: Geranyl pyrophosphate = (+)-(4R)-limonene + diphosphate. | Limonene is formed from geranyl pyrophosphat by limonene synthase. (R)-limonene synthase 1 consists of 606 aminoacids (sequence shown below, EC=4.2.3.20). (R)-limonene synthase needs magnesium or manganese as cofactor and catalyzes the following reaction: Geranyl pyrophosphate = (+)-(4R)-limonene + diphosphate. |
Revision as of 12:22, 15 August 2012
Contents |
Limonene
Background and principles
Limonene
Limonene is a cyclic terpene and a major constituent of several citrus oils (orange, lemon, mandarin, lime and grapefruit). It is a chiral molecule; citrus fruits contain the (R)-enantiomer. The (R)-enantiomer smells like oranges, while the (S)-enantionmer has a piney, turpentine-like odor. D-Limonene is used as a component of flavorings and fragrances. It has been shown to inhibit rat mammary and other tumor development (Tsuda et al. 2004). Being an excellent solvent of cholesterol, d-limonene also has been used clinically to dissolve cholesterol-containing gallstones. Because of its gastric acid neutralizing effect and its support of normal peristalsis, it has also been used for relief of heartburn (Sun 2007).
Biosynthesis
Limonene is formed from geranyl pyrophosphat by limonene synthase. (R)-limonene synthase 1 consists of 606 aminoacids (sequence shown below, EC=4.2.3.20). (R)-limonene synthase needs magnesium or manganese as cofactor and catalyzes the following reaction: Geranyl pyrophosphate = (+)-(4R)-limonene + diphosphate.
File:ReactionLimoneneSynthase.jpg
Idea
Producing the flavoring substance limonene in our beer might result in a fresh, lemon-like taste on the one hand. On the other hand, we might have health beneficial effects like preventive activity against cancer, dissolution of gallstones and relief of heartburn.
Limonene can be produced by (R)-limonene synthase.
General remarks and issues
We should ask professor Schwab whether he has suitable plasmids for us or not.
Biobricks and sequences
File:SequenceLimoneneSynthase.jpg
Citrus limon (+)-limonene synthase 1 mRNA, complete cds
1 ggccaagtat aactgtaagc tagcttacac tacatctgta tatccaatgt cttcttgcat 61 taatccctca accttggtta cctctgtaaa tgctttcaaa tgtcttcctc ttgcaacaaa 121 taaagcagcc atcagaatca tggccaaata taagccagtc caatgcctta tcagcgccaa 181 atatgataat ttgacagttg ataggagatc agcaaactac caaccttcaa tttgggacca 241 cgattttttg cagtcattga atagcaacta tacggatgaa gcatacaaaa gacgagcaga 301 agagctgagg ggaaaagtga agatagcgat taaggatgta atcgagcctc tggatcagtt 361 ggagctgatt gataacttgc aaagacttgg attggctcat cgttttgaga ctgagattag 421 gaacatattg aataatatct acaacaataa taaagattat aattggagaa aagaaaatct 481 gtatgcaacc tcccttgaat tcagactact tagacaacat ggctatcctg tttctcaaga 541 ggttttcaat ggttttaaag acgaccaggg aggcttcatt tgtgatgatt tcaagggaat 601 actgagcttg catgaagctt cgtattacag cttagaagga gaaagcatca tggaggaggc 661 ctggcaattt actagtaaac atcttaaaga agtgatgatc agcaagaaca tggaagagga 721 tgtatttgta gcagaacaag cgaagcgtgc actggagctc cctctgcatt ggaaagtgcc 781 aatgttagag gcaaggtggt tcatacacat ttatgagaga agagaggaca agaaccacct 841 tttacttgag ctcgctaaga tggagtttaa cactttgcag gcaatttacc aggaagaact 901 aaaagaaatt tcagggtggt ggaaggatac aggtcttgga gagaaattga gctttgcgag 961 gaacaggttg gtagcgtcct tcttatggag catggggatc gcgtttgagc ctcaattcgc 1021 ctactgcagg agagtgctca caatctcgat agccctaatt acagtgattg atgacattta 1081 tgatgtctat ggaacattgg atgaacttga gatattcact gatgctgttg agaggtggga 1141 catcaattat gctttgaagc accttccggg ctatatgaaa atgtgttttc ttgcgcttta 1201 caactttgtt aatgaatttg cttattacgt tctcaaacaa caggattttg atttgcttct 1261 gagcataaaa aatgcatggc ttggcttaat acaagcctac ttggtggagg cgaaatggta 1321 ccatagcaag tacacaccga aactggaaga atacttggaa aatggattgg tatcaataac 1381 gggcccttta attataacga tttcatatct ttctggtaca aatccaatca ttaagaagga 1441 actggaattt ctagaaagta atccagatat agttcactgg tcatccaaga ttttccgtct 1501 gcaagatgat ttgggaactt catcggacga gatacagaga ggggatgttc cgaaatcaat 1561 ccagtgttac atgcatgaaa ctggtgcctc agaggaagtt gctcgtcaac acatcaagga 1621 tatgatgaga cagatgtgga agaaggtgaa tgcatacaca gccgataaag actctccctt 1681 gactggaaca actactgagt tcctcttgaa tcttgtgaga atgtcccatt ttatgtatct 1741 acatggagat gggcatggtg ttcaaaacca agagactatc gatgtcggtt ttacattgct 1801 ttttcagccc attcccttgg aggacaaaca catggctttc acagcatctc ctggcaccaa 1861 aggctgatga tgaattataa tgcatgatgc gttgcgaatt cccagagagt gcagtttcag 1921 ttgatgttgg cctccacttt tctttcttct gagggatctc ttttcgataa taaaataaat 1981 tccctcattc aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2041 aaa
Name | Length | RFC10 | RFC25 | Codon Usage | NCBI |
(+)-Limonene Synthase 1 | 2043bp | 2x EcoRI (497-503/1896-1902) 1x SpeI (671-677) 1x PstI(1024-1030) 1x XbaI (1450-1456) | ok after RFC10 | 1 AS < 10% | [http://www.ncbi.nlm.nih.gov/nuccore/21435702 AF514287.1] |
Lavandula limonene synthase, plasmid provided by Prof. Schwab
GAAACCCGACGCTCCGGAAACTACAACCCTACCGCTTGGGATTT CAACTACATCCAATCCCTCGACAATCAGTATAAGAAAGAGAGGTACTCGA CAAGACACGCTGAGCTGACTGTGCAAGTGAAGAAGCTGCTGGAGGAAGAA ATGGAAGCGGTTCAAAAGTTGGAATTGATTGAGGATTTGAAGAACCTGGG AATATCTTACCCATTTAAGGACAATATCCAACAGATTTTAAATCAAATAT ATAATGAGCACAAATGTTGCCACAACAGTGAAGTGGAAGAAAAGGATTTG TATTTCACGGCTCTTCGATTCCGACTCCTTAGACAACAGGGTTTTGAAGT CTCTCAAGAAGTATTTGATCATTTCAAGAACGAGAAGGGTACAGATTTCA AGCCAAACCTTGCTGACGATACTAAAGGACTATTGCAACTTTACGAAGCA TCTTTCCTATTAAGAGAAGCTGAAGATACACTTGAGTTAGCTCGACAATT TTCAACCAAATTACTGCAGAAAAAAGTCGATGAGAATGGTGATGATAAAA TAGAGGATAATCTATTATTATGGATTCGCCGTTCTTTGGAGCTCCCGCTT CATTGGAGGGTGCAAAGGCTAGAAGCAAGAGGGTTCTTGGATGCTTACGT TAGAAGGCCCGACATGAATCCAATTGTTTTTGAGCTCGCCAAACTCGACT TCAATATTACCCAAGCAACACAACAAGAAGAACTGAAAGATCTCTCGAGG TGGTGGAATAGTACAGGCCTTGCCGAAAAACTCCCATTCGCGAGGGATCG GGTTGTTGAGTCCTACTTCTGGGCAATGGGAACCTTTGAGCCTCATCAAT ATGGTTATCAGAGAGAACTTGTCGCCAAGATTATTGCTCTAGCAACAGTT GTAGATGATGTTTACGATGTATATGGTACGTTAGAGGAACTGGAACTATT TACAGATGCCATTCGGAGATGGGATCGTGAATCAATCGACCAACTTCCTT ACTACATGCAGCTATGCTTTTTGACTGTCAACAACTTTGTTTTCGAGCTT GCTCATGATGTTCTTAAGGATAAGAGTTTCAACTGCTTACCACATTTACA GAGATCGTGGCTAGACTTGGCTGAAGCATATCTTGTCGAGGCTAAGTGGT ACCACAGTAGATATACACCGAGCCTCGAGGAATATCTCAATATTGCAAGA GTTTCAGTTACGTGTCCCACTATAGTTTCACAAATGTACTTTGCATTACC AATTCCGATAGAGAAACCGGTCATCGAGATCATGTACAAATACCACGACA TACTTTACCTCTCAGGAATGCTTCTAAGGCTTCCTGATGATCTAGGAACA GCATCGTTTGAGTTGAAGAGAGGTGATGTGCAAAAAGCAGTCCAGTGTTA TATGAAGGAAAGAAATGTTCCTGAAAATGAGGCACGAGAACATGTGAAGT TTCTGATTCGGGAGGCGTCGAAGCAGATAAACACCGCGATGGCGACCGAT TGTCCATTTACTGAAGATTTTGCTGTGGCTGCAGCGAATCTTGGAAGAGT GGCGAATTTTGTGTACGTCGACGGAGATGGTTTTGGCGTGCAACACTCAA AAATATATGAACAGATTGGAACCCTGATGTTCGAGCCATATCCCTAA
Name | Length | RFC10 | RFC25 | Codon Usage | NCBI |
lavendula angustifolia limonene synthase | 1641 bp | 2x PstI | ok after RFC10 | 4 AS < 10% | [http://www.ncbi.nlm.nih.gov/nucleotide/82408410?report=genbank&log$=nucltop&blast_rank=1&RID=TXMYMNC0012] |
(pET29a and pGEX4T1 plasmids contain synthase gene)
Note: The posted sequence above still contains an N- terminal signal sequence for transport in plastids (of plants), which we do not need. The plasmids from Prof. Schwab do not have these signal sequences and therfore they do not have any start codons, either. We will have to generate the ATG start- codon by adequate primer- design. (Roman)
References
Herrero O, Ramón D, Orejas M: Engineering the Saccharomyces cerevisiae isoprenoid pathway for de novo production of aromatic monoterpenes in wine. Metab Eng 2008 10:78-86.
Lücker J, Tamer M, Schwab W, Verstappen F, Van der Plas L, Bouwmeester H and Verhoeven H: Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases. Eur J Biochem 2002 269:3160-3171.
Sun J: D-Limonene: Safety and Clinical Applications. Altern Med Rev 2007 12(3):259-264.
Tsuda H, Ohshim Y, Nomoto H, Fujita K, Matsuda E, Iigo M, Takasuka N, Moore M: Cancer Prevention by Natural Compounds. Drug Metab Pharmacokin 2004 19(4):245-263.