From 2012.igem.org

Revision as of 10:52, 26 October 2012

• Home
• Team
  • The Team
  • Team Registration
• Project
  • 1. Introduction
  • 2. PnA System
  • 3. Virus-Like Particles
    • CCMV
    • HepB
    • Polerovirus Natural BioBrick
  • 4. Outside Modification
  • 5. Inside Modification
  • 6. Detection of VLPs
  • 7. Applications
  • 8. The Constructor
  • 9. Final Overview
• Human Practices
  • Human Practices Home
  • 1. Mini Symposium
  • 2. Visiting Secondary Schools
  • 3. Discovery Festival
    • Communication Science
  • 4. Stakeholders
  • 5. Munich CAS Conference
• Safety
  • Introduction
  • 1. General safety
  • 2. Virus-related safety
  • 3. Regulations
  • 4. Safety suggestions
  • 5. Safety of applications
• Modeling
  • Human Body Model
  • Tertiary folding prediction
  • VLP assembly model
• Attributions
• Parts
• Notebook
  • Journal
  • Protocols

---

Last year's project: Synchronized Oscillatory System

iGEM Home

Contact Us

Our Sponsors:

Week 25: 15 october - 21 october

GFP modification

15 October

• 3rd time growing JM109 containing our biobricks BBa_K883702 (GFP coil with an IPTG induced promoter) and BBa_K883703 (GFP coil + His tag with an IPTG induced promoter) and induce expression with IPTG with new medium

-> no GFP production could be seen

16 October

• to check if there are any colonies showing green fluorescence on the original plate (of the transformation on 21.September GFPcoil; GFPcoil + his tag in Bba_J04500 (IPTG induced promoter) in JM109), colonies where picked randomly and plated on agarplates containing IPTG next to the selection antibiotic

-> some colonies containing GFPcoil with an IPTG induced promoter show green fluorescence

Figure 1: 3 colonies containing GFPcoil with an IPTG induced promoter show a slight green colour in normal daylight'

• plate the JM109 samples that where used for sending the bricks in to the registry - containing BBa_K883702(GFPcoil with IPTG induced promoter) and BBa_K883703 (GFPcoil + His tag with IPTG induced promoter) on agarplates containing IPTG next to the selection antibiotic

-> culture containing BBa_K883702(GFPcoil with IPTG induced promoter) shows green fluorescence

Figure 2: BBa_K883702(GFPcoil with IPTG induced promoter)in JM109 [left] shows some green fluorescence whereas for BBa_K883703 (GFPcoil + His tag with IPTG induced promoter) in JM109 [right] no fluorescence can be seen '

• grow colonies containing the biobricks BBa_K883702 BBa_K883703 BBa_K883701 and BBa_K883700

• grow colonies containing BBa_K883702 and BBa_K883703 in duplo once with IPTG in the medium and once adding IPTG (fresh stock solution) to the culture at OD=0.6

• miniprep of the colonies containing BBa_K883702 BBa_K883703 BBa_K883701 and BBa_K883700

• 2nd try to send the bricks BBa_K883702 BBa_K883703 BBa_K883701 and BBa_K883700 in for sequencing

-> sequencing revealed that BBa_K883702 and BBa_K883703 had the expected sequence but BBa_K883701 and BBa_K883700 where faulty - therefore we deleted these two bricks from the registry

18 October

• transformation of BBa_K883702 with BL21 (producing strain) - plating the transformants on plates containing IPTG

19 October

• colony PCR of the transformation BBa_K883702 with BL21 using sequencing primers and plating the picked colonies again on a plate containing IPTG

-> all the colonies picked had the correct insert and showed fluorescence under the UV light

Figure 3: the transformation was successful since all the colonies on the plate show slight green fluorescence.'

Figure 4: the colony PCR shows that all picked colonies had the correct insert size. Bba_I13522 was used as a positive control and reference.'

• transformation of BBa_K883703 (GFPcoil + his tag + IPTG promoter) with BL21 (producing strain)

• digestion of BBa_K883702 as well as BBa_K883703 and ligation with the pSB1C3 backbone (originating from BBa_J04450). These constructs where than transformed with DH5α and plated on plate containing IPTG.

• plate JM109 containing the faulty brick BBa_K883700 and BBa_K883701 again to check if there are different colonies present containing different inserts

-> on the plate containg BBa_K883700 there where even red colonies growing on the plate (from original plasmid BBa_J04450 of the pSB1C3 backbone and encode for RFP with a constitutive promoter) so clearly there was a mistake done with picking single colonies from the tranformants

21 October

• innoculate 2x45ml medium with 10ml culture containing GFPcoil with an IPTG promoter. After an OD of around 0.5 was reached IPTG was added and the batch was incubated overnight

-> no fluorescence could be seen in the fluid or the pellet

• Colony PCR of the transformation from 19. October (BBa_K883703 (GFPcoil + his tag + IPTG promoter) with BL21; BBa_K883702 and BBa_K883703 in the pSB1C3 backbone

Figure 5: some of the picked colonies had an insert of the right size.'

Figure 6: transformation of the ligation of BBa_K883702 with the pSB1C3 backbone in DH5α. The red colonies contain the original plasmid BBa_J04450 of the pSB1C3 backbone and encode for RFP with a constitutive promoter, the green colonies contain the successful ligation product with the RFP encoding gene cut out and the GFPcoil + IPTG promoter ligated into the backbone (examples marked with an arrow). The circled ones are picked colonies'

-> comapring these two outcomes together it can be concluded that colony nr. 1 of the GFPcoil in pSB1C3 backbone in DH5α transformants (first lane second row in figure 5; left arrow to the circle in picture 6) has the correct insert and the GFP is functioning

• pick white colonies from the plate with JM109 containing the faulty brick BBa_K883700 and BBa_K883701 (from 19.october) and plate them again to seperate the cultures

Hepatitis B inside modification

15 October

• PCR check of the PCR fragment obtained on 27.August

Figure 7: The purified PCR fragment contains fragments of the correct size as well as a bigger fragment. The nonpurified sample shows only a smear.'

• ligation of the PCR product in pJET

• transformation with DH5α

-> there was growth on the negative control plate

CCMV K-coil frameshift correction

Directly after the European Jamboree we ordered two new primers to correct the frameshifts of the CCMV wt K-coil construct and the CCMV Δ26 K-coil construct. With these two primers we are able to repeat our extension-PCR scheme. To prevent new and unwanted frameshifts the primers were designed to anneal at the [http://partsregistry.org/Part:BBa_K883000 BBa_K883000] which is coding for the wildtype coat protein of CCMV and has a confirmed DNA-sequence. Additionally the resulting constructs were checked with Expasy translate to find unnecessary STOP-codons.

CCMV wt K-coil FW1: 5' TGGTGGTGGTTCTGGTGGTGGTGGTTCTGCTGCTGCTATGGGTACAGTCGGAACAGG 3'

CCMV Δ26 K-coil FW1: 5'TGGTGGTGGTTCTGGTGGTGGTGGTTCTGCTGCTGCTGTGGTCCAACCTGTTATTGTAGA 3'

PCR step I

<p align="justify">Figure 8: successful first PCR step to fuse the K-coil to our two constructs

PCR step II

PCR step III PCR step IV

PLRV

Using last weeks transformed BL-21 cells, we started a second attempt at producing VLPs. We used the culturing protocol and the dialysis protocol. We were afraid that with our Polero buffer, we might lose our product already in step 5 of the dialysis protocol (the supernatant of step 4). Therefore, we split up the batch. Half of it followed the normal protocols (but with 50% voluemes), the other half of the cells were resuspended directly in 8M urea in step 1 and skipped steps 4 and 5.

We also sequenced our BioBrick BBa_K883401: PLRV CP (isolated from Agria potato leaf) under the IPTG inducible promotor BBa_J04500, in the pSB1AK3 backbone. The results were positive: It is exactly what it is supposed to be!

[previous week] [next week]